ID: 958989016

View in Genome Browser
Species Human (GRCh38)
Location 3:100820007-100820029
Sequence ACCTATATGCAGAAAATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958989016 Original CRISPR ACCTATATGCAGAAAATGCA AGG Intronic
910155888 1:84219016-84219038 ACTAATATGCAGAATATACAAGG - Intronic
910922735 1:92366813-92366835 ACCTATTTCCAGAAATTGCAGGG - Intronic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
912032137 1:105261984-105262006 GCCCATATCCAGAATATGCAAGG - Intergenic
914852492 1:151325394-151325416 ACCTAGAATCAGAAAATGAATGG + Intronic
915496970 1:156288781-156288803 ACCTATTGGGAGAAAATGCAAGG - Intronic
917223216 1:172754026-172754048 ACCTAGAAGCAGGAAATGCTTGG - Intergenic
917398231 1:174617549-174617571 ACCTAAAAGTAGAAGATGCATGG - Intronic
917882556 1:179352436-179352458 CCCTATATGCACAAAAAGCCTGG - Intronic
918934667 1:190906115-190906137 ATTAATATGCAGAAAATACATGG - Intergenic
921014693 1:211178045-211178067 ATCTAAATGCAGAAAAGGTACGG + Intergenic
921596505 1:217059708-217059730 ACCAATTTGCAGGAAATACAGGG + Intronic
921720766 1:218468437-218468459 ACTTATATACAGAAAATAAAAGG - Intergenic
922674022 1:227540254-227540276 AGCTACATGCAGAAGATGGATGG + Intergenic
923192965 1:231638214-231638236 AACAATATCCAGAATATGCAAGG - Intronic
923861660 1:237897911-237897933 ACCTATATGCAGGTTCTGCAGGG - Intergenic
924583028 1:245337805-245337827 ACCTTTATGCAGCCACTGCATGG - Intronic
1063654899 10:7978696-7978718 GCCCATATGCAGAATTTGCATGG - Intronic
1064143702 10:12810816-12810838 ACCAACATGCAGAAAAATCAGGG - Intronic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067361051 10:45579198-45579220 ACATATATGCATAAAAAGAAAGG + Intronic
1067916858 10:50409005-50409027 ATCTATATGAATAAAATGAATGG - Intronic
1068881954 10:62059356-62059378 ACCAAAATGGAGAACATGCAAGG + Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1070254891 10:74805493-74805515 ACCTCAATTCAGAAAATTCAGGG + Intergenic
1070991418 10:80735984-80736006 ACCGATTTTCAGGAAATGCAGGG + Intergenic
1072712639 10:97726815-97726837 ACCTATAAGCAGAGGATGCTGGG + Intergenic
1073689207 10:105788707-105788729 ACTAATATCCAGAATATGCAAGG + Intergenic
1074966229 10:118493107-118493129 ACCTATATGTCGTACATGCATGG + Intergenic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1075591764 10:123696802-123696824 ACCTATATGCATAAAATCATGGG - Intergenic
1078856921 11:15213664-15213686 ACATATAGGCAGAGAAAGCAGGG - Intronic
1079403044 11:20121677-20121699 ATCTGGATGCAGCAAATGCAGGG + Intergenic
1079535197 11:21505847-21505869 AGATATATGAAGAAAAAGCATGG - Intronic
1080741810 11:35072273-35072295 ATGTATATGTAGAAAATGCGAGG + Intergenic
1081197365 11:40177768-40177790 AGCAATAACCAGAAAATGCAAGG - Intronic
1081865025 11:46354800-46354822 ACCTAAATGCAGAATATGCCTGG - Intronic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1083476774 11:62920473-62920495 TCCTATATCCAGGCAATGCATGG - Intronic
1086633250 11:89050090-89050112 ACTTAAATGAATAAAATGCATGG - Intronic
1087080362 11:94165039-94165061 ACATATAGGCTGAAAATGAAGGG - Intronic
1088488875 11:110367619-110367641 ACCTACATTTATAAAATGCATGG - Intergenic
1090707569 11:129352998-129353020 ACCCATAGGCAGCATATGCAGGG - Intergenic
1090864175 11:130682022-130682044 ACCTATATAATGAAACTGCATGG - Intronic
1092416670 12:8295323-8295345 TCCCATATGCATAAAAAGCAGGG - Intergenic
1092631617 12:10384858-10384880 ACCAATATCCAGAATATACAAGG + Intronic
1093563536 12:20573969-20573991 GCTTAGAAGCAGAAAATGCAGGG - Intronic
1093676616 12:21947959-21947981 ACATATAGGCTGAAAATGAAGGG + Intergenic
1095763213 12:45864603-45864625 ACCAATGTACAGAAAATACAAGG - Intronic
1095824614 12:46517965-46517987 GCCTAAAAGCAGAAAATACATGG + Intergenic
1095911897 12:47436028-47436050 ACTAATATCCAGAATATGCAAGG + Intergenic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1106679094 13:31991663-31991685 ACCTAAATGCAGAAAATTCAAGG - Intergenic
1106917352 13:34529758-34529780 ACCTAAATGCAGAAGATGTATGG + Intergenic
1107415486 13:40196100-40196122 ACAGATTTGGAGAAAATGCAGGG + Intergenic
1110470575 13:75855239-75855261 ACCTAGATGCAGAACAAGAATGG - Intronic
1110896051 13:80754035-80754057 TCCCATATGCAGAAAACTCATGG + Intergenic
1111328914 13:86736717-86736739 ATCTATATGCAGAAGAGTCAAGG + Intergenic
1111550282 13:89800543-89800565 ACCTAATAGAAGAAAATGCAGGG - Intergenic
1112011685 13:95298940-95298962 ACCTACATTTTGAAAATGCAGGG + Intronic
1112986381 13:105455135-105455157 ACTAATATCCAGAAAATACAAGG + Intergenic
1114698591 14:24652452-24652474 ACCAATATCCAGAAACTACAAGG + Intergenic
1115741435 14:36393057-36393079 ATCTAAATGCAGAAAAGGCCTGG - Intergenic
1116747384 14:48837975-48837997 ACTAATATCCAGAATATGCAAGG + Intergenic
1116928047 14:50661327-50661349 ACTAATATCCAGAATATGCAAGG - Intronic
1117629703 14:57677711-57677733 ACATATATGCATAAAATGAAAGG + Intronic
1118556980 14:67034566-67034588 ACATATAGGCTGAAAATGAAAGG + Intronic
1119353683 14:73987885-73987907 ACCTTTGTGCAGAAAATGCCAGG - Exonic
1119492240 14:75045462-75045484 ACCTATATTTTGAAAATTCATGG + Intronic
1120584826 14:86299234-86299256 GCCTATTTGAAGAAAATCCAGGG + Intergenic
1121784267 14:96643642-96643664 ACTAATATCCAGAATATGCAAGG - Intergenic
1123877993 15:24643519-24643541 ACCTATAAACTGAAAATGAAGGG + Intergenic
1127628713 15:60805395-60805417 ACCTTAATGTAGGAAATGCAGGG + Intronic
1131005700 15:88976004-88976026 ACTAATATGCAGAATATACAAGG - Intergenic
1131179037 15:90227883-90227905 CCCTGTAGGCAGAAAAGGCATGG - Exonic
1131732055 15:95292461-95292483 ACATATATTCAGAGAAAGCATGG + Intergenic
1131995070 15:98125508-98125530 ACCCATAAGGAGAGAATGCAAGG + Intergenic
1134179951 16:12039548-12039570 ACCCATCTCCAGAAACTGCATGG - Intronic
1134900915 16:17937020-17937042 CCCCCTATGCAGAAACTGCACGG + Intergenic
1135306696 16:21373315-21373337 ACCCATCTCCAGAAACTGCATGG - Intergenic
1136303438 16:29352457-29352479 ACCCATCTCCAGAAACTGCATGG - Intergenic
1136873407 16:33828286-33828308 ACCTTTATTCTGAAAATGGAGGG + Intergenic
1137957413 16:52846040-52846062 ACCAATATTCAGAATATACAAGG - Intergenic
1139299824 16:65935498-65935520 CCCTATATGAAGAAAATGGGTGG - Intergenic
1203071211 16_KI270728v1_random:1076292-1076314 ACCTAAAAGGAGAAAATCCAGGG - Intergenic
1152010955 17:77716073-77716095 AGGTATATGAAGAAAATACATGG - Intergenic
1153269202 18:3302813-3302835 ACTAATATGCAGAATATACAAGG + Intergenic
1157107837 18:44791572-44791594 TCCTAAATGCTGAAAATTCAGGG - Intronic
1158777957 18:60609930-60609952 AGCTATATGTAGAAAATATAAGG - Intergenic
1159129443 18:64264301-64264323 ACATCTATGCAGAGAATGCTTGG - Intergenic
1164256198 19:23530362-23530384 AACAATATGCAAAATATGCAAGG + Intronic
1164283349 19:23788711-23788733 AACAATATGCAAAATATGCAAGG - Intronic
1164294834 19:23900788-23900810 AACAATATGCAAAATATGCAAGG - Intergenic
1167961661 19:53110215-53110237 ACCAATTGGCAGAAAATACATGG + Intronic
925063941 2:914782-914804 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064039 2:915212-915234 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG + Intergenic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
926955171 2:18286712-18286734 ACATGTAGCCAGAAAATGCAAGG + Intronic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
929062672 2:37939757-37939779 ACCCATATGCACAAAATAAAGGG - Intronic
930525290 2:52521468-52521490 ATTTATATAAAGAAAATGCATGG + Intergenic
931518206 2:63065988-63066010 ACTAATATGCAGAACATACAAGG - Intergenic
931865939 2:66411933-66411955 ATCTCTATGTAGAAAAAGCAAGG - Intergenic
933083287 2:78022187-78022209 ACTAATATTCAGAATATGCAAGG - Intergenic
933479420 2:82836713-82836735 AATAATATTCAGAAAATGCAAGG - Intergenic
935501704 2:103849067-103849089 ACCTAAATGATGAGAATGCATGG + Intergenic
936785496 2:116089630-116089652 ACTAATATGCAGAATATACAAGG - Intergenic
937731431 2:125235603-125235625 AGCCATATGCAGAAAATTGAAGG - Intergenic
938401386 2:130994818-130994840 ACTTCTATACACAAAATGCAAGG - Intronic
938886645 2:135656576-135656598 ACACATATTCAGAAAATTCAAGG - Intronic
939276496 2:140004554-140004576 ACTAATATCCAGAATATGCAAGG + Intergenic
939542945 2:143515766-143515788 ACTTATATGTAGAAAATCAATGG + Intronic
939579324 2:143929803-143929825 TCATATATGCATAAACTGCAGGG - Intergenic
939741874 2:145917766-145917788 ACCTATTTGGTGTAAATGCAGGG + Intergenic
940427282 2:153544817-153544839 ACCTCTTTGCAGAAAAGGAATGG + Intergenic
941091256 2:161178985-161179007 ACCTGTATTCAGAAACAGCAGGG + Intronic
941467647 2:165848850-165848872 ACTAATATCCAGAATATGCAAGG - Intergenic
942478094 2:176350696-176350718 ACTAATATTCAGAATATGCAAGG - Intergenic
942534951 2:176953231-176953253 ACCTATATGCAAAAAAGAAAGGG + Intergenic
942960464 2:181824318-181824340 ACCAATATCCAGAATATACAAGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943913365 2:193596339-193596361 CCCTATACACAGAAAATGAAGGG + Intergenic
946467316 2:219923486-219923508 ACCTATATAGAGAAAATGGAGGG + Intergenic
946607914 2:221426047-221426069 ACCCAAATGCAGCAGATGCACGG - Exonic
1168987278 20:2060603-2060625 ATCTATATGGAAAAAATGAATGG + Intergenic
1169625157 20:7558750-7558772 ACCAATATCCAGAATATACAAGG - Intergenic
1171406567 20:24915777-24915799 ACCTGTCTGCAGAATCTGCAGGG - Intergenic
1174057942 20:47811454-47811476 ACATTTAGGCAGAAAATGAAGGG - Intergenic
1175604606 20:60302351-60302373 AGTTATATGAAGAAAGTGCAGGG - Intergenic
1175605139 20:60306624-60306646 ACCGATACACAGAAAATGAACGG - Intergenic
1177315862 21:19459825-19459847 ATCTATATGGGGAAATTGCATGG - Intergenic
1179952760 21:44720062-44720084 TACTATATGGAGAAAAAGCAGGG - Intergenic
1183513696 22:38250886-38250908 ACCTATATGAAGAACGTGAAGGG - Intronic
949149811 3:752926-752948 ACCAATATCCAGAATATACAGGG - Intergenic
951091199 3:18575900-18575922 TTCTATATGCAAAAACTGCATGG + Intergenic
951253324 3:20419263-20419285 AACTATAGGAAGAAAATGAAAGG + Intergenic
951285288 3:20804192-20804214 ACCAATATTCAAAATATGCAAGG - Intergenic
951408133 3:22326425-22326447 AGCCACATGCAGAAAATGCCTGG - Intronic
952855045 3:37763291-37763313 ACCTTTATTCAGAAGTTGCAGGG + Intronic
955724926 3:61923001-61923023 ATCTTTATGAAGAAAATTCAAGG - Intronic
955793168 3:62608951-62608973 ACCTTTTAGGAGAAAATGCATGG - Intronic
957476468 3:80731464-80731486 ACATATAAGCAGATAATACAAGG - Intergenic
957916046 3:86689033-86689055 ACATATAGACTGAAAATGCAGGG + Intergenic
958580342 3:96010558-96010580 ATGTATATCCAGAAAATGCATGG + Intergenic
958695206 3:97518876-97518898 ACCTATAGCCAGAATATACAAGG - Intronic
958989016 3:100820007-100820029 ACCTATATGCAGAAAATGCAAGG + Intronic
960013864 3:112863105-112863127 ACTAATATGCAGAATATACAAGG - Intergenic
964466774 3:157001636-157001658 ACCTATCTGGTGAAATTGCAGGG + Intronic
964928703 3:161988876-161988898 ACCAATATCTAGAAGATGCAAGG - Intergenic
965351965 3:167624251-167624273 GGCTATATGCACAAAATGGAAGG + Intronic
965657670 3:171006097-171006119 ACCAATAATCTGAAAATGCAAGG + Exonic
966791104 3:183670346-183670368 GCTTATATGCAAAAAATCCATGG - Intronic
970844296 4:20518056-20518078 ACATATATGCACAAAATAAAAGG - Intronic
973019614 4:45186363-45186385 ACCTATATGCTGAAATTTGAAGG + Intergenic
973922410 4:55701431-55701453 ATATATATGCAGAAATGGCATGG - Intergenic
974258579 4:59494758-59494780 TCCTATCTGCAGAAATAGCATGG + Intergenic
974272564 4:59670036-59670058 ACCTATATGAAAGAAAGGCAGGG + Intergenic
974325197 4:60405041-60405063 ACTAATATGCTGAAAATGCCTGG + Intergenic
978800270 4:112749476-112749498 AGTTATATTCAGAAAATGTATGG + Intergenic
978982593 4:114967530-114967552 ACCTATATCCCTAAAACGCAAGG + Intronic
980552750 4:134361426-134361448 ACCTGTATACAGATAAAGCAGGG + Intergenic
980588034 4:134845266-134845288 AGCTATAAAAAGAAAATGCAAGG + Intergenic
981825017 4:148930016-148930038 TCATATATGAAGAAAAGGCATGG + Intergenic
982058691 4:151580284-151580306 TCCAATTTGCAGGAAATGCAGGG - Intronic
982346725 4:154368119-154368141 GCCTTTATGCTTAAAATGCAGGG + Intronic
982811276 4:159828739-159828761 ACCTTGATGCAGAAAATTGATGG + Intergenic
983179220 4:164628390-164628412 ACCAATATTCAGAATATACAAGG + Intergenic
984285454 4:177722959-177722981 ATCTAAATACAGAAAATGTACGG + Intergenic
984899635 4:184573643-184573665 ACCCAGAGGCAGAAATTGCAGGG + Intergenic
985242368 4:187944094-187944116 ACCTAAAGGCAGAAAATGGTAGG - Intergenic
985991157 5:3562855-3562877 ACTAATATCCAGAATATGCAAGG - Intergenic
986160882 5:5227231-5227253 ACCTAAACGCAGTAGATGCAGGG - Intronic
987520921 5:18982432-18982454 AACTATATGCAGAAGATTAAAGG - Intergenic
987673140 5:21039898-21039920 ACCAATATACAGGAAATACAAGG + Intergenic
988291859 5:29297334-29297356 ACTTCAATGCATAAAATGCAAGG - Intergenic
988352141 5:30122631-30122653 ACATATATGCAGAGAGAGCAAGG - Intergenic
988368446 5:30334041-30334063 ATCAATATCCAGAATATGCAAGG + Intergenic
988959143 5:36351583-36351605 GACTATGTGCAAAAAATGCAAGG - Intergenic
989004948 5:36800151-36800173 ATCTAAATGTAGTAAATGCATGG + Intergenic
989202807 5:38782241-38782263 AGATATAAGAAGAAAATGCAAGG - Intergenic
989210987 5:38858980-38859002 ACTAATATCCAGAATATGCAAGG - Intronic
990390746 5:55317571-55317593 AGCCATATGCAGAAAATTGAAGG + Intronic
991314374 5:65283479-65283501 ACCTCTAAGAAGCAAATGCAGGG + Intronic
991725414 5:69530994-69531016 ACCTAGATGTAGAAAATGCAAGG - Intronic
993588764 5:89767123-89767145 CCCTATATGAAGAAAATATAAGG - Intergenic
994064763 5:95526367-95526389 ACTAATATACAGAAAATACAGGG - Intronic
994146253 5:96399083-96399105 GCAGATATGCATAAAATGCAAGG - Intronic
994621575 5:102169880-102169902 ACTTATATGCAAAAAATAAAAGG + Intergenic
995332963 5:110966332-110966354 AACTACATCCAGACAATGCATGG + Intergenic
997600774 5:135136958-135136980 TCCTGTGTGCAGAACATGCATGG + Intronic
1001364929 5:171127476-171127498 ACTTATATCCAGAATATGCAAGG + Intronic
1002863016 6:1096732-1096754 ACCAATTTGCAGAAAATAAAAGG - Intergenic
1006691586 6:35892351-35892373 ACCTTTAAGCAAAAAAAGCAGGG + Intronic
1008345795 6:50424750-50424772 GACTATGTGCAAAAAATGCAAGG + Intergenic
1009946237 6:70345047-70345069 ACCTATATGCTGAAAATAAAAGG - Intergenic
1010401213 6:75448614-75448636 ACCAATATGCAGAATCTACAAGG + Intronic
1010469911 6:76215192-76215214 ACCTAAACACAGAAAAGGCATGG + Intergenic
1010505477 6:76652753-76652775 ATCTATGTACAGAAAATGCAAGG - Intergenic
1011098520 6:83694773-83694795 ACCAATATGAGGAAAAGGCAGGG - Intronic
1011947157 6:92920306-92920328 ACTTAAATGAAGAAAATTCAAGG - Intergenic
1012010242 6:93774699-93774721 CCCTAAAGGCAGAAAAAGCAGGG + Intergenic
1012861830 6:104569448-104569470 ACCAATTTGCAGGAAATACAGGG - Intergenic
1012933447 6:105340664-105340686 ACATATATGCTGAAAATAAAGGG + Intronic
1015584176 6:134758716-134758738 ACCCACAGGCAGAAACTGCATGG + Intergenic
1015943883 6:138479723-138479745 ATCTACATGAGGAAAATGCAAGG + Intronic
1019013109 6:168858683-168858705 ACCAATGTGCAGAAGATGCATGG - Intergenic
1019063893 6:169279204-169279226 ACATATCTACAGAAAATGAACGG - Intergenic
1021739791 7:23674974-23674996 TCCAATATACAGAAAATACAAGG - Intergenic
1026040292 7:66862684-66862706 ACCTAGATGCAGCAAACCCATGG - Intergenic
1030860558 7:114620270-114620292 ACCTACAGACAGAAGATGCATGG + Intronic
1031238466 7:119208495-119208517 ACTAATATCCAGAATATGCAAGG + Intergenic
1031563607 7:123267248-123267270 ACCTATATTCTGAAAGTGCATGG - Intergenic
1033676861 7:143550193-143550215 ACTAATATCCAGAATATGCAAGG - Intergenic
1033694974 7:143779242-143779264 ACTAATATCCAGAATATGCAAGG + Intergenic
1034572305 7:151966032-151966054 ACCAATATGTAGCAAATGCATGG - Intronic
1036702627 8:11023212-11023234 CCCTGGGTGCAGAAAATGCAGGG - Intronic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1038682566 8:29682829-29682851 ACTAATATCCAGAATATGCAAGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1042356044 8:67828819-67828841 AACTATAAGCAGAAAATGACAGG - Intergenic
1042760494 8:72267084-72267106 ACCTATATGCCAAAGATGAAGGG - Intergenic
1043616778 8:82135160-82135182 ACTAATATTCAGAAACTGCAAGG + Intergenic
1045137715 8:99239786-99239808 AACTATAAACAGAAAATGCTTGG - Intronic
1046264554 8:111814232-111814254 ACCTAGATTCAGAAGATGCATGG - Intergenic
1047011836 8:120681202-120681224 ACCAATATGCAAATTATGCAAGG + Intronic
1048906074 8:139090375-139090397 ACCAATATCCAGAATATACAAGG - Intergenic
1051803102 9:20959416-20959438 ACTAATATCCAGAATATGCAAGG - Intronic
1056261961 9:84857904-84857926 GCCTATGTGAAGAAAATGGAAGG - Intronic
1058923223 9:109638156-109638178 ACCTATATACACAACATGGATGG + Intergenic
1061374917 9:130218363-130218385 ACACATATGCACACAATGCATGG + Intronic
1185705718 X:2264886-2264908 ACCAATGTGCAGCAAATGCGGGG + Intronic
1187660047 X:21534814-21534836 ACTAATATCCAGAATATGCAAGG - Intronic
1188981272 X:36729363-36729385 AGGAATATGCAGGAAATGCATGG - Intergenic
1189870997 X:45382327-45382349 ACCAATATCCAGAATATACAAGG - Intergenic
1193284988 X:79701886-79701908 ACCAATAGCCAGAATATGCAAGG + Intergenic
1194226045 X:91259173-91259195 ATCTATATGCTGAAAATTCCCGG + Intergenic
1194806870 X:98340077-98340099 ACCAATATCCAGAATATACAGGG - Intergenic
1196856061 X:119985885-119985907 ACTAATATGCAGAATATACAGGG + Intergenic
1197517766 X:127457175-127457197 ATCTATCAGCAGCAAATGCAAGG + Intergenic
1197584792 X:128332261-128332283 AGCTATATGCAGTAAATGGGAGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198889895 X:141382270-141382292 ACCAATATTCAGAATATACAAGG + Intergenic
1199113977 X:143968354-143968376 AGCTATATGCAAAATATGCTGGG + Intergenic
1201570906 Y:15413357-15413379 ACTTGTATGCAGAATATGTAAGG + Intergenic