ID: 959026302

View in Genome Browser
Species Human (GRCh38)
Location 3:101243674-101243696
Sequence AGTGTGGCTTGGCCCACAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959026302_959026304 -9 Left 959026302 3:101243674-101243696 CCTTCTGTGGGCCAAGCCACACT 0: 1
1: 0
2: 2
3: 20
4: 255
Right 959026304 3:101243688-101243710 AGCCACACTAACCATCTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959026302 Original CRISPR AGTGTGGCTTGGCCCACAGA AGG (reversed) Exonic