ID: 958991858

View in Genome Browser
Species Human (GRCh38)
Location 3:100855304-100855326
Sequence ATGTTTCCACAGCAGTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958991858_958991861 -8 Left 958991858 3:100855304-100855326 CCCTGATACTGCTGTGGAAACAT 0: 1
1: 0
2: 2
3: 14
4: 171
Right 958991861 3:100855319-100855341 GGAAACATGTGATGGCATACAGG 0: 1
1: 0
2: 1
3: 9
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958991858 Original CRISPR ATGTTTCCACAGCAGTATCA GGG (reversed) Intronic
900229815 1:1550950-1550972 ATGTGTCCACAGCAGAAACCTGG - Intronic
905453634 1:38073044-38073066 ATTTTTCCACACCCGTCTCATGG + Intergenic
908312885 1:62903223-62903245 ATGTTTTAGCAACAGTATCATGG - Intergenic
908895886 1:68897972-68897994 ATGTTTCCACTGCTTTCTCATGG - Intergenic
908985764 1:70018788-70018810 ATGTTTCCCCAGCAGCCTCGTGG + Exonic
911514727 1:98853620-98853642 ATGGTCCTACAGCAGAATCAGGG + Intergenic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
917901450 1:179547002-179547024 ATGTTTCCCAAGTAGTATCTGGG - Intronic
919538452 1:198817862-198817884 ATACTTTTACAGCAGTATCATGG + Intergenic
920874708 1:209823393-209823415 ATGTTTCATCAGGTGTATCAGGG - Intergenic
921626908 1:217387361-217387383 ATGTTTCCACCTCAGTCTCTTGG + Intergenic
922603936 1:226877360-226877382 CTGTTTCCTCATCAGTACCATGG + Intronic
922881719 1:228986098-228986120 ATGTTTCTAAAGCAATGTCACGG + Intergenic
1065045227 10:21741639-21741661 ACTTTTCCACAGAAGTAACATGG - Intronic
1065650486 10:27884272-27884294 ATGTTTCCATAGGAGAATGAGGG - Intronic
1065740272 10:28791146-28791168 ATATTTGCACAGCAAAATCAGGG + Intergenic
1068593015 10:58869501-58869523 ATGTTTCCTCATCATTACCAAGG - Intergenic
1069033386 10:63622306-63622328 ATGTTTACACAGGAGTACCTTGG + Exonic
1072835679 10:98709432-98709454 ATGTTTCCATAGCTGAATTATGG + Intronic
1073832543 10:107402591-107402613 ATGTTTCCAGATCAGCATCATGG + Intergenic
1074789378 10:116870945-116870967 ATGATTCCCCTGCAGTATCTGGG - Intronic
1074801106 10:117002399-117002421 ATGTTTACTCAGCATTATTAAGG + Intronic
1075444098 10:122501749-122501771 ATGCTTCCACAGCATGGTCATGG + Intronic
1078530151 11:12130871-12130893 CTCTTCCCACAGCAGTATCAGGG - Intronic
1082646558 11:55733766-55733788 ATGTTTTCACAGCAATGCCATGG - Intergenic
1086239367 11:84670797-84670819 ATGAGTCCACAGCAATATTAGGG - Intronic
1086304306 11:85463192-85463214 TTGTATCCTCAGGAGTATCAAGG + Intronic
1089949134 11:122509376-122509398 ATGTTTCCACCACAGAATCATGG - Intergenic
1091409845 12:232170-232192 GTGTTTCCACAACAGATTCATGG - Intronic
1091776477 12:3188197-3188219 CTGTTTCCTCATCAGTATAATGG - Intronic
1092321977 12:7486002-7486024 ATGTATACAAAGCAGTATGAGGG + Intronic
1093540262 12:20274329-20274351 AAGATTCCACAGCTGTAACATGG - Intergenic
1093889112 12:24498268-24498290 TTGTTTCCACACCAGTAAAAGGG - Intergenic
1097901995 12:64882535-64882557 ATGAATACACAGCAGTATGAGGG - Intergenic
1098464847 12:70774936-70774958 AAATTTTCACAGCAGTAACAAGG + Intronic
1099322658 12:81169913-81169935 ATGTTTCCACAGCAGTTCTAAGG - Intronic
1099725074 12:86415445-86415467 ATGAATACACAGGAGTATCATGG + Intronic
1099933004 12:89095247-89095269 ATGGTTCTACATCTGTATCATGG + Intergenic
1100955511 12:99903649-99903671 ATGTATCCAAAATAGTATCATGG + Intronic
1104081226 12:125431901-125431923 AGGTTTCCAGAGCAGAATCCAGG - Intronic
1105451355 13:20502777-20502799 AAGTTTACACTGGAGTATCAAGG + Intronic
1105743124 13:23349758-23349780 CTGTTTCCTCATCAGTAACATGG - Intronic
1105798280 13:23879777-23879799 AAGGTCCCACAGCAGTAACAAGG - Intronic
1106778089 13:33027695-33027717 ATATTTCAACAGCAGTAACCTGG - Intronic
1113510035 13:110846540-110846562 ATGTTTCCCCAACAGCTTCAGGG - Intergenic
1113916286 13:113875918-113875940 CTGTTTCCTCAGCAGCTTCATGG - Intergenic
1114712591 14:24793665-24793687 TTGTTTCCAAAGAAGTGTCAGGG + Intergenic
1115342119 14:32304106-32304128 ATGTTTCCACATCAGTAACAAGG + Intergenic
1118528236 14:66670188-66670210 ATGCCTACACAGCAGTAACATGG - Intronic
1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG + Intergenic
1122056281 14:99100464-99100486 ATGTCCCCACAGCAGCTTCATGG + Intergenic
1124912256 15:33933295-33933317 GTCTTTCCAAAGCAGTAACAAGG + Intronic
1126800155 15:52291006-52291028 GAGTTTCCACACCAGTATAATGG - Intronic
1126900035 15:53305392-53305414 TGGTTTCCACACTAGTATCAGGG - Intergenic
1127455129 15:59150123-59150145 ATGTTTGCACAGCAGATTTAAGG + Intronic
1128175525 15:65552108-65552130 ATGTTTCCACAGGACTCTCAAGG + Intronic
1128281810 15:66401270-66401292 ATGTAACAACAGCAGTAGCACGG - Intronic
1130611756 15:85367550-85367572 ATGTTTCCCTAGCAGTATCCTGG - Intergenic
1130728065 15:86461547-86461569 AAGATTTCACAGGAGTATCACGG + Intronic
1132826837 16:1909399-1909421 ATGTTGCCACTGCAGTCTCTGGG + Intergenic
1135158040 16:20071154-20071176 CAGTTTCCACAGCAGTAAAATGG - Intronic
1135945813 16:26863997-26864019 TTGTTTCAACAGCAGCTTCATGG + Intergenic
1137639465 16:50015744-50015766 ATGATTGCACAGCAGGATGAAGG - Intergenic
1143838273 17:9710233-9710255 AGGTTTCTACAGCAGCATCCCGG - Intronic
1146474837 17:33154435-33154457 ATGCTTCCCCAACAATATCATGG + Intronic
1149298411 17:55282296-55282318 GTGTTCCCAAAGCAGCATCACGG - Intronic
1151629834 17:75302951-75302973 TTGTTTCCTCAGCAGTATGATGG - Intergenic
1152840631 17:82565720-82565742 CTGTTTCCACAGCAGCTGCACGG - Intronic
1153942737 18:9991598-9991620 AAGGATCCACAGCAGCATCAAGG - Intergenic
1153994986 18:10432886-10432908 CTGTTTGCACAGCAGTAGAATGG + Intergenic
1156962152 18:43045407-43045429 ATGTTTTCATTGCAGGATCAGGG - Intronic
1158960664 18:62585122-62585144 ATGTTTCCAGAGAAATATCCAGG + Intronic
1163049089 19:14667889-14667911 ATGGTTCCACAACATTATGAAGG - Intronic
1166345530 19:42162997-42163019 CATTTTCCACAGCAGTGTCATGG - Intronic
1168360046 19:55731841-55731863 ATGATCCCACAGCAGTGCCAAGG + Intronic
927352250 2:22130014-22130036 ATGGTTCCAAACCAGTGTCATGG - Intergenic
928974934 2:37076490-37076512 ATGTTTCCACTGAAGGATCTAGG - Intronic
929048383 2:37813266-37813288 ATGCTTTCACAGCAGTATTCAGG - Intergenic
932330997 2:70898207-70898229 ATCTTTCCACACCAGTAACTCGG - Intergenic
933508512 2:83209408-83209430 ATGTTTCCAGATCATTTTCATGG - Intergenic
938162902 2:129002439-129002461 ATGTTTCCACGTCAGAAACATGG - Intergenic
938422936 2:131158307-131158329 AATTTGCCACAGCAGTAACAGGG + Intronic
940083029 2:149826260-149826282 ATGTTTCTACAGGAGGATGAGGG + Intergenic
942668241 2:178345592-178345614 CTGTTACCACATCAGTGTCATGG - Intronic
944472186 2:200065709-200065731 TTATTTCCAGAGCAGTCTCAGGG + Intergenic
944677511 2:202046714-202046736 AGGGTTCCACAGGAGGATCATGG + Intergenic
945042477 2:205753669-205753691 GTGCTTTCACAGCAGTATGATGG + Intronic
946544787 2:220727467-220727489 ATGTTTCCATTGCATTATTAAGG - Intergenic
947831892 2:233147294-233147316 ATGTTTCCACAGGCGTCTCCCGG - Intronic
948352925 2:237355570-237355592 TTGTTTCCTCAGCAGTAGAAAGG + Intronic
1170337231 20:15283136-15283158 ATGTGTCAAAAGCAGTACCAAGG - Intronic
1173890904 20:46509473-46509495 AAGTTTCCTCAGCAGGAGCATGG + Intronic
1176427363 21:6557106-6557128 ATGTTTGCACAGCAGGCTCCGGG + Intergenic
1179702854 21:43165423-43165445 ATGTTTGCACAGCAGGCTCCGGG + Intergenic
1181120687 22:20667025-20667047 GTGTTTCCACTGCAGTATTTGGG - Intergenic
949588598 3:5468609-5468631 TTGTTTCCACAACACAATCAAGG + Intergenic
952744716 3:36765556-36765578 TTTTTTGCACAGCAGCATCATGG - Intergenic
957305441 3:78452274-78452296 AAGTTGCCACAGCATTCTCAGGG + Intergenic
957849182 3:85783400-85783422 ATGTTACCACAGCAGAAACTTGG - Intronic
958601764 3:96303086-96303108 ATATTTCCATTGCAGTATAATGG - Intergenic
958617218 3:96510643-96510665 ATTTTTTCACAGCAGCATGAGGG + Intergenic
958991858 3:100855304-100855326 ATGTTTCCACAGCAGTATCAGGG - Intronic
959984708 3:112559980-112560002 CAGTTTGCACAGGAGTATCAAGG + Intronic
960679143 3:120228640-120228662 GCATTTCCACAGCAGTATCTGGG - Intronic
962791186 3:138813027-138813049 ATGTTACCACTGGAGTATTATGG + Intronic
965918645 3:173883737-173883759 ATGTTGACATGGCAGTATCATGG + Intronic
971178706 4:24307189-24307211 AAGTCTCTACAGCAGTACCATGG + Intergenic
971558835 4:28047949-28047971 CTCTTTCCACAGCAGCAGCATGG - Intergenic
975292693 4:72695746-72695768 ATGTTCCCACAGCAGAGACAGGG - Intergenic
975365943 4:73527668-73527690 ATGTTTCCAAGCCAGTGTCAAGG + Intergenic
977776398 4:100925137-100925159 ATGTGGCCACAGAAATATCAAGG + Intergenic
978176441 4:105737742-105737764 ATGTTTTTACAGAAGTGTCAAGG - Intronic
978319924 4:107482149-107482171 CTGTATCCACAGCAGTATGTGGG - Intergenic
984444761 4:179822676-179822698 ATGTATGCACCACAGTATCATGG - Intergenic
984624601 4:181991780-181991802 CTCTTTCCACTGCAGTATCATGG - Intergenic
986218031 5:5739343-5739365 ATGTTTCCATTGCAGAAGCATGG - Intergenic
986640796 5:9870012-9870034 ATCTTTCAACAGCATTAGCATGG + Intergenic
986804224 5:11293089-11293111 TTGTTTGCACAGCTGTATAATGG - Intronic
987485006 5:18515248-18515270 ATGTTTCTTCAACAGGATCAAGG - Intergenic
993229636 5:85217259-85217281 GTGTTTGCCTAGCAGTATCATGG - Intergenic
994762399 5:103872248-103872270 ATGTTTCCACAGCAGTGAAGAGG - Intergenic
995499906 5:112793410-112793432 ATGTTCTCTCAGCAGAATCAGGG - Intronic
995625869 5:114076073-114076095 ATTCCTGCACAGCAGTATCAGGG - Intergenic
997526145 5:134554510-134554532 ATGTTTCCACACCAGTAGCTTGG + Intronic
1001827500 5:174757394-174757416 ATGTTACAAAAGCAGTAACAAGG - Intergenic
1002378937 5:178811056-178811078 ATGTATACCCAGCAGTAGCATGG - Intergenic
1003258831 6:4497644-4497666 CTGTTTCCCCAGCTGTACCATGG - Intergenic
1004294527 6:14398111-14398133 AAAAATCCACAGCAGTATCATGG - Intergenic
1008913062 6:56757528-56757550 ATGTGTCCCCATCAGAATCAGGG - Intronic
1009700641 6:67174014-67174036 TTCTTTGCACAGAAGTATCAAGG - Intergenic
1009786010 6:68340507-68340529 ATGTTTACATAGCAGTTTCATGG - Intergenic
1010372318 6:75125013-75125035 ATGTTTCCTCAGCATTATGTAGG - Intronic
1014157688 6:118130145-118130167 CTGTTTCCACAACTGTAACATGG + Intronic
1014839494 6:126201190-126201212 CTGTTTCCGAAGCACTATCATGG - Intergenic
1019997791 7:4735835-4735857 ATGTTTCCCCAGCATGCTCAGGG - Intronic
1022530569 7:31064434-31064456 AAGTTTCCACATCAGTAAAATGG + Intronic
1024634463 7:51275833-51275855 ATGTTTCCACAGCCTGATTAGGG + Intronic
1025107684 7:56185804-56185826 ATGTTTCCCCAGCACCATCTTGG - Intergenic
1026310564 7:69180284-69180306 ATGTTTCCCCAGCACCATCTTGG + Intergenic
1026381764 7:69807084-69807106 GTGGTTGCACAACAGTATCATGG + Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028400715 7:90422596-90422618 ATGATTCCACACCAGAAACAAGG + Intronic
1030253635 7:107481316-107481338 ATGTGTCCACAGCTGTCTGAGGG - Intronic
1030856951 7:114570528-114570550 AGGTTCCTACAGCAGTATCATGG + Intronic
1031349373 7:120710259-120710281 ATGTTTGCACACCAGGAACAAGG + Intronic
1033484737 7:141777401-141777423 ATGTTACCAAAGTAGCATCAAGG - Intronic
1034180262 7:149131746-149131768 ATGTTTCCAAAGCTGGATTATGG - Intronic
1034727400 7:153350483-153350505 GTGTCCCCACAGCAGTGTCATGG - Intergenic
1036725885 8:11220379-11220401 TTTTAGCCACAGCAGTATCAAGG - Intergenic
1037407581 8:18559887-18559909 CTGTTTCTACAGCAGCATAAAGG + Intronic
1037931293 8:22881866-22881888 AAGTTTCCCCAGCAGTAAAATGG + Intronic
1038358553 8:26854575-26854597 ATGTTTCCATCCCAGTCTCAGGG - Intronic
1038570968 8:28662592-28662614 AGGTTTCCTCTGCAGTGTCATGG - Intronic
1039235774 8:35501137-35501159 GTGTTTCCAGAGTAGTTTCATGG - Intronic
1041190703 8:55351091-55351113 ATGTTTGCACAGCAATGTGATGG + Intronic
1042895923 8:73667615-73667637 ATGTTTCCATAGCACCATCGGGG + Intronic
1043609785 8:82048416-82048438 AAGTTACCACAGCAGTTTAATGG - Intergenic
1044780656 8:95740363-95740385 TAGTTTCCACATCTGTATCATGG + Intergenic
1045484323 8:102618859-102618881 GTGGTTCCATAGCATTATCATGG + Intergenic
1046420092 8:113970229-113970251 GTGATTGAACAGCAGTATCATGG - Intergenic
1046797088 8:118384991-118385013 ATGTTCCCGCAGCAGGAACATGG + Intronic
1046883893 8:119341133-119341155 GAGCTTCCACAGCAGCATCATGG - Intergenic
1048717589 8:137285754-137285776 ATGTTTACACAGCAGTGTGTAGG - Intergenic
1049493636 8:142917887-142917909 ATGTTTCCAGAGCAGGTTCCTGG - Intergenic
1051293209 9:15566940-15566962 AATTTTCAACAGAAGTATCAAGG - Intronic
1051666403 9:19470727-19470749 ATGGTGTCACATCAGTATCATGG - Intergenic
1051757079 9:20413472-20413494 ATATTTCCATAGCATTATAATGG - Intronic
1052349178 9:27440906-27440928 ATTTTTCCACAGCAGGGTTAGGG + Intronic
1052557903 9:30042825-30042847 ATATTTCTACAGAAATATCATGG - Intergenic
1054769163 9:69068313-69068335 CTGTTTGCACAGCAAAATCAGGG + Intronic
1054989177 9:71301886-71301908 ATGTTTCCACAGAAATAGAAAGG - Intronic
1055015550 9:71613947-71613969 AAGTTTCCACATCAGTATAATGG - Intergenic
1055032568 9:71785286-71785308 ATGTTCCCACTGAAGTATTAGGG + Intronic
1056488213 9:87080145-87080167 ATTTCTTCACAGCAGTATGAAGG + Intergenic
1057846947 9:98533217-98533239 ACTTTTCCAGAGCAGTATCCTGG + Intronic
1058197815 9:102000364-102000386 ATGTTTCCCCATCAGTAGAATGG + Intergenic
1060228656 9:121811527-121811549 CTGTTTCCTCAGCTGTATAAGGG + Intergenic
1060941874 9:127547211-127547233 CTGTTTCCTCAGCTGTAACATGG + Intronic
1186748275 X:12593254-12593276 ATTTTTCCACAGTAGCTTCAGGG + Intronic
1189241004 X:39524374-39524396 ATGTTCCCACAGCTGATTCAAGG + Intergenic
1191904714 X:66076231-66076253 ATGTTTCCAAACCAGTACCCTGG - Intergenic
1193982428 X:88199411-88199433 AAGTTTCCACAGAACTAACATGG + Intergenic
1195919823 X:109972467-109972489 ATGTTGCCAAAGCAGTATCAAGG - Intergenic
1196872749 X:120128174-120128196 ATGTTTGCTTAGAAGTATCAGGG - Intergenic
1198577546 X:138026322-138026344 ATGTGTCCACAGCAGTACTCTGG - Intergenic
1199530921 X:148846778-148846800 ATGTTTACACAGTAATATCATGG + Intronic
1200014557 X:153148253-153148275 AGGTTTCTAAAGCAGTTTCAAGG + Intergenic
1200025045 X:153251701-153251723 AGGTTTCTAAAGCAGTTTCAAGG - Intergenic