ID: 959014894

View in Genome Browser
Species Human (GRCh38)
Location 3:101122665-101122687
Sequence GTAAACACAGTGTCATCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959014891_959014894 2 Left 959014891 3:101122640-101122662 CCCTAATTGCTTCCAAGAAAACT No data
Right 959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG No data
959014893_959014894 -10 Left 959014893 3:101122652-101122674 CCAAGAAAACTAAGTAAACACAG No data
Right 959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG No data
959014892_959014894 1 Left 959014892 3:101122641-101122663 CCTAATTGCTTCCAAGAAAACTA No data
Right 959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959014894 Original CRISPR GTAAACACAGTGTCATCTCA TGG Intergenic
No off target data available for this crispr