ID: 959016641

View in Genome Browser
Species Human (GRCh38)
Location 3:101142228-101142250
Sequence CCATGAGCAAAATGGGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959016633_959016641 26 Left 959016633 3:101142179-101142201 CCATACTAGTAGGAGACATTGAA No data
Right 959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG No data
959016637_959016641 -10 Left 959016637 3:101142215-101142237 CCTGGAGATAGAACCATGAGCAA No data
Right 959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG No data
959016632_959016641 27 Left 959016632 3:101142178-101142200 CCCATACTAGTAGGAGACATTGA No data
Right 959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG No data
959016636_959016641 0 Left 959016636 3:101142205-101142227 CCTGTGCTAACCTGGAGATAGAA No data
Right 959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG No data
959016635_959016641 1 Left 959016635 3:101142204-101142226 CCCTGTGCTAACCTGGAGATAGA No data
Right 959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959016641 Original CRISPR CCATGAGCAAAATGGGCAAG AGG Intergenic
No off target data available for this crispr