ID: 959002688

View in Genome Browser
Species Human (GRCh38)
Location 3:100982748-100982770
Sequence TAGGGGAGTTTGGAGAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959002688 Original CRISPR TAGGGGAGTTTGGAGAGGAT GGG Intronic
902689059 1:18098314-18098336 TAGGGGAGATGGGAGAGGGAGGG + Intergenic
906287127 1:44594750-44594772 TTGGGGAATTTGGATTGGATTGG + Intronic
906998498 1:50824936-50824958 TAGGGGAGGTTGGGAAGGGTAGG + Intronic
907170617 1:52459919-52459941 TAGGGGAGGGGGGAGAGGAGAGG + Intronic
907914175 1:58853425-58853447 TTGGGGAGGTAGGAGAGAATGGG + Intergenic
907958897 1:59259965-59259987 TAGTGGAAGTTGGAGGGGATTGG - Intergenic
908167349 1:61471526-61471548 GAGAGGATTTTGGAGAAGATTGG - Intergenic
909474897 1:76071804-76071826 TATGTGAGTATGCAGAGGATAGG - Intergenic
911164475 1:94712668-94712690 TGGGGAAATTTGGAGAGGAGAGG + Intergenic
911693727 1:100863811-100863833 GAGGGGAGGCTGGAGAGGTTGGG + Intergenic
912216105 1:107614426-107614448 GAGGGGAATTTGAAGAGGAGGGG - Intronic
912654316 1:111472099-111472121 GAGGGGCATTTGGAGAGGGTGGG - Intergenic
915745558 1:158154325-158154347 TAGGAGAGTCTAGAGAGGAAAGG + Intergenic
916075917 1:161199958-161199980 TAGGGCAGTTGGGAGTGGGTAGG - Intronic
916165814 1:161966415-161966437 TAGGAGAGTTAGGAGAGCCTAGG - Intergenic
916173756 1:162021430-162021452 TAGGGCCTTTTGGAGAGGATTGG - Intronic
916620200 1:166488791-166488813 TGGGGAAGTTGGAAGAGGATGGG - Intergenic
916898988 1:169200561-169200583 TAGAGGAGGTTGGAGTGGATGGG - Intronic
917679347 1:177350175-177350197 GAGTGGGGTTTGGAGAGGAGGGG + Intergenic
919026292 1:192175610-192175632 TAGGAGAGTTTTGATAGGTTTGG - Intronic
919460732 1:197873512-197873534 TAAGGGTGTTTGGAGGGTATTGG + Intergenic
919468309 1:197948742-197948764 AAGGGGAGTTGGGAAGGGATGGG - Intergenic
919986117 1:202676365-202676387 TAGAGGAGTTCAGAGAGGGTGGG - Intronic
920547334 1:206829374-206829396 GAGGGGAGTGGGGAGAGGAAAGG + Intronic
923260514 1:232263758-232263780 TAGGGGTGTTTGGTGAAGATAGG + Intergenic
924471884 1:244349960-244349982 TGGCTGAGTTTGGAAAGGATTGG - Intergenic
1062954431 10:1530680-1530702 GAGAGGAGTTTGGAGAGTATGGG - Intronic
1064216688 10:13406400-13406422 TAGGTGAGGATGGAGAGGGTGGG - Intergenic
1065257030 10:23880451-23880473 AAGGGTAGTTGGGAGAGGAAGGG + Intronic
1065675175 10:28166333-28166355 TGGAGGAGTTTGGAGGGGAAAGG - Intronic
1066282551 10:33931827-33931849 CTGGGGAATTTGGAGAGGGTGGG + Intergenic
1069091887 10:64209438-64209460 TAGAGCAGTTTGGAAAAGATAGG + Intergenic
1070394002 10:75996007-75996029 TTGGTGAGTTTGGAGAGGTTAGG - Intronic
1071420193 10:85488035-85488057 TGGAGAAGTTTGGAAAGGATTGG - Intergenic
1071473060 10:86000361-86000383 TAGACCAATTTGGAGAGGATTGG - Intronic
1071978915 10:90983795-90983817 AAGGGGAGGTTGATGAGGATGGG + Intergenic
1072635709 10:97176524-97176546 TAAGGAAGTTTGCAGAGGAGAGG - Intronic
1073888714 10:108071747-108071769 AAGGCGAGTTTGGAGGTGATAGG - Intergenic
1073936669 10:108640660-108640682 CAGGGGAGTTTGGTGGGGGTAGG + Intergenic
1074082180 10:110176649-110176671 TCAGGGAGTTAGGAGAGGAAAGG + Intergenic
1075197958 10:120377651-120377673 TGTGGGAGTTTGGGGAGGCTAGG + Intergenic
1075390297 10:122086611-122086633 GAGGGCAGCATGGAGAGGATGGG + Exonic
1075394112 10:122114125-122114147 GAGGGGCGGCTGGAGAGGATGGG + Intronic
1076010563 10:126984942-126984964 TAGGGGAGTGGGGAGATGATGGG - Intronic
1077454293 11:2669050-2669072 CAGGGTAGTTGGGAGAGGACGGG - Intronic
1077634758 11:3834809-3834831 TAGGCGAGTATGGAGGTGATGGG + Intronic
1077660563 11:4064885-4064907 TAGGTGTGTTTGGAGATGTTAGG + Intronic
1079714174 11:23723871-23723893 TAGAGGCTTTGGGAGAGGATTGG + Intergenic
1080511077 11:32972126-32972148 TAGATGAGTTTGGAGAAGAGTGG + Intronic
1082869704 11:57932845-57932867 TAGAGCTATTTGGAGAGGATGGG - Intergenic
1082941405 11:58709159-58709181 AATAGGAGCTTGGAGAGGATAGG + Exonic
1083195206 11:61081936-61081958 TAGCGGGGTCTGGAGAGGAATGG + Intergenic
1083952270 11:65963368-65963390 TTGGGGAGCCTGGAGAGGTTGGG + Intronic
1084026152 11:66451006-66451028 GAGAGGAAGTTGGAGAGGATGGG + Intronic
1084116483 11:67045651-67045673 TTGGGGAGTTTGGAGTCGGTGGG + Intronic
1085051282 11:73381522-73381544 TGGGGGAGTCTGGAGAGGAGAGG + Intronic
1085126862 11:74007857-74007879 TAGGAGAGTCTGGAGTGAATTGG - Intronic
1085807004 11:79645480-79645502 ATGGGGAGTTGGGAGAGGCTGGG - Intergenic
1088961560 11:114671329-114671351 TAGAGGAATTAGGAGAGGATAGG + Intergenic
1089213553 11:116822022-116822044 TGGTGCAGATTGGAGAGGATGGG + Intronic
1089459067 11:118642196-118642218 GAGGGGAGGATGGAGAGGAAAGG - Intronic
1090060280 11:123458707-123458729 TTGGGGAGTATGAAGAGGAGGGG - Intergenic
1090731355 11:129575599-129575621 TTGGGGTGCTTGGGGAGGATGGG - Intergenic
1091124379 11:133082456-133082478 GAGGGGAGGATGGGGAGGATGGG - Intronic
1091403445 12:194859-194881 TGTGGGAGTTTGCGGAGGATCGG + Intronic
1091538364 12:1435323-1435345 GAGGGGAGTTAGGAGAAGAAAGG + Intronic
1091546118 12:1502346-1502368 TAGGGGAGCGAGGAGAGGAGAGG - Intergenic
1091585549 12:1814241-1814263 ATGGGGAGTCTGGAGAGGGTGGG + Intronic
1093692266 12:22121835-22121857 GAGGGGAGTTTGGCGGGGAGTGG - Intronic
1094383868 12:29872712-29872734 GAGGTGAGGTTGGAGAGGGTGGG + Intergenic
1095527768 12:43148489-43148511 TAGGGAAGTTTGGAGAGATCAGG - Intergenic
1095962555 12:47844614-47844636 TAGGGGAGGTGGCAGAGGAGGGG + Exonic
1096034951 12:48458392-48458414 TCGGGGTGTTTGGACAGAATAGG + Intergenic
1096588265 12:52638909-52638931 TAGGTCAGTTTGGGGAGAATTGG - Intergenic
1100766941 12:97876899-97876921 TAGAAGAATTTGAAGAGGATGGG + Intergenic
1101045655 12:100803173-100803195 TTGGGGTGTTCTGAGAGGATGGG + Intronic
1101570851 12:105952247-105952269 TGGGAGTGTTTGGAGAGGAGAGG - Intergenic
1101895112 12:108750705-108750727 GAGGGGAGTTTGGCCAGGCTGGG - Intergenic
1102851241 12:116246910-116246932 GAGGGGAGTGGGGAGAGGAGGGG + Intronic
1103674600 12:122645568-122645590 TAGTGGAGTTGGGGGAGGAGGGG + Intergenic
1103810786 12:123611834-123611856 TAGGGTAGTGTGGAGAGCATGGG + Intronic
1104683242 12:130766960-130766982 AAGAGGAAATTGGAGAGGATGGG + Intergenic
1105738672 13:23298954-23298976 TCGAGGAGTGTGGTGAGGATGGG + Intronic
1105924312 13:24993240-24993262 TAGTGGATTTAAGAGAGGATGGG - Intergenic
1106041816 13:26100742-26100764 TAGTGGATTTAAGAGAGGATGGG + Intergenic
1106091704 13:26601484-26601506 TGGGGGATGATGGAGAGGATAGG + Intronic
1106577943 13:30993162-30993184 TAAGGGAGGTTGGGGAGGAGTGG + Intergenic
1109037201 13:57280078-57280100 TAGAAGAGTTTGAAAAGGATTGG - Intergenic
1109071604 13:57775901-57775923 TAGGATAGTTTGAGGAGGATTGG + Intergenic
1109578120 13:64288822-64288844 AGGGTGAGTTTGGAGATGATAGG + Intergenic
1110169075 13:72478924-72478946 TAGAAGAGTTTGAGGAGGATTGG - Intergenic
1112363556 13:98738751-98738773 TAGGGCAGTATGGAGGGGAAAGG + Intronic
1113305832 13:109077420-109077442 TAGGGGATTTTTGAGAGCAGTGG - Intronic
1113966069 13:114154864-114154886 TGGGGGAGATTGGGGAGGTTGGG + Intergenic
1114081179 14:19202268-19202290 TCAGGGAGTTTGGAGTGGAAGGG + Intergenic
1114584596 14:23799053-23799075 TAGTTGAGTGTGGAGAGGCTAGG - Intergenic
1115084803 14:29501532-29501554 TAGGGGAGTGTCAAGGGGATGGG - Intergenic
1115914942 14:38301754-38301776 TAGAGGAGCTTGGAGAGCGTTGG - Intergenic
1116046276 14:39746907-39746929 TTGGGGAGAGTGGAGAGGAGGGG + Intergenic
1117989745 14:61421920-61421942 TGGGAGAGTTAGGAGAGGAGAGG + Intronic
1118453316 14:65923753-65923775 TAGGGGAGATTACAGAGGATGGG - Intergenic
1118849095 14:69571236-69571258 TAGGGAAGTTTGGCAAGGGTCGG + Exonic
1118892942 14:69924702-69924724 TAGGGGAGGTAGGAGAGGTAGGG + Intronic
1118893007 14:69924880-69924902 TAGGGGAGGTAGGAGAGGTAGGG + Intronic
1118893073 14:69925071-69925093 TAGGGGAGCTAGGAGAGGTAGGG + Intronic
1118893100 14:69925156-69925178 TAGGGGAGCTAGGAGAGGTAGGG + Intronic
1119268952 14:73284294-73284316 TAGGAGAGGTGGGAGAGGATGGG + Exonic
1119758151 14:77133179-77133201 TAGGGGAGTTGGGAAAGAGTGGG - Exonic
1120474846 14:84974235-84974257 TAGGCAAGTTTGGGGATGATTGG + Intergenic
1120906484 14:89625395-89625417 AAGGGGGGTCTGGAGAGGCTGGG - Intergenic
1120922046 14:89764174-89764196 TAGGGGAGGCAGGAGAGGCTGGG + Intergenic
1121450928 14:94007693-94007715 CAGGAGAGTATGGAAAGGATGGG - Intergenic
1121721900 14:96115139-96115161 TAGGGCAGTCTGGAGGGGCTGGG + Intergenic
1121734354 14:96207452-96207474 TAGGGGAGGGAGGAGAGAATGGG + Intronic
1122081542 14:99270782-99270804 TGGCGGGGTTTGGAGAGGAGGGG - Intronic
1122586443 14:102810238-102810260 GAGGGGATTTGGGTGAGGATGGG + Intronic
1122674137 14:103396461-103396483 TAATGGAGTTTGGAGAGGGAGGG + Intronic
1123632971 15:22274940-22274962 TGGGGGTGTGTGGATAGGATGGG - Intergenic
1126102632 15:45129184-45129206 TACGTGAGTTAGGAGAGGAGTGG - Intronic
1126111483 15:45177651-45177673 TAGGGGAGATCAGAGAGGACAGG - Intronic
1126240243 15:46433534-46433556 TTGGGGAAATTGGAGAGCATAGG + Intergenic
1128420935 15:67491189-67491211 TAGGGGAGGTTGGGGAGGGAGGG - Intronic
1128944685 15:71812376-71812398 AAGAGGAGTATGGAGAGGAGGGG - Exonic
1129117355 15:73371936-73371958 TAGGGGACTTTGGAGACAAATGG + Intergenic
1129672995 15:77617326-77617348 TAGGGGGGTTGGGGGAGGGTAGG + Intronic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1130122150 15:81060267-81060289 TACTGGAGATTGGAGAGCATCGG - Intronic
1131020095 15:89090139-89090161 TAGGGGAGTCCAGAGAGGTTAGG + Intronic
1133011886 16:2917807-2917829 TTGGGGGGTGGGGAGAGGATCGG - Intronic
1135518622 16:23156276-23156298 TAGGGGAGGAGGGAGAGGAGAGG + Intergenic
1135648817 16:24187587-24187609 TAGGGGATTTTGGAGATCAAGGG + Intronic
1136129397 16:28210591-28210613 TAGGGGAGTATTGAAAGTATCGG + Intronic
1136129403 16:28210665-28210687 TAGGGGAGTATTGAAAGTATCGG + Intronic
1136549752 16:30976642-30976664 TGGGGAATGTTGGAGAGGATGGG + Intronic
1137829052 16:51526460-51526482 GGGTGGAGATTGGAGAGGATAGG - Intergenic
1138091832 16:54181160-54181182 GAGGGGAGGTTGGGGAGGATGGG + Intergenic
1138560807 16:57799999-57800021 TGGGGGTGTTTGGCTAGGATGGG + Intronic
1138929301 16:61633011-61633033 GAGAGGAGTTTGGAGAGGTATGG - Intergenic
1139363635 16:66419316-66419338 GAGGGGGGTGTGGAGAGGAGGGG + Intergenic
1139568692 16:67796769-67796791 TAGGGAAGTTGGGAGGGGACTGG - Intronic
1141891662 16:86930345-86930367 TAGGGGAGTTGGGAAGGGACCGG - Intergenic
1142826918 17:2518991-2519013 TAGATGAATTTTGAGAGGATTGG + Intergenic
1143332730 17:6149385-6149407 GAGGGGAGTTTGGAAAGGTGAGG - Intergenic
1146181670 17:30702443-30702465 TGGGGGGTTTTAGAGAGGATAGG + Intergenic
1148088119 17:45006769-45006791 TGGGGGGGTTTGGAGGGGGTTGG - Intergenic
1148206011 17:45780552-45780574 GAGGGGAGTCTGGTGAGGTTGGG + Intergenic
1153416398 18:4850486-4850508 TACAGGAGTGTGGAGAGGAAGGG - Intergenic
1154062826 18:11079487-11079509 TAGGGGAGTTTGGCTAGAATTGG - Intronic
1154499241 18:14986856-14986878 TCAGGGAGTTTGGAGTGGAAGGG - Intergenic
1155716003 18:28944666-28944688 AAGAGGAGTTTGGGGAGGGTGGG - Intergenic
1156254096 18:35378408-35378430 TAGGGGACTAGGGAGAGGTTTGG + Intergenic
1157551471 18:48584712-48584734 TGGGAGAGCTTGGAGAGGACTGG - Intronic
1160171909 18:76562343-76562365 TGGGGGACAATGGAGAGGATGGG - Intergenic
1160241238 18:77124582-77124604 CAGGTGAGTTCGGAGGGGATGGG + Intronic
1161270636 19:3387644-3387666 TGAGGGAGTCTGGAGAGGCTGGG + Intronic
1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG + Intergenic
1162361673 19:10224091-10224113 TAGTGGGCTTTGTAGAGGATCGG + Exonic
1163405038 19:17116758-17116780 TTGGTGGGTATGGAGAGGATGGG + Intronic
1163497890 19:17657200-17657222 AGGGGGAGTTTGGAGCGTATGGG - Intronic
1166562915 19:43745227-43745249 AAGGGCAGGTTGGAGAAGATAGG + Intronic
1166930357 19:46298211-46298233 TAGGGGACAGGGGAGAGGATGGG - Intronic
1167774235 19:51544434-51544456 AAGGGGAGTGAGGGGAGGATGGG + Intergenic
1168028488 19:53661311-53661333 TAGGGGTGTTTGGAGGGGGCGGG + Intergenic
1168340497 19:55620685-55620707 TTGGGGAGTTGGGGGAGGAGGGG - Intergenic
927707951 2:25308549-25308571 CGGGGGAGTTAGGAGAGGGTTGG - Intronic
929071401 2:38034643-38034665 TAAGAAAGTTTGGAGAGCATGGG - Intronic
929298110 2:40271236-40271258 GAGGGGAGGTGGGAGAGGAGTGG - Intronic
929409303 2:41678653-41678675 TAGGAAAGTTGGGAGTGGATAGG + Intergenic
929442167 2:41972938-41972960 GAGGGGAGTTGCAAGAGGATAGG - Intergenic
931023049 2:58072807-58072829 TAGGAGAGATTGTAGAGAATTGG + Intronic
931665762 2:64608943-64608965 TGAGTGTGTTTGGAGAGGATTGG + Intergenic
932216505 2:69969639-69969661 TGGGGCAGTGGGGAGAGGATGGG - Intergenic
932357093 2:71075977-71075999 TAGGGGATTATAGAGAGGTTAGG + Intronic
933206509 2:79513267-79513289 GGGGGGAGGATGGAGAGGATGGG - Intronic
933746160 2:85572854-85572876 AAGGTGAGTTTAGAGGGGATTGG + Intronic
934892425 2:98082203-98082225 TGGGGAAGTTTGGAGAACATGGG - Intergenic
935526588 2:104177275-104177297 TAGTAGAGTTTGAAAAGGATTGG + Intergenic
935536265 2:104298075-104298097 GAGGAAAGTTTGGAGAGGTTAGG - Intergenic
936053479 2:109242784-109242806 GTGGCAAGTTTGGAGAGGATGGG + Intronic
938498452 2:131817224-131817246 TCAGGGAGTTTGGAGTGGAAGGG - Intergenic
939606591 2:144262606-144262628 GAGGGGAGATAGGAGAGGAAGGG + Intronic
940669764 2:156652435-156652457 TAGGGGATTAGGGAGAGGAGAGG - Intergenic
940690745 2:156917022-156917044 TAGAGCAGTTTGGGGAGAATTGG + Intergenic
941681211 2:168401488-168401510 TAGAGGAGTTTGGAGAACCTTGG + Intergenic
941874384 2:170418251-170418273 AAGGGGAGTATGGAGAGCATGGG - Intronic
942134343 2:172910248-172910270 TAGAGGTTATTGGAGAGGATTGG - Intronic
944285515 2:197945372-197945394 TAGGGGAGGTAGGTGAGGGTGGG + Intronic
944904162 2:204245731-204245753 CTGGGGATTTAGGAGAGGATAGG - Intergenic
944971449 2:204997320-204997342 TAGATTAGTTTGGAGAGAATTGG + Intronic
1169369809 20:5020104-5020126 AAGGGGAGTGTGGAGGGGAGGGG - Intergenic
1170022489 20:11851743-11851765 TTGGGGAATTTGTGGAGGATAGG - Intergenic
1171365096 20:24617856-24617878 TATGGGAGTGGGGAGAGGCTGGG + Intronic
1172070440 20:32252690-32252712 TAGCAGAGGTGGGAGAGGATGGG + Intergenic
1172179156 20:32990137-32990159 TAGGGGTGCTGGGAGGGGATAGG - Intronic
1173117249 20:40256860-40256882 TAGGGGATGTTGGAGAGGAGAGG + Intergenic
1173449312 20:43148385-43148407 TAGGGGAGTCTGAAGAAGAGGGG - Intronic
1176007353 20:62873503-62873525 TAGGGAAGTTGGGAAAGAATGGG + Intergenic
1179138405 21:38700586-38700608 CAGGGGAGTTTGGAGTGGAGTGG - Intergenic
1179209975 21:39316013-39316035 GGGGTGACTTTGGAGAGGATGGG + Intronic
1180499594 22:15920418-15920440 TCAGGGAGTTTGGAGTGGAAGGG - Intergenic
1180643155 22:17315771-17315793 TGGGGGAATGTGGAGAGGAATGG + Intergenic
1180993145 22:19950715-19950737 TAGGGAAGTATGGAGGTGATAGG + Intronic
1182248814 22:28983227-28983249 TAGAGGAGTTTGGAGGAGAGTGG + Intronic
1182254536 22:29028928-29028950 TAGGGGAGTTTAGGGATGCTGGG - Intronic
1184093359 22:42303851-42303873 GAGGGGAATGTGGAGAGGAGGGG + Intronic
1184621748 22:45684349-45684371 TTGGGGAGTGGGGAGAGGACTGG + Intronic
1203301259 22_KI270736v1_random:78719-78741 TAGAGTAGTTTGGAGTGGAGTGG + Intergenic
949593856 3:5523326-5523348 TGGAGGAGTTTCAAGAGGATGGG + Intergenic
949821330 3:8118915-8118937 TAGAGGAGTTTTGAGAGAAAAGG - Intergenic
950447465 3:13046632-13046654 GAGGGGAGTTGGGGGAGGTTTGG - Intronic
950629077 3:14269506-14269528 TAGGGGAGCTGGGAGAAGCTGGG - Intergenic
950796859 3:15517168-15517190 GAGGAGAGTTTCCAGAGGATAGG + Intronic
952384636 3:32831157-32831179 TGGGGGATTTTGGAGATGAAAGG + Intronic
952492430 3:33885415-33885437 TAGGGTAGTGGGGTGAGGATGGG + Intergenic
952579676 3:34818151-34818173 TAGAGGAGTTTGAGAAGGATTGG - Intergenic
952640144 3:35583832-35583854 TAGGGGAGTTGGGGGAGGTGGGG + Intergenic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
953137022 3:40190115-40190137 TGGGGGAGAGTGCAGAGGATGGG - Exonic
954847815 3:53575091-53575113 CTGGGGTGTTTGGAGAGGACTGG + Intronic
954911546 3:54114781-54114803 AAAGGGTGTTTGGAGAGGTTAGG + Intergenic
955329472 3:58035035-58035057 TTGGGGACATTGCAGAGGATTGG + Intronic
955372396 3:58364285-58364307 TAGAAGAGTTTGTAGAGAATTGG + Intronic
956465195 3:69513490-69513512 TGGAAGAGTTTGGGGAGGATTGG - Intronic
956466150 3:69522541-69522563 AAGTGGAGTTTGGTGAGTATTGG + Intronic
957529717 3:81425610-81425632 TAGGGGAGTTTGGATAGACTTGG + Intergenic
959002688 3:100982748-100982770 TAGGGGAGTTTGGAGAGGATGGG + Intronic
959709217 3:109368125-109368147 TAGAAGAGTTTGAAGAGGATTGG + Intergenic
959823195 3:110761483-110761505 TGGAGGAGTTTGAAAAGGATTGG + Intergenic
960868340 3:122225580-122225602 TTGGGGAGTTTGCAGAGAAAAGG + Intronic
961518059 3:127450779-127450801 TGTGGGAGTTGGGGGAGGATGGG + Intergenic
961812842 3:129531662-129531684 TAGGCCAGATTGGAGAAGATGGG - Intronic
962092857 3:132263347-132263369 TAGGGGAATTAGCAGAGGAATGG - Intronic
962940213 3:140118654-140118676 TTGGGGAGTTTGCATTGGATAGG + Intronic
963019984 3:140863641-140863663 TGGGAGAGTGTGGAGAGGAGAGG + Intergenic
963341262 3:144036572-144036594 AAGGGGAGGTGGGAGAGGACAGG - Intronic
965768464 3:172155698-172155720 TAGGAGTGAATGGAGAGGATGGG + Intronic
966372629 3:179265242-179265264 TACAGGAGTTTGGATAAGATGGG - Intronic
967346018 3:188456564-188456586 TAGGGGAGTCAGGTGAGGATTGG + Intronic
967427117 3:189339977-189339999 AAGGGAAGCTTGGAGAGGATCGG - Intergenic
972080941 4:35148085-35148107 TAGGAGAATATGGAGGGGATAGG + Intergenic
972428678 4:38959628-38959650 CAAGGCAGTTTGGTGAGGATAGG + Intergenic
973102539 4:46291133-46291155 TGGAGGAGTTTGGAGATGATTGG + Intronic
974173365 4:58294373-58294395 TTGGGGAGTTTTAAGAGGTTTGG + Intergenic
975841800 4:78482035-78482057 CAGGGGAGTTTAGAGAGCTTGGG - Intronic
976634062 4:87269816-87269838 TAGAGGAGTTATGAGAGGAATGG + Intergenic
978322380 4:107512180-107512202 GAGGGGAGAATGGAGAGTATTGG - Intergenic
978863886 4:113484129-113484151 AAGGGAAGTTTGGATAGAATGGG - Intronic
979126224 4:116975646-116975668 TAGGGGATTATGGAGATTATGGG + Intergenic
982063333 4:151626342-151626364 TATAGGAGTGTGGAGAAGATGGG + Intronic
982122933 4:152159756-152159778 TAAGGGGGTTGGGAGAGGAGGGG - Intergenic
982290465 4:153776503-153776525 TAGGGGTGTCTGGGGAGGTTTGG + Intergenic
983400936 4:167264744-167264766 TAGGGGAAATTGGTGAGTATTGG - Intergenic
983452410 4:167925554-167925576 TTGGGGAGTTTTAAGAGGTTTGG - Intergenic
983659650 4:170119114-170119136 TTGGGGAGTTTTAAGAGGTTTGG - Intergenic
984927520 4:184819657-184819679 TATGGTGGTTTGGAGAGGAGTGG + Intronic
985116431 4:186596588-186596610 AAGGGGAGTTTGAAGGGGGTGGG + Exonic
985169995 4:187138568-187138590 TCGTGGAGTTTTGTGAGGATCGG + Intergenic
986347697 5:6850129-6850151 TGGGGGTGTTTGGCAAGGATGGG + Intergenic
988241728 5:28620148-28620170 AAGGGGAGGTTGTAGAGGAAAGG + Intergenic
988776862 5:34485014-34485036 TTGGGGAGGTTGGAGAGGTTGGG - Intergenic
989810796 5:45671203-45671225 TAATGGAGTTTGGAGAGAACAGG - Intronic
990159749 5:52924376-52924398 TAGGGGAGTTTGGGGAGCAGAGG + Intronic
990938199 5:61173125-61173147 TAGGGGAAGTTGGAGAAGGTGGG - Intergenic
991952160 5:71956753-71956775 GAGGGGAGTATGCAGAGGCTTGG + Intergenic
992369176 5:76125513-76125535 TAGGAAAGTTTGGAAATGATTGG + Intronic
995181966 5:109237909-109237931 TGGTGGATCTTGGAGAGGATGGG + Intergenic
995296750 5:110532505-110532527 TTGGGGAGTTTTAAGAGGTTTGG - Intronic
997480892 5:134183824-134183846 TAGGGTAGGTTGGAGAGTCTTGG + Intronic
999094697 5:148967439-148967461 TAGGGCAATTTGGAAAGTATTGG + Intronic
999195470 5:149778702-149778724 TAGGGGAGCTTGGGCAGGAAGGG - Intronic
999670828 5:153957985-153958007 TGGGGCAATTTGCAGAGGATAGG + Intergenic
1000014294 5:157264336-157264358 TGGGGGTGTTTGTGGAGGATGGG - Intergenic
1004720032 6:18261020-18261042 TAGGGCAGTGTGGAGTGGAAAGG + Intronic
1005463953 6:26093681-26093703 TAGGTGAGGTTGAAGATGATGGG + Intronic
1006305438 6:33215642-33215664 TAGGGGAGTTGGGGAAGGGTTGG - Intergenic
1006454776 6:34125516-34125538 TGGGGGAGTTCGGGGAGCATTGG - Intronic
1006989436 6:38200852-38200874 TAGAATAGTTTGAAGAGGATTGG - Intronic
1007262448 6:40573274-40573296 GGGGGGAATTTGGAAAGGATAGG + Intronic
1007339236 6:41179783-41179805 CAGAGGAGGATGGAGAGGATGGG - Intergenic
1010455607 6:76050763-76050785 TAGAAGAGTTTGGTGAGGAATGG - Intronic
1011406383 6:87019494-87019516 TAGGGGAGTTTAGAAAGCACAGG - Intergenic
1011667920 6:89653328-89653350 GAGGGGAGTTTAGAGAGTAAGGG - Intronic
1011782197 6:90801951-90801973 TATGGGAGAGTGGAGGGGATGGG + Intergenic
1012836130 6:104270827-104270849 TTGGGGAGAATGGAGAGGCTGGG - Intergenic
1012836141 6:104270886-104270908 TTGGGGAGAATGGAGAGGCTGGG - Intergenic
1014126290 6:117780289-117780311 TAGGGGTCTTTGGTGAGGAAAGG + Intergenic
1014621674 6:123674866-123674888 TAGGGGAGTGTGGAAGGGAAAGG - Intergenic
1015641807 6:135342350-135342372 TAGGGAAGTTTGTGAAGGATTGG - Intronic
1015921252 6:138268553-138268575 TAGGGGAGTTTGAAAATGTTCGG + Intronic
1017074687 6:150606891-150606913 TAGCAGAGTTGGGAGAGGGTGGG - Intronic
1017723672 6:157262044-157262066 TAGGGGAGTTGGGGGAGGTGGGG - Intergenic
1017893191 6:158656199-158656221 GAGGGGAGTTGTGTGAGGATTGG - Intronic
1018019495 6:159746273-159746295 TATAGGAGTTTGGAGGGAATAGG + Intronic
1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG + Intronic
1019320834 7:414547-414569 AAGGGGAGTACGGAGAGGACGGG - Intergenic
1019323577 7:426429-426451 GAGGGGAGGTTGGAGGGGAGGGG - Intergenic
1019323585 7:426446-426468 GAGGGGAGGTTGGAGGGGAGGGG - Intergenic
1019662513 7:2232663-2232685 CAGGGGAGTGGGGAGAGGAGGGG + Intronic
1022976204 7:35558889-35558911 AAGGGGAGGCTGGAGAGGAAAGG - Intergenic
1026119713 7:67526076-67526098 TAGGGCAGTGTGGAAAGGACAGG + Intergenic
1028239983 7:88408078-88408100 TAGGGCAATGTGGAGAGGTTAGG + Intergenic
1032187811 7:129742453-129742475 TACGGGAATAAGGAGAGGATGGG - Intronic
1032270358 7:130399267-130399289 TTGGGGATGTTGGAGAGGAAGGG - Intronic
1032570564 7:132991864-132991886 TAGGGGAAGATGGAGAGGAGGGG - Intronic
1032868395 7:135953100-135953122 AAGGGGAGTTTGGAGGAGTTTGG - Intronic
1033210577 7:139457233-139457255 CAGGGAAACTTGGAGAGGATGGG + Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033469308 7:141630244-141630266 TAGGGGAGATTGGAAAGAACTGG - Intronic
1034942095 7:155237305-155237327 GAGGGGAGTTTCTGGAGGATTGG - Intergenic
1034967529 7:155400384-155400406 TAGGGGAGTCTGGACACCATGGG + Intergenic
1036512813 8:9416453-9416475 TAGGGATGATTGGAGAGAATGGG + Intergenic
1037240581 8:16772690-16772712 TAGGGGATTTGGGAGAGGTGGGG - Intergenic
1037680874 8:21096529-21096551 TATGTGATTTTGGAGAGGGTTGG + Intergenic
1041356475 8:57005922-57005944 TAGAGGAGTATGGAGAGCCTTGG + Intergenic
1043921696 8:85990438-85990460 TAGAGGAGTTTGGAGATCAGAGG - Intronic
1047256201 8:123215253-123215275 TAAAGAAGTTTGGAGAGGAAAGG - Intergenic
1047318271 8:123754495-123754517 AAGGGAAGTTTGGAGATGTTAGG + Intergenic
1047917820 8:129601908-129601930 TAGGAGAGTTTGTAAAGAATTGG + Intergenic
1048117331 8:131539401-131539423 TATGGGAATGTAGAGAGGATGGG - Intergenic
1051526221 9:18047883-18047905 TAGGGAGGATTGCAGAGGATAGG + Intergenic
1051875607 9:21790231-21790253 GAGGGGAGGAGGGAGAGGATGGG + Intergenic
1052550561 9:29942094-29942116 TAGGGGAGTTTAGAGAATAATGG + Intergenic
1053540146 9:38965262-38965284 TAGGGCAGTGTGGAGAAGAGGGG - Intergenic
1053804496 9:41787419-41787441 TAGGGCAGTGTGGAGATGAGGGG - Intergenic
1054140787 9:61528043-61528065 TAGGGCAGTGTGGAGATGAGGGG + Intergenic
1054625994 9:67398662-67398684 TAGGGCAGTGTGGAGATGAGGGG + Intergenic
1055113773 9:72585823-72585845 GAGGTGAGTGTGGAGTGGATGGG + Intronic
1055967991 9:81883922-81883944 TAGGGGAGTCAGGAGAGGAAGGG - Intergenic
1056733803 9:89187042-89187064 TAGGGGAGATATGAGAGGAGAGG + Intergenic
1056879947 9:90381373-90381395 GAAGGGACTTTGGAGAGGTTGGG + Intergenic
1057839793 9:98477093-98477115 TTGGGGAGTTTTGGGAGGGTGGG + Intronic
1058103569 9:100944122-100944144 TAGAAGAGTTTGGGAAGGATTGG + Intergenic
1058702151 9:107610057-107610079 TATGTAAGCTTGGAGAGGATAGG + Intergenic
1058938296 9:109789677-109789699 TGGCGGAGTTTGTAGAGGAAAGG + Intronic
1059742590 9:117166786-117166808 TAGGGGAGTTTGCAGTCTATGGG - Intronic
1059855569 9:118393482-118393504 TAATGGAGGCTGGAGAGGATGGG - Intergenic
1060824024 9:126677286-126677308 CAGGGGAGCTCGGAGAGGAGGGG - Intronic
1062217312 9:135396215-135396237 TCTGGGAGGTGGGAGAGGATCGG + Intergenic
1062561161 9:137142681-137142703 AAGGGGAGTTTGGAGAGCTGGGG + Intronic
1185848773 X:3465473-3465495 AAGGGCTGTTTGGAGAGGACAGG - Intergenic
1186459927 X:9739947-9739969 GAGGGGAGTGGGGAGAGGAGGGG + Intronic
1186862324 X:13685432-13685454 TAGGAGAGCTTAGAGAAGATTGG - Intergenic
1187226572 X:17379024-17379046 TAGGGGAGTTTGAAAGGGAGAGG + Intronic
1190180537 X:48187762-48187784 TTGGGTAGATTGGAGAGGGTTGG + Intronic
1190516941 X:51233668-51233690 AAAGGGAGTTTGAAGAGGGTTGG - Intergenic
1191256294 X:58281050-58281072 TAGAGGAGGTTGAGGAGGATGGG - Intergenic
1191668662 X:63728942-63728964 TAGTGGAGTTTGGAGAGGTTAGG + Intronic
1191675231 X:63785690-63785712 TAGGGGAGTATGCAGAGGGAGGG - Intergenic
1191998631 X:67124100-67124122 TAGGGGAGGCTGGAGATCATGGG + Intergenic
1192615850 X:72621283-72621305 GAGGGGACTTTGGTGAGGAAGGG + Intronic
1193577503 X:83219361-83219383 TTGAAGAGTTTGGATAGGATTGG - Intergenic
1194427661 X:93759946-93759968 TAGGGGAGGATGAAGAGGTTGGG - Intergenic
1196376620 X:115040060-115040082 GAGGGGAGTTTGGCCAGGAGCGG + Intergenic
1197181727 X:123543989-123544011 TAGGGAAGTTTAGTGAGGCTAGG - Intergenic
1201291020 Y:12421024-12421046 CGGGGGCGCTTGGAGAGGATGGG - Intergenic