ID: 959000809

View in Genome Browser
Species Human (GRCh38)
Location 3:100962067-100962089
Sequence CATGGTCACTAATCTCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959000809 Original CRISPR CATGGTCACTAATCTCAAGT GGG Intronic
904926169 1:34049908-34049930 TAAGGGCACTAATCTCATGTTGG - Intronic
906221876 1:44086950-44086972 CATGACCACTTACCTCAAGTGGG - Intergenic
907070752 1:51532573-51532595 CATCGCCACTGACCTCAAGTGGG - Intergenic
908018374 1:59871977-59871999 CACAGTCACTGATCTCAACTAGG - Intronic
908727353 1:67191100-67191122 CATGACCACTAACCTCAACTGGG + Intronic
910203153 1:84721037-84721059 CAAAGTCACTAATCTCCAGATGG - Intergenic
910276630 1:85456267-85456289 AATGGTGACTAATGTCAAGATGG + Intronic
912245382 1:107956735-107956757 CATGATCCCTAACCTCAAGTGGG - Intronic
912504663 1:110148065-110148087 CATGGCCACCAACTTCAAGTGGG - Intergenic
912895958 1:113589334-113589356 CATGATCACTAACCTTATGTGGG - Intronic
917649833 1:177065427-177065449 CATGGTCCCTATTCTCAAAGAGG + Intronic
919092133 1:192988738-192988760 CATGATCACGAATCTCAAGTAGG - Intergenic
920258341 1:204671960-204671982 CATCGTCACTAATCTCACCCAGG + Intronic
921723701 1:218501480-218501502 CATGGTAATGTATCTCAAGTGGG - Intergenic
924070791 1:240276174-240276196 CATGGCCACTAACCTCAGGTGGG - Intronic
1063481307 10:6379027-6379049 CAAGTTCAGAAATCTCAAGTTGG - Intergenic
1067492444 10:46723942-46723964 CATATTCACTCATCTAAAGTGGG - Intergenic
1067602222 10:47616452-47616474 CATATTCACTCATCTAAAGTGGG + Intergenic
1069277720 10:66613211-66613233 CATGGCCATCAAACTCAAGTGGG - Intronic
1071613649 10:87055109-87055131 CCTGACCACTAACCTCAAGTAGG - Intronic
1072350122 10:94549194-94549216 CATGTTTATTAATCTCAAGTAGG - Intronic
1075917114 10:126177562-126177584 CATCGTCACAAATCTTCAGTAGG - Intronic
1076555536 10:131318875-131318897 CATGGACAGTAACCCCAAGTCGG - Intergenic
1079794803 11:24788064-24788086 CATTATCAGTAATCTTAAGTGGG + Intronic
1081381308 11:42419031-42419053 CATGCTCATTAATATCATGTTGG + Intergenic
1084343457 11:68525848-68525870 CATTGTCACTTACCTCAAGTTGG + Intronic
1084627110 11:70316580-70316602 CATGGTCCCCAACCTCACGTGGG - Intronic
1085065105 11:73488105-73488127 CATGATCACTATTTTCATGTGGG + Intronic
1087573338 11:99959213-99959235 CATGATCATCAATTTCAAGTGGG + Intronic
1090300969 11:125639271-125639293 CAGGATTACTAATCTCAAGTGGG + Intronic
1090516150 11:127429441-127429463 CCAGGTCACTAATTTCAACTAGG + Intergenic
1092437738 12:8465076-8465098 AATGGTAACTATTCACAAGTTGG - Intronic
1095644818 12:44530990-44531012 TATGATCACAAATCTCTAGTGGG - Intronic
1096066937 12:48748539-48748561 CATGATCACCAAACTCAAGCGGG + Intergenic
1096964724 12:55616955-55616977 GATGGTCTCTCATCTGAAGTTGG - Intergenic
1098577388 12:72058577-72058599 CGTGATCACTCACCTCAAGTGGG + Intronic
1099328204 12:81246313-81246335 CGTTGTCACTTATCTGAAGTAGG + Intronic
1099992118 12:89734777-89734799 CATGATCACTGATCTCATGAAGG + Intergenic
1102508714 12:113399838-113399860 CCTGGGCTCTAATCGCAAGTGGG + Intronic
1105432917 13:20353408-20353430 CAAGGTCACAAGTCTGAAGTAGG + Intergenic
1107097568 13:36552881-36552903 CATGGCCTCTAACCTCAAGTAGG - Intergenic
1107204321 13:37763541-37763563 CATGACCACTAATTTCAAGTGGG - Intronic
1109357799 13:61253859-61253881 CTTGGTGACTAATTTAAAGTGGG + Intergenic
1110410583 13:75200211-75200233 TATGGTCACCAACCTCAATTTGG - Intergenic
1111568760 13:90050341-90050363 CATGTTCAGTAATCTCCAGTAGG + Intergenic
1112346720 13:98596289-98596311 CAGGGTCACCAGTCTCAAATGGG + Intergenic
1114695665 14:24624806-24624828 CATGGTATCCAAGCTCAAGTGGG + Intergenic
1121157187 14:91697104-91697126 CATGATCATGAATCTTAAGTGGG - Intronic
1121373075 14:93378378-93378400 TATAGTCTCTAATCCCAAGTAGG - Intronic
1129035598 15:72646800-72646822 CCTGGACACCGATCTCAAGTAGG - Intergenic
1129214286 15:74090416-74090438 CCTGGACACCGATCTCAAGTAGG + Intergenic
1135953446 16:26936414-26936436 ACAGGTTACTAATCTCAAGTTGG + Intergenic
1140127091 16:72126458-72126480 CATGTCCACTAACCTCAAATCGG - Intronic
1140464959 16:75174129-75174151 CATGACCACTAACCTCAAGTGGG - Intergenic
1144083056 17:11782262-11782284 CATGGTCACAAACCTTAAATGGG + Intronic
1146442515 17:32909740-32909762 CATGATCACAAATCTCAAACAGG - Intergenic
1147412972 17:40267132-40267154 TATGGCCCATAATCTCAAGTGGG - Intronic
1147613419 17:41814203-41814225 CATGGCCACTAATTTCCTGTGGG - Intronic
1147762727 17:42810798-42810820 CATGCTGACGAATCTTAAGTGGG - Exonic
1149439812 17:56664703-56664725 CAAGGTCACTAATCCCATGAGGG + Intergenic
1150863374 17:68824047-68824069 CATAATCACTAATCCCAAGCTGG + Intergenic
1156313493 18:35946665-35946687 CACAGTCACTAATCACAAGATGG - Intergenic
1157033849 18:43946873-43946895 CATGATCACTAAACTCAAATGGG - Intergenic
1158785156 18:60702708-60702730 AATGGGCACTAATCTCAACATGG + Intergenic
1162768563 19:12935236-12935258 AATGGTCAGTAATCACATGTGGG + Intergenic
1202644800 1_KI270706v1_random:130256-130278 TATTGTCTCTAATATCAAGTTGG + Intergenic
929185658 2:39091278-39091300 CATGCTCACTACCCTCAAGGAGG - Intronic
929369689 2:41207598-41207620 CATGATCACTCTCCTCAAGTAGG - Intergenic
929542492 2:42833161-42833183 CATGGTCACAAAACTGACGTGGG + Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930506591 2:52289271-52289293 AATGTTCACTAATATCAAGCAGG - Intergenic
930880022 2:56259917-56259939 CATCTTCACCAAACTCAAGTGGG + Intronic
933076808 2:77938859-77938881 CATGTTCATTAATCGTAAGTGGG - Intergenic
935396052 2:102610417-102610439 CATGGTTATTAACCTCAAGTGGG + Intergenic
939112764 2:138028178-138028200 CATGACCACTAATCTCAAGTGGG + Intergenic
940308753 2:152254722-152254744 CATGATCACTAGCCTCGAGTGGG + Intergenic
943493927 2:188594541-188594563 CAAGGTCACTAATTTCTAGCAGG + Exonic
943987853 2:194645632-194645654 AATGGTCTCTAATCTCATCTAGG + Intergenic
944077965 2:195753356-195753378 GATGGTCACAAATCTCAAGATGG - Intronic
945498759 2:210542281-210542303 CATGGTCACGGATCTCAAATGGG + Intronic
945648667 2:212534251-212534273 CATAGCCATTAATCTCAAGGTGG + Intronic
946368330 2:219264875-219264897 CATGGCCACTAGCCTCAAATGGG - Intronic
1169062146 20:2668596-2668618 CATGGTCACCAACCTCAACAGGG - Intergenic
1170175046 20:13459567-13459589 CATGGTCACTATCTTCAATTTGG + Intronic
1171894752 20:30749175-30749197 TATTGTCTCTAATATCAAGTTGG + Intergenic
1175000212 20:55619745-55619767 CATGTTCCCTAATCTCAAGAAGG - Intergenic
1176431399 21:6578538-6578560 CATGATCACGAAGCTCACGTCGG - Intergenic
1176607078 21:8842399-8842421 TATTGTCTCTAATATCAAGTTGG - Intergenic
1179706793 21:43186000-43186022 CATGATCACGAAGCTCACGTCGG - Intergenic
1180357157 22:11852187-11852209 TATTGTCTCTAATATCAAGTTGG - Intergenic
1180381106 22:12140144-12140166 TATTGTCTCTAATATCAAGTGGG + Intergenic
1182029530 22:27146982-27147004 CATGGTCTCTAATTCCAAGAGGG - Intergenic
1182910105 22:33976266-33976288 CATGACCACAAATCTCAAGAAGG - Intergenic
1183797151 22:40128881-40128903 CATGGTTCCTACTCTCAAGGCGG + Intronic
949667657 3:6359029-6359051 TATGGTCACTAATCTCCATGTGG - Intergenic
949725212 3:7036233-7036255 CATGGCCAATAATTTGAAGTAGG + Intronic
949726811 3:7058137-7058159 TATGGTCAATCATCTCAAATAGG - Intronic
957839918 3:85654652-85654674 CATGGGCACTAATATTAAGTGGG - Intronic
959000809 3:100962067-100962089 CATGGTCACTAATCTCAAGTGGG + Intronic
960609774 3:119544921-119544943 CATGGTCAGGAATCCAAAGTCGG + Intronic
962336323 3:134534736-134534758 CATGGTCACTAACCTCAAATGGG + Intronic
962818617 3:139024752-139024774 CATGATCACCAACCTCCAGTGGG + Intronic
963115887 3:141728658-141728680 CCTGGTTAATAATCTCAAGAAGG + Intergenic
965797919 3:172460455-172460477 CATGATCATTAACTTCAAGTGGG - Intergenic
965797998 3:172461446-172461468 TATAATCACTGATCTCAAGTAGG + Intergenic
966629898 3:182060609-182060631 CATGGGCATTGATGTCAAGTGGG + Intergenic
967741472 3:193007706-193007728 CATGATTACTAATCTCAACAGGG + Intergenic
967995607 3:195164223-195164245 CATGGTCACTAGTGGCAAGATGG + Intronic
970179812 4:13379298-13379320 CACAATCACTAATCTCAAGTGGG - Intronic
970589030 4:17542960-17542982 AGTGGTCCCTAATCTCAAATGGG - Intergenic
973244060 4:47990932-47990954 AATAGTCACTAATCTCATCTAGG + Intronic
973371042 4:49248815-49248837 TATTGTCTCTAATATCAAGTTGG + Intergenic
973389986 4:49546640-49546662 TATTGTCTCTAATATCAAGTTGG - Intergenic
973633840 4:52843874-52843896 CCTGACCACCAATCTCAAGTCGG + Intergenic
976215695 4:82713733-82713755 CATGACCACTAACCTCAATTGGG + Intronic
978071515 4:104478086-104478108 CTTGGTCACAAATGTCAATTTGG - Intronic
978076566 4:104538542-104538564 AATGATCACTAAGTTCAAGTGGG - Intergenic
978084495 4:104633776-104633798 TGTGGTCAGGAATCTCAAGTTGG + Intergenic
978651179 4:111007086-111007108 CATGACCACTAATCTCAGGTGGG + Intergenic
978795201 4:112701872-112701894 GCTGGACACTAATTTCAAGTGGG - Intergenic
978902887 4:113973561-113973583 TATGACCACAAATCTCAAGTGGG + Intronic
979324467 4:119362539-119362561 CAAGGTCACTAATGACCAGTGGG - Intergenic
981623545 4:146731384-146731406 TGTGATCACTAACCTCAAGTGGG - Intronic
983162515 4:164433738-164433760 CATGATTACTACTCTCAAATTGG + Intergenic
983674573 4:170277867-170277889 CATGATCACTAATCTCAAGTGGG + Intergenic
985197625 4:187449158-187449180 CATGACCATTAACCTCAAGTTGG + Intergenic
986525456 5:8669430-8669452 CATGGTCACTAATTTTCTGTGGG + Intergenic
986525899 5:8674580-8674602 CATGATCACTAATGTCACGTGGG - Intergenic
988623445 5:32846780-32846802 CACAGTCTCTATTCTCAAGTTGG - Intergenic
991772336 5:70051704-70051726 CATGACCACGAATCTCAAGTAGG - Intronic
991851629 5:70927122-70927144 CATGACCACGAATCTCAAGTAGG - Intronic
991971862 5:72149037-72149059 CATGGTCTCTACTCTCATGGAGG - Intronic
992040258 5:72823811-72823833 CATGGCCACAAACCTTAAGTGGG + Intronic
992066240 5:73112640-73112662 AATGTTCACTAAACTGAAGTGGG - Intergenic
995441435 5:112196775-112196797 CATGTTCATTAACTTCAAGTGGG + Intronic
995962361 5:117857947-117857969 CATGGTTATTAATCTTAAGTGGG + Intergenic
997146857 5:131443757-131443779 CATAGTCCTTACTCTCAAGTAGG - Intronic
999955794 5:156700200-156700222 CATGATTCCTAACCTCAAGTGGG + Intronic
1001148431 5:169204870-169204892 CATGACCACTAACCTCAAATGGG - Intronic
1001483276 5:172102961-172102983 CCTGGTTACTAACCACAAGTTGG + Intronic
1004473167 6:15947088-15947110 CCTGGTCACTAAGCCCAAGCAGG - Intergenic
1005027337 6:21476041-21476063 CATGGTCACTAACTTCAGCTAGG + Intergenic
1006113474 6:31762890-31762912 GATGGTCTCTCTTCTCAAGTAGG + Exonic
1006374801 6:33665913-33665935 CATGGTCACTAAGCCCAACCGGG + Exonic
1010395872 6:75391340-75391362 CATGGTCACTAACTTTAACTGGG + Intronic
1011012080 6:82713909-82713931 TGTGATCACAAATCTCAAGTGGG + Intergenic
1011750919 6:90453948-90453970 CATGGCCACAAATCTCAGATTGG - Intergenic
1012647456 6:101704091-101704113 TATGGCCCCTAATCTCAAGTGGG - Intronic
1014057720 6:117036009-117036031 CATGCTCACTTATCTCAAGTGGG + Intergenic
1014693884 6:124595124-124595146 CATGATTTCTAATCTCAGGTAGG - Intronic
1015461841 6:133500455-133500477 TGTGGCCACAAATCTCAAGTGGG + Intronic
1017600344 6:156073628-156073650 CATGATCACTAATCTCAAAAAGG + Intergenic
1022149120 7:27581156-27581178 AATGATCACTAATCCCAAGTTGG - Intronic
1022162673 7:27727276-27727298 CAAGGTCCCTAACCTCAAGGAGG - Intergenic
1022816986 7:33923352-33923374 TTTGGTCACTAAGCTCTAGTGGG + Intronic
1027740008 7:81989617-81989639 CATGACCTCTAACCTCAAGTGGG - Intronic
1029218608 7:98970231-98970253 CATGGTCACACATGTCAAGCAGG + Exonic
1032886294 7:136142785-136142807 CATGGCCATAAACCTCAAGTGGG + Intergenic
1033090305 7:138379380-138379402 TATGGTCTCTAACCTCAAGTGGG + Intergenic
1035081857 7:156222724-156222746 CATGTTCACTAATCACAGCTTGG - Intergenic
1036066005 8:5382234-5382256 CAGGGTCTGTAATCTCAAGAAGG - Intergenic
1038607726 8:29025815-29025837 CATGACCGCTAACCTCAAGTGGG + Intronic
1039263454 8:35798523-35798545 CAAGGTCACAAATCCAAAGTGGG - Intergenic
1042612457 8:70614049-70614071 TATGGCCCCAAATCTCAAGTGGG - Intronic
1043261378 8:78203110-78203132 AATGGTCTCTAATCTCAACCAGG - Intergenic
1044278254 8:90327019-90327041 AATGATCCCTAATCTCAAGTGGG - Intergenic
1044958404 8:97505383-97505405 CATGGCCATTAACTTCAAGTGGG - Intergenic
1048904806 8:139077239-139077261 CATGATTTATAATCTCAAGTAGG + Intergenic
1056982332 9:91326965-91326987 TATGACCACTCATCTCAAGTGGG + Intronic
1057980687 9:99659434-99659456 GGTGGTAACTTATCTCAAGTTGG - Intergenic
1058499336 9:105594437-105594459 CATGACTACTAATCCCAAGTGGG - Intronic
1203695447 Un_GL000214v1:93614-93636 TATTGTCTCTAATATCAAGTTGG + Intergenic
1203742221 Un_GL000218v1:12701-12723 TATTGTCTCTAATATCAAGTTGG - Intergenic
1203702411 Un_KI270742v1:7290-7312 TATTGTCTCTAATATCAAGTTGG - Intergenic
1203554391 Un_KI270743v1:193346-193368 TATTGTCTCTAATATCAAGTTGG - Intergenic
1203640826 Un_KI270751v1:10449-10471 TATTGTCTCTAATATCAAGTTGG - Intergenic
1185860314 X:3572338-3572360 CATGGTGACTCATCTCAAAAAGG + Intergenic
1186470597 X:9819052-9819074 CACTGTCACTATTCTCAGGTGGG + Intronic
1187156850 X:16728224-16728246 CATGTTCATTAATATCAAGCAGG - Intronic
1189911116 X:45811310-45811332 CATGGCCACCAAACTCAAATGGG + Intergenic
1191730652 X:64331618-64331640 CATGGTCATGAATCTCCAGCAGG + Exonic
1194784459 X:98064674-98064696 CATGACCACTAACCTCAAGTGGG - Intergenic
1199055333 X:143287337-143287359 CATTGTCACAAATTTCAAGATGG + Intergenic
1200242384 X:154504132-154504154 CATGATAAATAATCTCAAGATGG - Intergenic
1201155755 Y:11130177-11130199 TATTGTCTCTAATATCAAGTTGG - Intergenic
1201508747 Y:14734243-14734265 CATTGTCTCTAATGTCCAGTTGG + Intronic
1202086635 Y:21144396-21144418 AATGTTCACTAATATCAAGCAGG + Intergenic