ID: 959027659

View in Genome Browser
Species Human (GRCh38)
Location 3:101259197-101259219
Sequence TGGGTTCTTACTGCCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959027659_959027664 10 Left 959027659 3:101259197-101259219 CCATCATAGGCAGTAAGAACCCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 959027664 3:101259230-101259252 CCAAGATCCCTCCAGAGGAAAGG 0: 1
1: 0
2: 1
3: 37
4: 290
959027659_959027662 5 Left 959027659 3:101259197-101259219 CCATCATAGGCAGTAAGAACCCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 959027662 3:101259225-101259247 TCACACCAAGATCCCTCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959027659 Original CRISPR TGGGTTCTTACTGCCTATGA TGG (reversed) Intronic
900617405 1:3571583-3571605 TGGGTCCTTCCTGCATATGCTGG + Intronic
904737151 1:32643417-32643439 TGGGTTCTCACTGTCTACCAAGG + Intronic
910510889 1:88002618-88002640 TGGGTTCTGACTGCCTCACAGGG + Intergenic
910746607 1:90581582-90581604 AGGGTTGTTCCTGCCTATGATGG - Intergenic
911966582 1:104380051-104380073 TTGGTTCTAACTGTTTATGATGG - Intergenic
912644806 1:111382681-111382703 TGTGTCCTTAATGCCTATGCTGG + Intergenic
912757331 1:112335318-112335340 TGGGTTCCTGATGTCTATGAGGG - Intergenic
913365624 1:118034861-118034883 TTGCTTCTTACTGCCTTTCAGGG - Intronic
919604641 1:199667005-199667027 TGGTTTCTTTATCCCTATGATGG + Intergenic
922204577 1:223435322-223435344 TTGGTGCTTTCTGCCTATGTTGG + Intergenic
923366691 1:233268692-233268714 TGTGTTCTGACTGCCCAGGAAGG - Intronic
1062876531 10:947420-947442 TGTGTTCTGACTGCCTGGGACGG - Intergenic
1071799257 10:89041274-89041296 TGAGTTCTTAATGCCCATTAAGG + Intergenic
1074139671 10:110660956-110660978 TATGTTCTTACTGTCTATTATGG + Intronic
1077387359 11:2276533-2276555 TGGGGACTTGCTGACTATGAAGG + Intergenic
1078438041 11:11341523-11341545 TGGGTTCTGACTGAATCTGAGGG + Intronic
1081940345 11:46936278-46936300 TGTGTCTTTTCTGCCTATGACGG - Intergenic
1081966332 11:47172299-47172321 TGGCTTCTTCTTGCCAATGATGG + Exonic
1083324693 11:61867252-61867274 TGGGTTCATTCTGCCTCTGCGGG - Exonic
1085198203 11:74684717-74684739 AGGGGTCTTCCTGCCTCTGATGG - Intergenic
1092765138 12:11846145-11846167 TGGGCCCTTTCTGCCTTTGATGG - Intronic
1095324984 12:40878671-40878693 TGTGTTATTACTTCCTAAGAGGG - Intronic
1095325170 12:40881626-40881648 TGTGTTATTACTTCCTAAGAAGG + Intronic
1095644328 12:44525233-44525255 TGGAATCTTTCTGCCTATAAGGG - Intronic
1097157973 12:57026583-57026605 TGGGTTGTTTCAGCCTCTGAGGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1099201811 12:79687182-79687204 TGGGTGGTTACTGCATGTGATGG - Intronic
1102505810 12:113384118-113384140 TGGGTTCTTGTTGCCAATGGTGG - Exonic
1103173861 12:118844732-118844754 TAGTTTCTTTCTGCCTGTGAGGG - Intergenic
1103517327 12:121515787-121515809 TGGGCTCTGCCTGCCTCTGATGG + Intronic
1104068190 12:125322932-125322954 TGGTTTGCTACTGTCTATGAAGG - Intronic
1107963718 13:45580721-45580743 TGGGTTCATACTGGGTATGTGGG + Intronic
1110914258 13:81001781-81001803 TCGGTTCTTACTTACCATGAAGG - Intergenic
1118413687 14:65509366-65509388 TTGGTTCTTTCTGCTTAGGATGG + Intronic
1120394518 14:83952484-83952506 TGGGTCCTCATTGCCTTTGATGG + Intergenic
1125341916 15:38683753-38683775 TGGATTCTTAATGCCTAGCAAGG + Intergenic
1125715222 15:41815818-41815840 TGGGTACTGACTGCCTCTCATGG + Intronic
1130160609 15:81395471-81395493 TTGGTTCTTATTCCGTATGATGG + Intergenic
1131273032 15:90958216-90958238 TGGGCTCTAACAGCCTAGGAAGG - Intronic
1131357686 15:91759830-91759852 TGGGGTCTTAATGCCCATGGTGG + Intergenic
1139335109 16:66226091-66226113 TGGGCTCTGACTGACTTTGAAGG - Intergenic
1140923173 16:79558145-79558167 TGGGTTTTTCCTGCCTGTGGGGG + Intergenic
1140990207 16:80203540-80203562 TTGCTTCTTATTGTCTATGAAGG + Intergenic
1143677214 17:8443105-8443127 TGAGTTCTTGCTGCCTAGTATGG + Intronic
1145227954 17:21146760-21146782 TGGTTTCTTACTGAATAAGAAGG + Intronic
1150042534 17:61879328-61879350 TGGGTGCTTACATCCTATAAGGG - Intronic
1155586584 18:27373177-27373199 TGGGGTCTTTCTGCTTGTGATGG + Intergenic
1156812858 18:41273789-41273811 TGGGTTCTTAATCCCTATCTGGG + Intergenic
925389220 2:3484178-3484200 TGGTTTGTCACTTCCTATGAGGG - Intronic
925880705 2:8350068-8350090 TGGGCTATTACTGCCTGGGAGGG - Intergenic
927047026 2:19289663-19289685 TGAGTTCTTAGTGCCCATAAAGG + Intergenic
928594923 2:32850877-32850899 TTGGCTATTACTACCTATGAAGG - Intergenic
929352844 2:40981331-40981353 TGGATTATTACTGACTAAGAGGG - Intergenic
931819241 2:65934980-65935002 TGGGTTCTTCATGTCTATAATGG - Intergenic
940376954 2:152968171-152968193 TGTGTTCTTACTCCCTATTATGG - Intergenic
942530556 2:176905289-176905311 TGGGTTCTTTCTGCCTTTCAGGG + Intergenic
947581020 2:231318590-231318612 TGGGGTGTCACTGCCTACGATGG + Intronic
947846417 2:233247700-233247722 TGGAGTCTGACTGCCTATAATGG - Intronic
948469397 2:238167528-238167550 TGTGTTCTTACTGCTTAGAAGGG + Intronic
1172807580 20:37623361-37623383 TGAGCTCTTAGTCCCTATGAAGG - Intergenic
1174692419 20:52520073-52520095 TGGTTTCTTAGTGCATATAAAGG + Intergenic
1175349156 20:58306391-58306413 AGGGTTCTTTCTGCCAATAATGG + Intergenic
1177316486 21:19468906-19468928 TGAGTTCTTACTGGATCTGATGG - Intergenic
1178944312 21:36933519-36933541 TTCATTCTTACTGCCTAGGATGG - Intronic
949279920 3:2333890-2333912 TGGGTTTTAACTACCTGTGAAGG + Intronic
949662777 3:6300005-6300027 TGGGTGCTTAGTGCCTAAGCCGG - Intergenic
957550784 3:81700911-81700933 TGGGTTCTTATTTGCTATAACGG - Intronic
959027659 3:101259197-101259219 TGGGTTCTTACTGCCTATGATGG - Intronic
960746386 3:120894498-120894520 TGGGTCCTCTCTGGCTATGAAGG - Intergenic
981086071 4:140685298-140685320 TGGGCTCATAATGCCAATGAGGG + Intronic
981541576 4:145851970-145851992 TGTGTTGTGACTGCCCATGAGGG - Intronic
981913862 4:150012848-150012870 TTGTTTCTCAGTGCCTATGAGGG - Intergenic
982091365 4:151882839-151882861 TGGGTTGTTATTGCCTCTCAGGG - Intergenic
985824309 5:2181327-2181349 TGGCTTCTTCCTGCCTGTGCTGG + Intergenic
986015444 5:3753410-3753432 TGGTTTCTTACAGCTGATGAAGG - Intergenic
986178134 5:5369288-5369310 TGGGTTCTTTCTGACTGTGTGGG - Intergenic
988354637 5:30158003-30158025 TGGCTTCATATTGCCTATCAAGG + Intergenic
989256766 5:39374462-39374484 TGAGCTCCTACTGCCTATGAAGG + Intronic
990895244 5:60692737-60692759 TGGGTTGTTTCTGCCTATTATGG - Intronic
992259150 5:74952740-74952762 GTGGTTCTTGCTGCCTATGAAGG - Intergenic
999468327 5:151828418-151828440 TGGGTTCTCTCTCCATATGAGGG - Intronic
1004801190 6:19150313-19150335 CGGATTTGTACTGCCTATGAAGG + Intergenic
1006875258 6:37289953-37289975 TTTGTTCTCACTACCTATGAAGG + Intronic
1010106911 6:72180889-72180911 TGAGTTTTTACTGCCTATTGTGG - Intronic
1011077346 6:83451005-83451027 CGGGATCTTACTGCTTAAGATGG - Intergenic
1014222148 6:118808534-118808556 AGGGATCTTGCTGCCTTTGAGGG - Intergenic
1017630346 6:156390980-156391002 TGGATTCTCCCTGCCTATGAGGG - Intergenic
1019404029 7:873505-873527 TGGGTGCTCACTGCCTCTGCAGG + Exonic
1021913449 7:25408757-25408779 TGAGTTCTGACTGCCTGGGATGG + Intergenic
1022421596 7:30228575-30228597 TGGATCCTTGCTGCCTATGGTGG - Intergenic
1029466478 7:100728476-100728498 TAGGTACTTTCTGCCTATGCAGG - Intergenic
1032644883 7:133812546-133812568 TGTGTCCTTCCTGCCCATGAAGG + Intronic
1036538516 8:9677530-9677552 TGTGTTTTTACTGTCTATCAGGG + Intronic
1038903546 8:31871505-31871527 GGGGTTCTTACTGCCTGAGAGGG + Intronic
1041923793 8:63214888-63214910 TGGGTTCCTATTGGCTGTGATGG + Intergenic
1042034459 8:64516313-64516335 TGGCTTCTTCCTTCCTTTGAAGG + Intergenic
1047130617 8:122016148-122016170 TAGGTTCTGTCTGCCTTTGAAGG + Intergenic
1048615978 8:136076199-136076221 TTGGCTCATCCTGCCTATGAAGG + Intergenic
1056825296 9:89872861-89872883 TGGGTTCTCACTGCATCTGGAGG + Intergenic
1059167344 9:112090934-112090956 TGGGTTCTAAGTGGCTCTGAAGG - Intronic
1186776104 X:12866058-12866080 TTGGTTTTTACTGCCTGTGTGGG + Intergenic
1186828512 X:13365861-13365883 TGGTTACATACTGCCTATGGTGG + Intergenic
1187208311 X:17203965-17203987 TGTATTCTCACTGCCTATCACGG + Intergenic
1193132805 X:77935248-77935270 TGGTGTCTTACTGTGTATGAGGG + Intronic
1195488831 X:105442370-105442392 TGGGTTCTTATTACCTACCAGGG + Intronic
1197397739 X:125948359-125948381 AAAGTTCTTACTGCCTATGTAGG - Intergenic
1197794234 X:130283210-130283232 TCTGTTCTTACTGCTTATGCAGG + Intergenic