ID: 959007629

View in Genome Browser
Species Human (GRCh38)
Location 3:101038362-101038384
Sequence CTCAGAGAAATAAAACCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959007629_959007632 0 Left 959007629 3:101038362-101038384 CCTATTGGTTTTATTTCTCTGAG No data
Right 959007632 3:101038385-101038407 GAACCCTGACTAATATCCCAGGG No data
959007629_959007631 -1 Left 959007629 3:101038362-101038384 CCTATTGGTTTTATTTCTCTGAG No data
Right 959007631 3:101038384-101038406 GGAACCCTGACTAATATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959007629 Original CRISPR CTCAGAGAAATAAAACCAAT AGG (reversed) Intergenic
No off target data available for this crispr