ID: 958989990

View in Genome Browser
Species Human (GRCh38)
Location 3:100831705-100831727
Sequence CTGGATGAGTAGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 1, 2: 3, 3: 61, 4: 552}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958989990_958989996 5 Left 958989990 3:100831705-100831727 CCCTCATCCCTCTACTCATCCAG 0: 1
1: 1
2: 3
3: 61
4: 552
Right 958989996 3:100831733-100831755 ATGCTGGTTTCTAATTATCCTGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958989990 Original CRISPR CTGGATGAGTAGAGGGATGA GGG (reversed) Intronic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
901568728 1:10141691-10141713 CTGGAAGCGAAGAGGGATGATGG + Intronic
901966563 1:12873176-12873198 TTTGATGAGTTGAGAGATGAAGG - Intronic
901981957 1:13043425-13043447 TTTGATGAGTTGAGAGATGAAGG - Intronic
902000126 1:13185488-13185510 TTTGATGAGTTGAGAGATGAAGG + Intergenic
902019376 1:13331255-13331277 TTTGATGAGTTGAGAGATGAAGG + Intergenic
902166524 1:14576346-14576368 ATAGATGGGTAGATGGATGATGG + Intergenic
902315707 1:15617249-15617271 GTGGAAGAGGAGAGGGAGGAAGG - Intergenic
902722174 1:18311251-18311273 CTGGATGGGGAGAGGCATGGTGG - Intronic
902722825 1:18315530-18315552 TTGGATGAGTGGATGGATGATGG + Intronic
902722839 1:18315577-18315599 GTGGATGGGTAGAGGGTGGATGG + Intronic
903192165 1:21662964-21662986 CTGGATGGGGGGAGGCATGATGG - Intronic
903568244 1:24285058-24285080 CTGCATGAGGAGCGGGATGGAGG - Intergenic
903662008 1:24984106-24984128 CTGGGTGGGTTCAGGGATGAGGG + Intergenic
903796064 1:25929788-25929810 GAGGATGAGTAGGGGGCTGATGG - Intergenic
903934523 1:26885973-26885995 CTGGATGTTGAGAGGGATAAAGG + Exonic
904581677 1:31548473-31548495 CTCGAGGAGAAGAGGGATGGGGG + Intergenic
904776586 1:32912164-32912186 CTGGATGAAGGGAGTGATGACGG - Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906650911 1:47511962-47511984 ATAGAAGAGTAGATGGATGAAGG - Intergenic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907933744 1:59023362-59023384 GTAGATGAGAAGGGGGATGAAGG + Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908453656 1:64280961-64280983 CTGGTTGACATGAGGGATGATGG + Intergenic
908973273 1:69864345-69864367 TTGGATGAATAGATGGATGGAGG + Intronic
910225861 1:84935369-84935391 CTGGAGGAGGGGAGGGATAAGGG - Intronic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
912392122 1:109310613-109310635 CTGGATGAATATAGGGGCGAGGG + Exonic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
915623017 1:157097786-157097808 CTGGCTGAGTACATGGCTGAGGG - Intronic
916784743 1:168078357-168078379 CTGGAGGACTAGTGGGGTGAAGG + Intergenic
917440622 1:175066072-175066094 CAGGAAGGGTAAAGGGATGAGGG - Intergenic
917504494 1:175615500-175615522 CTGGAGGAGTAGGGGTCTGAGGG + Intronic
917968141 1:180191380-180191402 CGGGGTGAGTTGAGGGGTGATGG + Intronic
919935161 1:202246170-202246192 ATGGATGGGTGGAGGGATGGAGG - Intronic
919935207 1:202246291-202246313 ATGGATGGGTGGAGGGATGGAGG - Intronic
920127624 1:203706090-203706112 CTGGATGCTTTGAGGGCTGATGG - Intronic
920228076 1:204452220-204452242 CTGTATGAGTAAAGGGTTTAAGG + Intronic
920534694 1:206729872-206729894 CTGGATGAGTAGAGGAAGGGAGG + Intronic
920700566 1:208215383-208215405 AGGGATGGGTAGATGGATGATGG + Intronic
922194795 1:223350682-223350704 CTTGATTAGAAGAGGGCTGAAGG - Intronic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
924034274 1:239920310-239920332 ATGGATGGGTGGATGGATGATGG - Intergenic
1062940201 10:1415107-1415129 ATGGATGGGCAGAGGGATGATGG + Intronic
1063069538 10:2647479-2647501 ATAGATGAGCAGACGGATGATGG - Intergenic
1063073321 10:2689156-2689178 TTGGATGAGTGGATGGATGGAGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1064960185 10:20954842-20954864 GTGGATGGGGAGAGGTATGAAGG + Intronic
1065369401 10:24968441-24968463 CTGGATGAGCAAGGGGATGTTGG - Intergenic
1066656348 10:37702229-37702251 CTGGCTGAGGACAGGGAGGAGGG - Intergenic
1067051422 10:43023554-43023576 ATGGATGAATGGATGGATGATGG + Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067830108 10:49606870-49606892 TTGAATGAGTAGAGGAAGGAAGG - Intergenic
1069784289 10:70977875-70977897 CAGGATGACTGCAGGGATGATGG + Intergenic
1069788961 10:71007218-71007240 TTGGATGGGTAGATGGATGATGG - Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1071935684 10:90527429-90527451 TTGGAGGAGTAGAGGGACTATGG - Intergenic
1072304811 10:94096832-94096854 TTTGCTGAGCAGAGGGATGAAGG + Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1073429044 10:103474388-103474410 GTGGATGAGTAGATAGATCAAGG - Intronic
1073467236 10:103701292-103701314 ATGGATGAATGGATGGATGATGG - Intronic
1073467240 10:103701315-103701337 ATGGATGAATGGATGGATGATGG - Intronic
1073467275 10:103701488-103701510 ATGGATGAATGGATGGATGATGG - Intronic
1073467377 10:103702035-103702057 GTGGATGGATAGATGGATGATGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076136770 10:128050426-128050448 ATGGATGGGTGGATGGATGATGG + Intronic
1076565340 10:131394685-131394707 ATGGATGAGTGGATGGATGGAGG + Intergenic
1076867378 10:133174733-133174755 ATGGATGGGTGGATGGATGATGG + Intronic
1077357954 11:2127285-2127307 ATGGATGGGTGGAGGGATGGGGG + Intergenic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1078642865 11:13112769-13112791 ATGGATGAGTAAATTGATGATGG + Intergenic
1078725977 11:13931388-13931410 CCTCAGGAGTAGAGGGATGAGGG + Intergenic
1079367107 11:19819054-19819076 GTGGGTGGGTAGATGGATGAAGG - Intronic
1080849360 11:36054893-36054915 ATGGATGAATGGATGGATGATGG + Intronic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082135023 11:48538344-48538366 CTGAATGAGTACAGTGATCAGGG + Intergenic
1082222489 11:49656781-49656803 TTGGATGAGTAGATATATGAAGG + Intergenic
1083134288 11:60657080-60657102 CTCCATGAGGGGAGGGATGAGGG - Intergenic
1084456752 11:69272258-69272280 GTGGATGAGTAGATGAATGATGG - Intergenic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084596371 11:70119237-70119259 ATGGATGGGTTGATGGATGATGG + Intronic
1084596406 11:70119373-70119395 ATGGATGGGTTGATGGATGATGG + Intronic
1084596508 11:70119891-70119913 ATGGGTGGGTAGATGGATGATGG + Intronic
1084684561 11:70686099-70686121 ATGGATGGGTAGATGGGTGATGG - Intronic
1084684617 11:70686310-70686332 ATGGATGGGTAGATGGATGATGG - Intronic
1084684637 11:70686405-70686427 ATGGATGGGTAGATGGATGATGG - Intronic
1084705120 11:70811622-70811644 ATGGATGAGTGGATGGATGATGG - Intronic
1084705130 11:70811684-70811706 ATGGATGGGTAGATGGATGTTGG - Intronic
1084705150 11:70811798-70811820 ATGGATGGGTAGATGGATGATGG - Intronic
1084781802 11:71414776-71414798 ATGGGTGGGTAGATGGATGATGG + Intergenic
1084781845 11:71414982-71415004 ATGGATGGGTAGATGGATGATGG + Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1088760076 11:112921117-112921139 ATGGATGAGTAGTGGGAGAAAGG - Intergenic
1089049069 11:115530365-115530387 CTGGAAGGGTAGTGGAATGATGG + Intergenic
1089580048 11:119476057-119476079 GTAGATAAGTAGATGGATGATGG + Intergenic
1090173104 11:124622718-124622740 CTGGATGAGGAGAGGAGGGAGGG - Intergenic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1091024521 11:132130212-132130234 TCAGATGAGTAGCGGGATGAGGG + Intronic
1091053400 11:132395718-132395740 CTGGAAGAGAAGAGAGATGATGG + Intergenic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1092073554 12:5653874-5653896 CGGGATGAAAAGGGGGATGAGGG + Intronic
1093863244 12:24193981-24194003 ATCAATCAGTAGAGGGATGAGGG - Intergenic
1095946882 12:47758749-47758771 TTGGGTGAGTAGAGGGGTGGGGG + Intronic
1095955049 12:47801118-47801140 CTGGCTGGGTCCAGGGATGAGGG - Intronic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1096670713 12:53196821-53196843 CTGGGAGAGGAGAGGAATGAAGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097535420 12:60863828-60863850 CAGGATAAGATGAGGGATGAAGG + Intergenic
1097896009 12:64825194-64825216 CTGGAAGGGTAGAGGGCAGACGG + Intronic
1100370720 12:93966760-93966782 AGGGAGGAGTGGAGGGATGAAGG - Intergenic
1100370739 12:93966835-93966857 AGGGAGGAGTGGAGGGATGAAGG - Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101292673 12:103387563-103387585 CTGGTTGACAAGAGGGATGTTGG - Intronic
1101560909 12:105857200-105857222 GATGATGAGTAGATGGATGATGG + Intergenic
1102401063 12:112630168-112630190 TTGGATGGGTGGATGGATGATGG - Intronic
1102763186 12:115407474-115407496 GTGGAGGAGAAGAGGCATGAGGG + Intergenic
1102856098 12:116295464-116295486 ATGGATGGGTAGATGGATGGAGG + Intergenic
1103023991 12:117558687-117558709 ATGGATGGGTAGATGGATGGGGG + Intronic
1103444827 12:120987997-120988019 GTGGGTGGGTAGATGGATGATGG - Intronic
1103444877 12:120988186-120988208 GTGGGTGGGTAGATGGATGATGG - Intronic
1104034673 12:125090055-125090077 GTGGATGGATAGATGGATGAGGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104062811 12:125282330-125282352 CTGGATGAGCTGAGGAGTGAGGG - Intronic
1104628549 12:130379913-130379935 TTGGATGGGAAGTGGGATGAGGG - Intergenic
1104628573 12:130380045-130380067 TTGGATGGGAAGTGGGATGAGGG - Intergenic
1104778630 12:131405470-131405492 ATGGATGGGTGGATGGATGATGG - Intergenic
1104896389 12:132166959-132166981 ATGGATGGGTAGGTGGATGATGG - Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105279610 13:18955767-18955789 ATGGATGGGTAGATGGATGGGGG - Intergenic
1105837978 13:24227117-24227139 CTGGGTGAGATGAAGGATGAAGG + Intronic
1105901886 13:24762546-24762568 TTGGATGAGTAGTAGAATGAGGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106900575 13:34351215-34351237 AGGAATGAGTAGAGGGATGATGG + Intergenic
1106900583 13:34351269-34351291 ATGGATGAGTAGAGGGATGATGG + Intergenic
1106900607 13:34351396-34351418 ATGGATTAGCGGAGGGATGATGG + Intergenic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1109301284 13:60592742-60592764 CTGGATGGGTTGAGAGCTGAAGG - Intergenic
1112769172 13:102776775-102776797 CTGGCTGAGAAGATGGAAGAGGG + Intergenic
1113072909 13:106438823-106438845 ATGGATGGGTGGAGGGAGGAAGG + Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1114257129 14:21012645-21012667 CAGGATGGGAAAAGGGATGAGGG + Intergenic
1114695942 14:24627853-24627875 CTGGAGGAAAAGAGGGATGGTGG + Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1119038078 14:71247382-71247404 ATTGATGAGTACAGGGAAGAGGG - Intergenic
1119294583 14:73522636-73522658 CTGGATGCATGCAGGGATGATGG + Exonic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1122600722 14:102920394-102920416 ATGGATGGGTAGATGGATGGTGG - Intergenic
1122879931 14:104686132-104686154 GTGGATGGGTAGATGGATGAAGG + Intergenic
1122958513 14:105083787-105083809 ATGGATGGGTGGAGGGAGGATGG - Intergenic
1123083186 14:105705678-105705700 ATGGATGAGTGGATGAATGAAGG - Intergenic
1124665101 15:31585611-31585633 CTGGAAGGGTAGAGGAGTGAAGG - Intronic
1125663296 15:41411380-41411402 TTGGGAGAGAAGAGGGATGAGGG + Intronic
1127032981 15:54884461-54884483 GTGGATGAGTAGAATCATGAAGG + Intergenic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127395665 15:58542171-58542193 GTGGATGAGGAGAGGGGAGAAGG - Intronic
1127549554 15:60023384-60023406 CTGGATGGGGAGAGGGAACAGGG + Intronic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128793740 15:70450336-70450358 ATGGATGAATAGAGGGATGGAGG + Intergenic
1128818257 15:70629906-70629928 CTGGATGAAGAGTGGGATGTGGG - Intergenic
1129245938 15:74278677-74278699 CTGGGTGAAGAGAGGGATAAAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129914361 15:79255206-79255228 AGGGATGAGGAGGGGGATGAGGG - Intergenic
1130353615 15:83111287-83111309 ATGGATGAATTGATGGATGATGG - Intronic
1130353623 15:83111339-83111361 ATGGATGAATTGATGGATGATGG - Intronic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1133204926 16:4227513-4227535 GTAGATGAGTAGATGGATGATGG + Intronic
1133326840 16:4947113-4947135 ATGGAGGAATGGAGGGATGAAGG - Intronic
1133539580 16:6736300-6736322 GGGGAAGAGTAGAGGGGTGAGGG - Intronic
1133741596 16:8655878-8655900 CAGGAAGAGGAGAGGGCTGAGGG + Intergenic
1134224681 16:12381226-12381248 GTGGATAGGTAGATGGATGAGGG - Intronic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1134806146 16:17127153-17127175 TTAGATGAGTAGATGAATGATGG - Intronic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580038 16:49628032-49628054 ATGGATGGGTAGATGGAAGATGG - Intronic
1137580061 16:49628135-49628157 ATGGATGGGTAGATGGACGATGG - Intronic
1137676774 16:50307573-50307595 CTGGTGGGGTATAGGGATGAGGG + Intronic
1138653592 16:58476191-58476213 TTAGATGAGTAGGTGGATGATGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140731897 16:77863954-77863976 ATGGATGGGTAGAGGGAGGCTGG + Intronic
1140853239 16:78954230-78954252 TTGGATGATTGGATGGATGATGG + Intronic
1141316740 16:82969519-82969541 CTGGAAGAGTGGAAAGATGATGG + Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141373567 16:83509080-83509102 GGGGTTGAGTAGAGGGATTATGG - Intronic
1141483748 16:84325084-84325106 ATGGATGGATGGAGGGATGAAGG - Intronic
1141641866 16:85346297-85346319 GTGGATGGGTGGATGGATGATGG + Intergenic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1141854894 16:86674102-86674124 ATGAATGGGTAGATGGATGAAGG - Intergenic
1142152351 16:88518250-88518272 GTGGGTGAGTAGATGGATGGTGG + Intronic
1142960524 17:3549684-3549706 GTAGATGAGTGGATGGATGATGG + Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143766321 17:9139903-9139925 ATGGATGAATGGATGGATGATGG - Intronic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1144534604 17:16075881-16075903 GTGGCTGAGTTGAAGGATGAAGG - Intronic
1145716714 17:27029740-27029762 TTTGATGAGTAGAGAGAAGAAGG + Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146821730 17:35988508-35988530 GTGGGTCAGTAGTGGGATGATGG + Intronic
1147617279 17:41836852-41836874 CTGGATGGGAGGAGAGATGAAGG + Intronic
1147668396 17:42163179-42163201 GTGGATGGGCAGATGGATGACGG + Intronic
1147805102 17:43125622-43125644 CTGGAAGAGTAGAGGCTAGAGGG - Intergenic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1149453737 17:56770531-56770553 GTGTATGAATAGATGGATGATGG - Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149600242 17:57888823-57888845 CTGGAGGGGCAGAGAGATGATGG - Intronic
1149624402 17:58069874-58069896 CTGGATCAGTTGAGGGTTGAGGG + Intergenic
1150266861 17:63837694-63837716 CTGGCTGACGAGAGGGATGGAGG - Intronic
1150320426 17:64209013-64209035 ATGGATGGGTAGATGAATGAAGG - Intronic
1152311141 17:79550602-79550624 ATGGATGAGTGGACAGATGATGG + Intergenic
1152756303 17:82088478-82088500 CTTGATGAGTGGGGAGATGAGGG + Exonic
1152940879 17:83172458-83172480 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940891 17:83172496-83172518 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940970 17:83172796-83172818 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941026 17:83172984-83173006 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941044 17:83173060-83173082 CTGGGTGAGCAGTGGGGTGAAGG + Intergenic
1152941077 17:83173173-83173195 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941131 17:83173363-83173385 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1153617854 18:6951099-6951121 ATGGATGTGTAAATGGATGAAGG - Intronic
1153660548 18:7322018-7322040 GAGGATGGGTAGATGGATGATGG + Intergenic
1153838997 18:8989600-8989622 CAGGCTGAGTAGAGGCATCAAGG + Intergenic
1153976334 18:10271490-10271512 ACGGATGAGTAGGGAGATGACGG - Intergenic
1153995518 18:10438318-10438340 TTGGAAGAGTAGAGATATGAAGG + Intergenic
1155015838 18:21838408-21838430 GTGGATGAGAAGAAAGATGATGG + Exonic
1158574281 18:58623159-58623181 CTGGCTGGGTTGAAGGATGAGGG - Intronic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160105856 18:75975527-75975549 AAGGATGAGTAGTGAGATGAAGG + Intergenic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1161105286 19:2440809-2440831 CTGGATGGGTGGACGGATGATGG - Intronic
1161227518 19:3153953-3153975 ATGTATGAGTAGATGGATAATGG + Intronic
1161449122 19:4334806-4334828 ATGGATGAGTGGATGGATGATGG - Intronic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161681420 19:5681551-5681573 ATGGATGAGTGGAAGGATGGGGG - Intronic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1162085808 19:8248519-8248541 TTGGATCAGTGGATGGATGATGG + Intronic
1162085832 19:8248636-8248658 TTGGATGAGTGGATGGATGATGG + Intronic
1162085934 19:8249148-8249170 TTGGATGGGTGGATGGATGATGG + Intronic
1162621384 19:11847244-11847266 ATCGATGAGGAGGGGGATGAGGG - Intergenic
1162625161 19:11879497-11879519 ATCGATGAGGAGAGGGATTAGGG - Intronic
1162630398 19:11923267-11923289 ATCGATGAGGAGGGGGATGAGGG - Intergenic
1163015428 19:14451429-14451451 CTGGAGGGGTAGATGGCTGAGGG - Intronic
1163112956 19:15172485-15172507 GGGGAGGGGTAGAGGGATGAAGG - Intronic
1163238345 19:16043070-16043092 TTGGATGGGTGGATGGATGAAGG + Intergenic
1163238382 19:16043222-16043244 ATGGATGGGTGGATGGATGAAGG + Intergenic
1163238464 19:16043532-16043554 ATGGATGGGTGGATGGATGAAGG + Intergenic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1163394709 19:17052967-17052989 CTGGAGGGGAAGAGGGATGGTGG + Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164811692 19:31162472-31162494 ATGAATGAGTAAATGGATGACGG + Intergenic
1164827214 19:31292640-31292662 ATGGATGGGTAGATGGATGGAGG - Intronic
1165843095 19:38801144-38801166 ATGGATGGGTAGATGGATAAAGG + Intergenic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166830802 19:45638679-45638701 CTGGAAGAGGAGAGGGAATAGGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
1168326400 19:55540898-55540920 CTGGAGGAGTGGACAGATGAGGG - Exonic
925119343 2:1405295-1405317 ATGGATGAGTGAATGGATGATGG - Intronic
925347763 2:3182906-3182928 CTGGATGGGTGGATGGATGATGG - Intergenic
925687124 2:6483886-6483908 CTGGATGAGTAGATGTTTGCAGG + Intergenic
925745313 2:7038911-7038933 GTGGATGGATAGATGGATGATGG + Intronic
925882914 2:8368094-8368116 CTGAAAGAGAAGATGGATGAGGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925925714 2:8668532-8668554 ATGGATGGGTGGATGGATGAGGG + Intergenic
926038259 2:9652216-9652238 GTGGATGGGTGGATGGATGATGG - Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
928472568 2:31589282-31589304 CTGGATGAGGTGGTGGATGAGGG - Intergenic
928902548 2:36335954-36335976 CTGTAAGAATAGAAGGATGAGGG + Intergenic
929136116 2:38625311-38625333 TTGCATGAGAAGAGGGCTGAAGG - Intergenic
930962208 2:57275838-57275860 TTTGATGAGTCGAGAGATGAAGG - Intergenic
932735674 2:74252389-74252411 CTGGAAGAGAAGGGGGATGAAGG + Intronic
932799189 2:74724330-74724352 CTGGCTGCGTAGAGTGAGGAAGG - Intergenic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933654385 2:84875597-84875619 TGGGATGAATAGAGGGATGAGGG + Intronic
933665003 2:84957770-84957792 CTGGATGCTTAGAGGAAGGAAGG - Intergenic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935124269 2:100209185-100209207 CTGGAAGGGTAGAGGGTAGAAGG - Intergenic
937082641 2:119151402-119151424 ATGGATGGATAGAGGGATGGAGG - Intergenic
938122874 2:128645958-128645980 ATGAATGAGTAGAGGGAACAAGG - Intergenic
938884140 2:135625700-135625722 CTGGATGAGGAGATTGGTGAAGG + Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940369725 2:152887762-152887784 TTGGATGTGGTGAGGGATGAAGG - Intergenic
941015096 2:160346561-160346583 CAGGAGGAGTGGACGGATGATGG - Intronic
941649199 2:168075134-168075156 ATGGATGAGAAGAGCGAAGAAGG - Exonic
942022494 2:171880712-171880734 ATGGATGACTAGAGGGAGAAAGG - Intronic
942045968 2:172099933-172099955 ATGGATGAGGAGAGAGCTGAGGG + Exonic
942150750 2:173074540-173074562 CTGGATGACTGGAAGAATGATGG - Intergenic
942181402 2:173384355-173384377 CTGGAAGACTGGAAGGATGAAGG - Intergenic
942648261 2:178138537-178138559 TTGGATGAGTAGAGGAATCTTGG - Intronic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944537619 2:200726512-200726534 ATGGATGGGTGGATGGATGATGG - Intergenic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
947458044 2:230274437-230274459 CTGGATGTGGAGATGGATGCAGG + Intronic
948375472 2:237517813-237517835 ATGGATGGGTAGATGAATGAAGG + Intronic
948438291 2:237968156-237968178 CTGGCTGAGGAGTGAGATGAAGG + Intronic
948815640 2:240509046-240509068 ATGGATGAGTGGAGGGTAGATGG + Intronic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1168733542 20:109447-109469 GTGGATTACTAGAGGGAGGAGGG + Intergenic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1170405605 20:16032668-16032690 ATGGATGAGAAGAGGGAAGGAGG + Intronic
1170862170 20:20116748-20116770 CAGGAAGAGTAGAGGGGTGGGGG - Intronic
1172230789 20:33334236-33334258 GAGGATGGGTAGATGGATGATGG + Intergenic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1173773030 20:45680353-45680375 CTGGAGGAGGAGCGGGGTGAGGG - Intergenic
1173871491 20:46344859-46344881 ATGGATGGGTAGATGGATGATGG - Intergenic
1173871527 20:46345034-46345056 ATGGAGGGGTAGATGGATGAAGG - Intergenic
1174570589 20:51498426-51498448 GTGGATGAGTAGGTGGGTGAAGG + Intronic
1175530696 20:59672745-59672767 GTGGATGAGGAGAGAGATGGTGG - Intronic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1175754183 20:61518980-61519002 ATGGATGAATGGATGGATGAAGG - Intronic
1175779252 20:61671904-61671926 ATGGATGAGTAGGTGGATGCAGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1175817427 20:61890619-61890641 GGGGATGGGTAGACGGATGAGGG + Intronic
1175817855 20:61892986-61893008 ATGGGTGAGTAGAGGGATGGTGG + Intronic
1175817876 20:61893069-61893091 ATGGGTGAGTAGAGGGATGCTGG + Intronic
1175817896 20:61893148-61893170 GTGGGTGAATAGAGGGATGGTGG + Intronic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175817978 20:61893468-61893490 GCGGATGAGTAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175855437 20:62118489-62118511 ATGGATGGGAAGAGGGAAGAGGG + Intergenic
1175934626 20:62509265-62509287 GTGGAGGAGTAGAGGGATGGAGG - Intergenic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1179125937 21:38590648-38590670 ATGGATGAATACATGGATGATGG - Intronic
1179474718 21:41635819-41635841 ATGGATATATAGAGGGATGATGG - Intergenic
1179474741 21:41635981-41636003 GTGGATGTATAGAAGGATGATGG - Intergenic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179623673 21:42634925-42634947 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623729 21:42635365-42635387 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623741 21:42635471-42635493 ATGGATGGATAGAAGGATGATGG - Intergenic
1179644116 21:42765151-42765173 GTGGATGGGTAGATGGATGGAGG + Intronic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1180024926 21:45155700-45155722 ATGGATGAATAGATGGGTGATGG - Intronic
1180025094 21:45156336-45156358 GTGGATGGATAGATGGATGATGG - Intronic
1181536726 22:23550141-23550163 ATGGATGGGTAGTTGGATGATGG - Intergenic
1181536730 22:23550160-23550182 ATGGATGGGTAGATGGATGATGG - Intergenic
1181536981 22:23551422-23551444 ATGGATGAGAGGAGGAATGAAGG - Intergenic
1183066703 22:35368482-35368504 ATGGATGAGGAGAAGGTTGAGGG - Intergenic
1183106491 22:35618796-35618818 ATGGATGAATGGAGGGATGATGG - Intronic
1183303999 22:37072322-37072344 ATGGATGAATGGATGGATGATGG + Intronic
1183304035 22:37072523-37072545 ATGGATGAATGGATGGATGATGG + Intronic
1183304038 22:37072542-37072564 ATGGATGAATGGATGGATGATGG + Intronic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304094 22:37072821-37072843 ATGGATGGATAGACGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1183304142 22:37073075-37073097 ATGGATGGATAGACGGATGATGG + Intronic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183878163 22:40802185-40802207 CTGGCAGAAAAGAGGGATGAAGG - Intronic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184293416 22:43509750-43509772 GTGGATGAATGGAGGGATGGAGG - Intergenic
1184460828 22:44636923-44636945 GTGGATGGATAGATGGATGATGG + Intergenic
1184951209 22:47843724-47843746 CTGGAGGAGTACAGGGAGGCAGG + Intergenic
1185053492 22:48565918-48565940 GTAGATGAGTAGATGGATGATGG + Intronic
1185103701 22:48855388-48855410 ATGGATGGGTAGATGAATGATGG - Intergenic
1185146282 22:49138578-49138600 GTGGATGAATAGATGGATGGAGG - Intergenic
1185146325 22:49138785-49138807 ATGGATGGGTATAGGGATGGAGG - Intergenic
1185165589 22:49260430-49260452 ATGGATGAATGGATGGATGATGG - Intergenic
1185193360 22:49452709-49452731 GTGGATGGGTGGAGAGATGATGG + Intronic
1185193439 22:49453132-49453154 GTGGATGGGCAGATGGATGATGG + Intronic
1185193478 22:49453345-49453367 GTGGATGGGCAGATGGATGATGG + Intronic
950425957 3:12924860-12924882 CTGAATGCCTACAGGGATGAAGG - Intronic
950440890 3:13009585-13009607 CAGGAGGAGGTGAGGGATGAGGG - Intronic
950541795 3:13617541-13617563 CTGGATGGGTGGATGAATGAAGG - Intronic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
954633840 3:52060983-52061005 CTAGGTGACTAGAGGGCTGAGGG - Intergenic
954744593 3:52779944-52779966 GTGGCTGAGTTGAGGGATGCAGG + Intronic
955399924 3:58584337-58584359 CTGGATGAATAAATGAATGAAGG + Intronic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
956740627 3:72272949-72272971 GTCGAAGAGTAGAGGGATGGAGG + Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
960291571 3:115891778-115891800 ATGGAAGAGAAGAGGGATGGTGG - Intronic
961094828 3:124145205-124145227 CTGGATCAGTAGATCGATAAAGG - Intronic
962006696 3:131356877-131356899 CTGGATGGGTAGAGGAGTGATGG + Intergenic
962073241 3:132053819-132053841 TTCGATGAGTTGAGGGAAGAAGG - Intronic
962202821 3:133414868-133414890 AGGGATGAGTAGAGGGGAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203486 3:133417492-133417514 AGGGATGAGTAGAGGGGAGAGGG - Intronic
962203496 3:133417525-133417547 AGGGATGAGTAGAGGGGAGATGG - Intronic
962229517 3:133649679-133649701 CTGCATGACAAGTGGGATGATGG - Intronic
962804076 3:138914887-138914909 ATGGATGAATGGATGGATGAAGG + Intergenic
964173483 3:153797942-153797964 CTTGATGAGTTGAGAGAAGAAGG + Intergenic
964859688 3:161187283-161187305 GGGGATGAGGAGAGGGGTGAAGG + Intronic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
968263525 3:197344066-197344088 CGGGATGAGTAGAGGAAAGAAGG - Intergenic
968594734 4:1476501-1476523 GTGGGTGGGTAGATGGATGATGG + Intergenic
968643203 4:1725374-1725396 CTGGAGGGGTAGAGGGGAGACGG - Intronic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
968936037 4:3611041-3611063 ATGGATGGGTGGATGGATGATGG - Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969571584 4:8012087-8012109 ATGGATGGGCAGATGGATGATGG - Intronic
969612291 4:8234179-8234201 ATGGATGAATGGATGGATGATGG - Intronic
969823801 4:9740757-9740779 CTGGAAGAGGGGGGGGATGATGG + Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
972193874 4:36629058-36629080 CTGGAAGATTAGATGAATGATGG - Intergenic
972317772 4:37943819-37943841 TTTGATGAGTTGAGGGAAGAAGG - Intronic
972677548 4:41275404-41275426 CTTGATGAGTTGAGAGAAGAAGG - Intergenic
973865034 4:55104107-55104129 CTGCATGAAGAGTGGGATGATGG - Intronic
974083706 4:57237763-57237785 AGGGAGGGGTAGAGGGATGATGG + Intergenic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974467237 4:62272924-62272946 ATGGATGAGAAGTGGGAGGAAGG - Intergenic
975174416 4:71270965-71270987 CTGGAAGAGAAGAGGCAGGATGG - Intronic
976817185 4:89162593-89162615 CTGGATGATTTGAAGGCTGAAGG + Intergenic
978264027 4:106800682-106800704 CTTGTTGAGTAGAGGCATGGAGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
981960517 4:150532211-150532233 CTAGATGAGTACAAGGATAATGG - Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
984055267 4:174920691-174920713 CTGGATGAATAAAGGAAAGAAGG + Exonic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985709239 5:1419023-1419045 ATGGATGGGTGGATGGATGATGG - Intronic
985940984 5:3135653-3135675 TTGGCTGTGTAGAGGCATGATGG - Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986741674 5:10710550-10710572 CTGGAAGTGTGGTGGGATGATGG + Intronic
986883307 5:12202931-12202953 CCTCAAGAGTAGAGGGATGAAGG - Intergenic
988286182 5:29219427-29219449 CTGGATGACTAGGTAGATGATGG + Intergenic
988680628 5:33480999-33481021 ATGAAGGAGAAGAGGGATGAAGG - Intergenic
988732796 5:33990141-33990163 ATGGATGGGTGGATGGATGATGG - Intronic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
990444391 5:55880721-55880743 GTGAATGAGTAAATGGATGATGG - Intronic
992538515 5:77738058-77738080 TTGGATGAGCAGAGGCATGAAGG + Intronic
993096417 5:83484322-83484344 ATGGATGAATAGATAGATGATGG - Intronic
993934472 5:93984958-93984980 ATGGAGGAGGACAGGGATGAAGG - Intronic
994224721 5:97239252-97239274 TTTGATGAGTAGAGAGAAGAAGG - Intergenic
995105141 5:108369080-108369102 TTAGGTGAGCAGAGGGATGATGG - Intronic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
997758193 5:136420194-136420216 GTCTATGGGTAGAGGGATGAGGG + Intergenic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
998506852 5:142679202-142679224 GTGGCTGAGTGCAGGGATGAAGG - Intronic
998705062 5:144749856-144749878 CTAGATGATTGGAGAGATGATGG + Intergenic
999095950 5:148978461-148978483 GTGGAGGAGGAGAGGTATGAAGG - Intronic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999746741 5:154598182-154598204 ATGGATGAATGGATGGATGATGG + Intergenic
1000427693 5:161112030-161112052 CTGTATGAGTAGGGGTAAGAAGG - Intergenic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001200909 5:169715766-169715788 CTGGCTGAGAAGGGGTATGAGGG - Intronic
1001646322 5:173284682-173284704 GTGGATGATTGGATGGATGAGGG - Intergenic
1001646349 5:173284805-173284827 GTGGATGATTGGATGGATGAGGG - Intergenic
1001646408 5:173285079-173285101 GTGGATGACTGGATGGATGAGGG - Intergenic
1002315385 5:178340026-178340048 AGAGATGAGTAGAGGGATGAGGG + Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003972587 6:11313350-11313372 ATGGCTGAGTAGATGGATGGTGG + Intronic
1004184188 6:13407891-13407913 TTGGGTGAGTACAGGGAGGAGGG - Intronic
1004415221 6:15417146-15417168 GTGGGTGAGTAGGGGGAAGAGGG + Intronic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1005213165 6:23493125-23493147 TTGGAAGAGTAGAATGATGAAGG - Intergenic
1007109556 6:39304992-39305014 CTGGATGGGCAGATGGATGCTGG + Intronic
1007259617 6:40554411-40554433 GTGGATGGGTGGATGGATGATGG + Intronic
1007781687 6:44258024-44258046 AAGGATGAGTAAAGGGATGGGGG - Intergenic
1008422135 6:51313640-51313662 ATGGATGAATGGATGGATGATGG - Intergenic
1010373904 6:75144142-75144164 CTGGAACAGTAGAGGAATGGAGG - Intronic
1011376615 6:86694361-86694383 TTTGATGAGTTGAGGGAAGAAGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1012123096 6:95391489-95391511 ATGGGTGAGTGAAGGGATGAAGG + Intergenic
1012849771 6:104432463-104432485 CTTGAAGAGTAGAAGGATCAAGG + Intergenic
1013547785 6:111176168-111176190 GTGGATTAGTAGAGGGAGAAGGG + Intronic
1017112304 6:150943807-150943829 CAGAATGAGTAGAGTCATGAGGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018853166 6:167655635-167655657 ATGGATGAATGGATGGATGATGG + Intergenic
1019345575 7:528576-528598 ATGGATGAATAGACAGATGATGG + Intergenic
1019777421 7:2920558-2920580 ATGGATACGTAGATGGATGATGG - Intronic
1020284149 7:6667421-6667443 CTGGAAGAGTAAAAAGATGAGGG - Intergenic
1021593926 7:22294505-22294527 TTTGATGGTTAGAGGGATGAGGG - Intronic
1021818474 7:24473246-24473268 CTAGATGAGGAGATGGAGGAAGG + Intergenic
1022327073 7:29342180-29342202 ATGAATGGGTAGATGGATGAGGG + Intronic
1024131081 7:46353843-46353865 CCTGATGAGTGGAGGGATGAGGG - Intergenic
1024588644 7:50862197-50862219 CTGGAAGAGTAGAGGGTCCACGG + Intergenic
1025638460 7:63346082-63346104 CTACATGCATAGAGGGATGAGGG + Intergenic
1025644236 7:63402007-63402029 CTACATGCATAGAGGGATGAGGG - Intergenic
1025713832 7:63935070-63935092 CTACATGCATAGAGGGATGAGGG - Intergenic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026591817 7:71702893-71702915 CTGGATGAGTGTATGGGTGATGG + Intronic
1026904276 7:74053907-74053929 ATGAATGGGTAGATGGATGAGGG + Intronic
1027163768 7:75820704-75820726 GTGGATGGGTAGATGGATGAAGG - Intronic
1029815032 7:103084889-103084911 CTGGATCAGTCGAGGGACCATGG + Intronic
1031023392 7:116652599-116652621 TTGGATGAGAAGGGAGATGAGGG + Intergenic
1031518687 7:122735640-122735662 TTGGATCAGCAGGGGGATGAGGG - Intronic
1032067432 7:128782271-128782293 ATGGATGTGTACAGGGATGGTGG + Intergenic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1033106976 7:138536200-138536222 CTTGATGAGTTGAGAGAAGAAGG - Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1035245365 7:157559433-157559455 CTGGACGAGCAGAGGAATGAGGG + Intronic
1035278924 7:157765326-157765348 ATGGATGGGTGGATGGATGATGG - Intronic
1035279038 7:157765830-157765852 GTGGATGAGTGGATGGATGGAGG - Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035279155 7:157766347-157766369 ATGGATGGGTAGATGGATGATGG - Intronic
1035296974 7:157872813-157872835 CTGGCGGGGTAGAGGGGTGACGG + Intronic
1035318719 7:158014444-158014466 ATGGATGGGTAGATGGATGGAGG - Intronic
1036536317 8:9655900-9655922 CTTGATGAGTTGAGAGAAGAAGG + Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038325130 8:26567235-26567257 GTGGATGGATAGATGGATGATGG - Intronic
1038555020 8:28505176-28505198 CTGGATCAGTAGAGGGATGGAGG - Intronic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1044061949 8:87649160-87649182 TTTGATGAGTTGAGAGATGAAGG + Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045398463 8:101785637-101785659 CTGGGTTAGTACAGGGAAGACGG + Intronic
1045419639 8:102001033-102001055 TTTGATGAGTAGAGAGAAGAAGG + Intronic
1045733963 8:105273806-105273828 GTGGATTAGGAGAGGGATAAAGG + Intronic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1048043899 8:130755555-130755577 CTGGAAGAGGACAGGGAGGAGGG - Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048979739 8:139696917-139696939 GTGGATGGATAGATGGATGAAGG + Intronic
1048979769 8:139697020-139697042 GTGGATGGGTAGATGGGTGAAGG + Intronic
1049035869 8:140075448-140075470 CTGGAGGAGGAGAGGGATGTGGG - Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049431584 8:142567673-142567695 CTCGAGGACCAGAGGGATGAGGG + Intergenic
1051194982 9:14554360-14554382 CTGGATGAGGAAAAGGCTGAAGG - Intergenic
1051369811 9:16348681-16348703 CCGCATGAGGAGAGGCATGAGGG + Intergenic
1052220077 9:26010187-26010209 CTGGATAGGTGGATGGATGACGG - Intergenic
1052448957 9:28601470-28601492 CTGGAGGACTAGAGGTATCAGGG + Intronic
1053575902 9:39357417-39357439 CTGGATGCGGAGGGGGGTGAGGG + Intronic
1053840418 9:42185354-42185376 CTGGATGCGGAGGGGGGTGAGGG + Intronic
1054097471 9:60916108-60916130 CTGGATGCGGAGGGGGGTGAGGG + Intergenic
1054118874 9:61191738-61191760 CTGGATGCGGAGGGGGGTGAGGG + Intronic
1054454248 9:65421401-65421423 ATGGATGAGTGGATGGATAATGG + Intergenic
1054454363 9:65421971-65421993 GTGGATGAGTGGATGGAAGATGG + Intergenic
1054459172 9:65453469-65453491 CTGGCTGGGTGGATGGATGATGG + Intergenic
1054588878 9:66990824-66990846 CTGGATGCGGAGGGGGGTGAGGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055922862 9:81479806-81479828 CTGGATGAGGAGATGGGTGGAGG + Intergenic
1055986887 9:82061986-82062008 CTGGATGCAGAGAGGGGTGAGGG - Intergenic
1056095763 9:83251444-83251466 TTGGATGAGAAGAGGCATTATGG - Intronic
1056584506 9:87919579-87919601 CTGGATGCGGAGGGGGGTGAGGG + Intergenic
1056612360 9:88133341-88133363 CTGGATGCGGAGGGGGGTGAGGG - Intergenic
1057160289 9:92884228-92884250 CTGGATGCGGAGGGGGTTGAGGG + Intergenic
1057230178 9:93317188-93317210 GTGGCTGAGTAGAGGCATGTGGG + Intronic
1057273295 9:93662776-93662798 GTGGATGGGTAGATGGATGGAGG + Intronic
1057563438 9:96146957-96146979 CTGGATGATTATAGGCGTGATGG + Intergenic
1058230883 9:102422898-102422920 CTGGATGGATCGATGGATGATGG - Intergenic
1058714740 9:107713605-107713627 GTGGAGGAGTAGAGGGAGGGAGG + Intergenic
1059252212 9:112895746-112895768 GTGGATGGGTAGATGGATAATGG - Intergenic
1059365505 9:113783693-113783715 ATAGATGAATAGATGGATGATGG + Intergenic
1059858949 9:118435288-118435310 ATGAATGGGTAGAAGGATGATGG - Intergenic
1061244857 9:129396309-129396331 ATGGATGAGATGATGGATGAAGG + Intergenic
1061245102 9:129397533-129397555 ATGGATGGGTAGATGGATGATGG + Intergenic
1061256548 9:129456876-129456898 ATGGATGAGTGGAGGGATATGGG + Intergenic
1061417464 9:130454864-130454886 ATGGATGGGTGGATGGATGATGG - Intronic
1061417470 9:130454887-130454909 GTGGATGAGTGGATGGGTGATGG - Intronic
1061417499 9:130455029-130455051 ATGGATGAATGGATGGATGATGG - Intronic
1061417511 9:130455094-130455116 ATGGATGGATAGACGGATGATGG - Intronic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1061911821 9:133729051-133729073 GGGGATGGGTGGAGGGATGAAGG + Intronic
1061964066 9:134003373-134003395 GTGGATGGGTAGAGGGTGGATGG - Intergenic
1061981017 9:134103679-134103701 CTGGATGAATGGACGGATGCTGG - Intergenic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062281290 9:135752900-135752922 AGGGATGAGTGGATGGATGATGG + Intronic
1062281321 9:135753074-135753096 ATGGATGAGTGGATGGATGGAGG + Intronic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1186526953 X:10257577-10257599 CTGGGAGGGTAGAGGGATGTTGG + Intergenic
1186598052 X:11006147-11006169 GTGGATGAGAGGAGGGAAGAAGG - Intergenic
1187257983 X:17658568-17658590 CTAGAAGACTAGAGGAATGATGG - Intronic
1188675819 X:32937632-32937654 TTGGATGAGTAGACGAATGGAGG + Intronic
1188820583 X:34770182-34770204 ATGGACCAGTAGAGAGATGAGGG - Intergenic
1190817145 X:53938801-53938823 CAGGATGAGGAGAGGTATGAAGG - Exonic
1191656933 X:63608174-63608196 TTGGATGAGTTGAGAGAAGAAGG + Intergenic
1194097545 X:89661393-89661415 CGGGAAGAGTAGTGGGATGATGG - Intergenic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1195203858 X:102575445-102575467 CTTGATGAGTTGAGAGAAGAAGG + Intergenic
1195205462 X:102595426-102595448 CTGGATGGGTAGAAGGGAGAGGG - Intergenic
1196659065 X:118251032-118251054 CTGGATATGTTGAGGGATGTAGG - Intergenic
1197010550 X:121556918-121556940 TGGGATGGGTAGTGGGATGAGGG + Intergenic
1197344633 X:125318041-125318063 CTGGAGGAGTAGGGGGATGTAGG - Intergenic
1198275660 X:135095709-135095731 CTGGAGGAGAAGAGGAGTGAGGG - Intergenic
1200450565 Y:3322767-3322789 CGGGAAGAGTAGTGGGATGATGG - Intergenic
1200781575 Y:7221077-7221099 ATGGATGAATGGATGGATGATGG + Intergenic
1202022345 Y:20478301-20478323 TTTGATGAGTTGAGGGAAGAAGG + Intergenic