ID: 959009153

View in Genome Browser
Species Human (GRCh38)
Location 3:101054455-101054477
Sequence CTGCTGTTATTTTCCAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959009151_959009153 11 Left 959009151 3:101054421-101054443 CCATACTGATGTGTATTGCTTTG No data
Right 959009153 3:101054455-101054477 CTGCTGTTATTTTCCAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959009153 Original CRISPR CTGCTGTTATTTTCCAACAT AGG Intergenic
No off target data available for this crispr