ID: 958996540

View in Genome Browser
Species Human (GRCh38)
Location 3:100912179-100912201
Sequence CTGCCGTCGGCTCAGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958996534_958996540 5 Left 958996534 3:100912151-100912173 CCAAGAACACCTGCTCTTACCCT 0: 1
1: 0
2: 1
3: 24
4: 244
Right 958996540 3:100912179-100912201 CTGCCGTCGGCTCAGGCTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
958996535_958996540 -4 Left 958996535 3:100912160-100912182 CCTGCTCTTACCCTTCGTGCTGC 0: 1
1: 0
2: 1
3: 15
4: 168
Right 958996540 3:100912179-100912201 CTGCCGTCGGCTCAGGCTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
958996533_958996540 6 Left 958996533 3:100912150-100912172 CCCAAGAACACCTGCTCTTACCC 0: 1
1: 0
2: 1
3: 15
4: 184
Right 958996540 3:100912179-100912201 CTGCCGTCGGCTCAGGCTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958996540 Original CRISPR CTGCCGTCGGCTCAGGCTTC AGG Intronic
900977764 1:6027830-6027852 GTCCCCTCGGCTCAGGCCTCAGG + Intronic
902358728 1:15929129-15929151 CTGCAGGCTGCTCAGGCTTGAGG - Exonic
905875478 1:41429352-41429374 CTACCTTTGGATCAGGCTTCAGG - Intergenic
909661901 1:78092824-78092846 CTGCTGTCTGCTCTGACTTCCGG + Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
913039272 1:115007145-115007167 CAGCCGTGGGCTCATGCTTATGG - Intergenic
916362175 1:163982915-163982937 CTGCCTTCTTCTCAGGATTCAGG - Intergenic
923205439 1:231754335-231754357 CTGGCATCTGCTCTGGCTTCTGG + Intronic
1063486214 10:6423413-6423435 ATGCCGTCTGCTCAGTCTCCTGG - Intergenic
1071166658 10:82815769-82815791 CTGCACTCGGCTCATGCTACTGG + Intronic
1071517711 10:86310092-86310114 CTGCCCTGGGCACAGGATTCTGG - Intronic
1072825225 10:98599242-98599264 CTCCTGTGGCCTCAGGCTTCAGG - Intronic
1073462943 10:103676932-103676954 CTGGCTTTGGCTCGGGCTTCTGG - Intronic
1074991437 10:118712238-118712260 CTGCGCTCGGCTCATGCTACTGG + Intronic
1076995749 11:296786-296808 CTGCCTCAGGCTCAGGCTCCTGG - Intergenic
1077046912 11:550843-550865 CTGCCCTCAGCTCAGGGCTCTGG - Intronic
1078003336 11:7514309-7514331 CTGCCCTCCTCCCAGGCTTCTGG - Intronic
1079145455 11:17847272-17847294 CTGCCGTCTGCTCAGGCATGTGG - Intronic
1079888956 11:26026210-26026232 TTGCTGTGGGCTCAGGCTTCTGG + Intergenic
1082999698 11:59280160-59280182 AGGCCATCGGCTCAGGCTTGGGG - Intergenic
1083313075 11:61795692-61795714 CTGCAGCAGGCTCAGGCTGCTGG + Exonic
1088036181 11:105318710-105318732 CTGCCATCTTCTCAGCCTTCAGG - Intergenic
1088893792 11:114063274-114063296 CTCCCCTCGGCTCAGGCATGAGG - Exonic
1088913324 11:114208574-114208596 CTGTCATGGGCTCTGGCTTCAGG + Intronic
1096575693 12:52551513-52551535 CTGCCCTCGGCTCAGCCTCAGGG - Intronic
1104929411 12:132329891-132329913 CTGCCCTCGGGTCAAGCTTGGGG - Intergenic
1106368141 13:29104094-29104116 CCACCCTGGGCTCAGGCTTCAGG + Intronic
1107094032 13:36515483-36515505 CTGTGGTAGTCTCAGGCTTCAGG - Intergenic
1110809076 13:79791687-79791709 CTGCAGCCTGCTCAGGTTTCAGG - Intergenic
1111567417 13:90033365-90033387 CTGGGCTCGGCTCAGGCTACTGG - Intergenic
1113592891 13:111513144-111513166 CTCCCGTAGTCTCAGGCTCCAGG + Intergenic
1113804564 13:113105868-113105890 CTGCCTTCTGCTTGGGCTTCAGG + Exonic
1124241430 15:28031385-28031407 GAGCAGGCGGCTCAGGCTTCTGG + Intronic
1125606017 15:40940491-40940513 CTGCTGCCGGCTCAGGCTGTGGG - Intergenic
1130564473 15:84981887-84981909 CGGCCGTCGGCTCCTGCCTCAGG + Intronic
1131160912 15:90104228-90104250 CTCCCTTGGGCTCAGCCTTCTGG - Intergenic
1140035702 16:71369690-71369712 CTGCCCTAGCCTCGGGCTTCTGG + Intronic
1142120449 16:88383992-88384014 CTGCCCTCGGCCCAGGGTGCAGG - Intergenic
1142338360 16:89505253-89505275 CTGCTGTGGGCTGAAGCTTCAGG - Intronic
1142624976 17:1186268-1186290 CTGCCCTCTGCTCAGCCTCCCGG + Intronic
1143006617 17:3840022-3840044 CTGCCATCACCTCATGCTTCTGG - Intronic
1149430707 17:56594072-56594094 CTCCCGGCGGCTCATGCTGCCGG + Exonic
1149774417 17:59346045-59346067 CTGCTCTAGGCTCAGGATTCTGG + Intronic
1151569735 17:74920266-74920288 CAGCCGGCGGCTCAGGGTGCTGG + Exonic
1152795791 17:82305517-82305539 CTGCCGTCTCCTCTGGCATCAGG + Intergenic
1153473279 18:5469562-5469584 CTGCAGTTGGCTCATGCTACTGG - Intronic
1157332686 18:46714988-46715010 CTGCGGCCGGCTGAGGCTGCTGG - Intronic
1159458680 18:68694549-68694571 CTGCCCTTGGCTCATGCTACCGG - Intronic
1160766135 19:808906-808928 CAGCCCTCGGCTCAAGCTCCAGG - Intronic
1161327302 19:3670037-3670059 CTGCCGCCTGCAGAGGCTTCTGG - Intronic
1163326392 19:16606116-16606138 CTGCCGTGGGCCCAGGCGTGTGG - Intronic
1165415950 19:35693667-35693689 CTTCCCTAGGCTCAGGCTTAGGG - Intergenic
926593106 2:14760371-14760393 CTGGGGTCGCCTCAGGCTCCCGG - Intergenic
927502944 2:23594316-23594338 CTGCGGGCGCCTCAGACTTCAGG - Intronic
929266104 2:39920612-39920634 CTGCCTGTGGCTCATGCTTCAGG + Intergenic
929557217 2:42932974-42932996 CTGCCCTCAGCTCAGGACTCCGG - Intergenic
932144465 2:69306074-69306096 CTGCTGTCGCCTCAGGGTCCCGG - Intergenic
933721572 2:85400684-85400706 CTGGCTTCGGCTCAGGCTAGAGG + Intronic
937223534 2:120355481-120355503 CTGCCCTTGGCTCTGGCCTCAGG + Intergenic
941853513 2:170207501-170207523 CTGCCATCGTGTCAGGCTTTTGG + Intronic
943390155 2:187256259-187256281 CTGGCATCTGCTCAGGCTTTGGG - Intergenic
943470822 2:188292133-188292155 AGGCAGTCGGGTCAGGCTTCGGG - Intronic
943770783 2:191714042-191714064 CTGCCCTCAGCCCAGGCTTAGGG - Intergenic
944451815 2:199851179-199851201 CTGCCGCCGGCTCCGCCTCCCGG + Intergenic
947461496 2:230307755-230307777 CTGCACTTGGCTCAGGCTACTGG - Intronic
948926597 2:241102510-241102532 CTGCCGCGGCCTCAGCCTTCGGG + Intergenic
1170430952 20:16276065-16276087 CTCCTGTGGGCTCCGGCTTCAGG + Intronic
1174056322 20:47800754-47800776 CAGCCGTCTGCTCAGGCCTCTGG - Intergenic
1178601504 21:33998814-33998836 CAGGCCTCGGCTTAGGCTTCAGG - Intergenic
1182117197 22:27763616-27763638 CTGCCCTAGGCCCAGGCTTGGGG - Intronic
1184899885 22:47439346-47439368 GTGCCGACAGATCAGGCTTCAGG - Intergenic
949564540 3:5232673-5232695 CTTCCGTGTGCTCAGGCCTCTGG + Intergenic
954876009 3:53803634-53803656 CTGCCGGTGGCCCTGGCTTCCGG - Intronic
958996540 3:100912179-100912201 CTGCCGTCGGCTCAGGCTTCAGG + Intronic
960005482 3:112777042-112777064 CAGCTGTTGGCCCAGGCTTCAGG - Intronic
962436128 3:135368438-135368460 CTGCCGGGGACTCAGCCTTCAGG + Intergenic
968545336 4:1195120-1195142 CAGCCGGCGGCTCAGGGCTCAGG + Intronic
968585114 4:1412704-1412726 CTGCCCTCGGATCAGGCCACGGG + Intergenic
969718230 4:8878707-8878729 CTGCAGCCGTCTCAGGCTGCCGG + Intergenic
981052066 4:140319058-140319080 CTACTGTGAGCTCAGGCTTCTGG + Intronic
982184442 4:152781192-152781214 CAGCCGTCTGTTAAGGCTTCAGG + Intronic
986402059 5:7392381-7392403 CTGCCGTAGGCTCTGCCTGCAGG + Intergenic
993088333 5:83392657-83392679 CTCCCGTGGGCTCAGGCCTTCGG - Intergenic
996082588 5:119271957-119271979 CTGCAGTTGGCTCAGACTCCAGG - Intronic
1004183222 6:13398716-13398738 CTGCCGCCTGCTCAGCCTCCCGG + Intronic
1008028614 6:46667527-46667549 CTGCTGCCGGCCCAGTCTTCTGG + Intronic
1015206739 6:130649202-130649224 CTGCAGTCGGCTCCTGCTGCAGG + Intergenic
1020649396 7:10855859-10855881 CTGCACTCGGCTCATGCTACTGG - Intergenic
1022274982 7:28846366-28846388 GTGACGTCAGCTCAGGCTTTGGG - Intergenic
1024991217 7:55235673-55235695 CTGCAGACCGCTCATGCTTCAGG + Intronic
1025236677 7:57239399-57239421 CAGCCATCTGCTCAGGCCTCTGG + Intergenic
1025263598 7:57438655-57438677 CTGCCTCTGGCTCAGGCTTGTGG + Intergenic
1025635642 7:63317480-63317502 CTGCCTCTGGCTCAGGCTTGTGG - Intergenic
1025647054 7:63430700-63430722 CTGCCTCTGGCTCAGGCTTGTGG + Intergenic
1028527275 7:91800499-91800521 CTGCAGTCAGCTCATGCTTCTGG + Intronic
1036575251 8:10021966-10021988 GTGCTGTCTGCTCAGGCTGCTGG + Intergenic
1038538464 8:28371746-28371768 CTGCCTTAAGCTCAGACTTCCGG + Intronic
1039612743 8:38932401-38932423 CTGGAGTCGGTTCAGGCTTCAGG + Intronic
1043737565 8:83767710-83767732 CTGTCCTCGGCTCATGCTACCGG + Intergenic
1047104551 8:121719163-121719185 CTGCGCTCGGCTCACGCTACTGG + Intergenic
1049491734 8:142907535-142907557 CTGCCGTCTCCTCAGGTTGCTGG + Intronic
1049554454 8:143275103-143275125 CTGCCTTGGGCTGGGGCTTCTGG + Intronic
1049784035 8:144442061-144442083 CTGCCCTCTGCACAGGCTTCTGG + Exonic
1052857591 9:33416749-33416771 CTGCCGTCACCACAGGCTTAGGG + Intergenic
1057963248 9:99477660-99477682 CTGCAGTAGGCTCAGTCTTCAGG + Intergenic
1058687530 9:107491138-107491160 GTTCCTTCGGCTCAGGCTCCGGG + Intergenic
1058904300 9:109469158-109469180 CTTTCGTTGTCTCAGGCTTCAGG - Intronic
1058919578 9:109600204-109600226 CTTCCGTGTTCTCAGGCTTCTGG + Intergenic
1062173701 9:135149197-135149219 CCCCCTTAGGCTCAGGCTTCTGG - Intergenic
1062263864 9:135677870-135677892 CTGCCGTCAGCACAGGCACCTGG - Intergenic
1203759528 EBV:4917-4939 CACCCGTCGGCACAGGCATCCGG - Intergenic
1197892170 X:131278713-131278735 CTGCCCACAGCTCAGGCTTAGGG + Exonic