ID: 959012108

View in Genome Browser
Species Human (GRCh38)
Location 3:101089612-101089634
Sequence CCCGTAGGGTATTTAAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959012108_959012115 4 Left 959012108 3:101089612-101089634 CCAAACTTTAAATACCCTACGGG No data
Right 959012115 3:101089639-101089661 ATTAAGGCTGGTCCCCAACAAGG No data
959012108_959012114 -8 Left 959012108 3:101089612-101089634 CCAAACTTTAAATACCCTACGGG No data
Right 959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959012108 Original CRISPR CCCGTAGGGTATTTAAAGTT TGG (reversed) Intergenic
No off target data available for this crispr