ID: 959026489

View in Genome Browser
Species Human (GRCh38)
Location 3:101245844-101245866
Sequence GCTTCAGACTGGCTTGCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959026489_959026495 30 Left 959026489 3:101245844-101245866 CCACAGGCAAGCCAGTCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 157
Right 959026495 3:101245897-101245919 CTGCTAACCTCTAAAACCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959026489 Original CRISPR GCTTCAGACTGGCTTGCCTG TGG (reversed) Exonic