ID: 959031241

View in Genome Browser
Species Human (GRCh38)
Location 3:101301150-101301172
Sequence TCTTACATGGATATTGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959031241 Original CRISPR TCTTACATGGATATTGTTCA TGG Intronic
901610415 1:10493710-10493732 TCTTCCATGGATATTGAGGAAGG + Intronic
903159322 1:21473900-21473922 AATTTCATGGACATTGTTCAGGG - Intronic
903641169 1:24861531-24861553 TCTCACATGGCTATTGTTAGGGG + Intergenic
905060812 1:35137520-35137542 TCTTAGGTGGATCTTTTTCACGG + Intergenic
908340786 1:63176714-63176736 TCTTATATGGGTGCTGTTCATGG + Intergenic
908835874 1:68229861-68229883 TTATACATAGATATTTTTCAAGG + Intronic
908953043 1:69585840-69585862 TCTTACAAGGATATATTTCTTGG - Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909189098 1:72529811-72529833 TCTTATATGGCTATGTTTCATGG - Intergenic
909320441 1:74279197-74279219 TCTTACCTGGGTATTGGACAAGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909824829 1:80114963-80114985 TCTTACCAGGGTATAGTTCAAGG - Intergenic
909837719 1:80277433-80277455 TCTTACAGAGATATTGTTTAAGG + Intergenic
909916118 1:81321668-81321690 TCTTACATGGATGTGGCTCATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911833907 1:102591536-102591558 TCTTATTTGGAACTTGTTCAAGG - Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912874023 1:113337476-113337498 TCTTACATGAGTACAGTTCATGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
914189836 1:145400052-145400074 AATTCCATGGACATTGTTCAGGG + Intronic
915845295 1:159257397-159257419 TCTTACCTGGATACAGTTCATGG + Intergenic
916464163 1:165057231-165057253 CCTTACCTGGATTTTGTGCATGG - Intergenic
916635532 1:166664091-166664113 TTTTACATGCATTTTCTTCAAGG - Intergenic
916643169 1:166754025-166754047 TTTTACATCGATATTCATCAAGG - Intergenic
917306868 1:173635720-173635742 GCTAACATGGATATATTTCAGGG + Intronic
917422274 1:174877031-174877053 TATTACATGAAGATTGTTCTTGG - Intronic
918096674 1:181341782-181341804 ACTTACATGGCTATTTTTCCTGG + Intergenic
918529909 1:185507234-185507256 TTTTACATGTATATTCATCAGGG + Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918688344 1:187447505-187447527 TCTGACATGCATCTTGCTCAGGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919426254 1:197435185-197435207 TCTTACTTTGAAAATGTTCATGG + Exonic
920799197 1:209172038-209172060 TCTTACATGGGCACAGTTCATGG - Intergenic
921307968 1:213816093-213816115 TCTTACATGGGTGCAGTTCATGG + Intergenic
921463916 1:215462537-215462559 TATTTCTTGGATATTGGTCAAGG + Intergenic
921546301 1:216478866-216478888 TCTTACATGTATGTTCATCAGGG - Intergenic
921565710 1:216715755-216715777 TCTTAAAAGGATACTTTTCAAGG - Intronic
924022249 1:239796738-239796760 TGTTACATGGATATATTGCATGG + Intronic
924114170 1:240729316-240729338 ACTTACATGGGTATTTTTAAAGG + Intergenic
924238181 1:242016446-242016468 TCTTGCATGGATCTTATTCCAGG + Intergenic
924860760 1:247919340-247919362 TCATAGATGGATATTGTGGATGG + Intergenic
1063984937 10:11492208-11492230 TCTTACTTGGAAATTGTTTAAGG + Intronic
1064589402 10:16873176-16873198 TCTGACAGTAATATTGTTCATGG - Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1064851426 10:19713315-19713337 TCTTATCTGGATATGGTTCCAGG - Intronic
1064912612 10:20419298-20419320 TCTTTCATGGATATTGCTTTTGG - Intergenic
1065410903 10:25426639-25426661 TCTTACATGGGTGAGGTTCATGG + Intronic
1066346126 10:34588520-34588542 TCATACATGGAGGTTGTACATGG - Intronic
1068180285 10:53509538-53509560 TGTTACATGGATATATTGCACGG + Intergenic
1069906018 10:71732657-71732679 TGTTACAGGGATATTGATCTCGG - Intronic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071270797 10:84005466-84005488 TGATACATGAAGATTGTTCAAGG + Intergenic
1071389919 10:85163070-85163092 TCTTACAAGGATGTTGTCTATGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074017611 10:109550011-109550033 TTTTACATGGATGTTCATCAGGG - Intergenic
1074210692 10:111331458-111331480 TCTTATATGGGTGTAGTTCATGG - Intergenic
1074678917 10:115883164-115883186 TCTTGCATGGATGTTGTTCTTGG - Intronic
1075801611 10:125158415-125158437 TCTGACATGGATAATTTTGAGGG - Intronic
1075884308 10:125884475-125884497 TCATACATGTATATTGTAGATGG + Intronic
1079021445 11:16912452-16912474 TCTGACATGGATATTTTAAATGG + Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1079793456 11:24768428-24768450 TGTTAGTTGGATAATGTTCAGGG + Intronic
1080848020 11:36043406-36043428 TCTTACTTGCAAATTGTTAAAGG - Intronic
1081186357 11:40047140-40047162 TCTTATATGGACACAGTTCATGG + Intergenic
1081289981 11:41312832-41312854 TCTGACATGTATATTTCTCAAGG + Intronic
1081500790 11:43664581-43664603 ACTTCCATGGCTATTGTTCTAGG + Intronic
1082126885 11:48443254-48443276 TTTTGCATAGATATTGATCAGGG + Intergenic
1082560460 11:54614232-54614254 TTTTGCATAGATATTGATCAGGG + Intergenic
1084137710 11:67199123-67199145 TCCTATATGGATACAGTTCATGG - Intronic
1084163220 11:67362394-67362416 TCCTACATGGATATTTTATAAGG - Intronic
1084343173 11:68522849-68522871 TCTTTCATGAAGACTGTTCATGG + Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1084668161 11:70588045-70588067 TCTTATATGGGTACAGTTCATGG - Intronic
1085616764 11:78006195-78006217 TCTTATATGGATGTTGTTTGTGG - Intergenic
1085817315 11:79753120-79753142 TCTTACATATATATTGTTGGTGG + Intergenic
1086032643 11:82378748-82378770 TATTAAAGGGACATTGTTCAAGG - Intergenic
1087881607 11:103422410-103422432 TTTTACATGGATGTTCATCAAGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1091186393 11:133651434-133651456 TTTTACATGGATATATTGCATGG + Intergenic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1094280122 12:28727643-28727665 TCTTACATGGGAGCTGTTCATGG + Intergenic
1095664744 12:44784601-44784623 TTTCACATGGATGTTGATCAGGG - Intronic
1096664700 12:53155696-53155718 TCTCAAATGGAGATTATTCAAGG + Intergenic
1096909554 12:54968736-54968758 TTTTACATGGAAGTTATTCATGG + Intronic
1099218345 12:79880995-79881017 TCTTCTATGAATATGGTTCATGG - Intronic
1099277923 12:80601761-80601783 TCTTATATTTATATTTTTCAAGG + Intronic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1100726231 12:97411877-97411899 TCTTACATCCATACAGTTCATGG - Intergenic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106616169 13:31330100-31330122 TTTGACATGGATATTGTGAATGG + Exonic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1108964904 13:56286094-56286116 TCTTTCATGGCTATTGTGAATGG + Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109392369 13:61709421-61709443 AATTACATGGCTATTTTTCAGGG - Intergenic
1109403351 13:61863826-61863848 TTTTTCATGGAAATTGATCAAGG + Intergenic
1110372222 13:74752575-74752597 ATTTACATGGAAATTGATCAGGG - Intergenic
1110869411 13:80432824-80432846 TCTTTCATGTATATTTTCCAGGG + Intergenic
1111923503 13:94438246-94438268 TTTTCCATGAATATTGTTAATGG + Intronic
1112637314 13:101228862-101228884 TCTTACATGACTTTTGTTTATGG + Intronic
1113251635 13:108459472-108459494 ACTTACATAGAAATTGCTCAAGG - Intergenic
1113487040 13:110661876-110661898 TCTTCCATGGATGTGGTTCATGG + Intronic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113659179 13:112093259-112093281 CCTTGCATGAATATGGTTCACGG + Intergenic
1114774553 14:25466477-25466499 TCTTGCATAAATATTCTTCATGG - Intergenic
1115021849 14:28691311-28691333 TTTTAAATGTATATTGTTTATGG + Intergenic
1115303126 14:31906712-31906734 TCTAACATCCATGTTGTTCAAGG + Intergenic
1115627986 14:35214583-35214605 TCTTACATGGGTGTGGTTCCTGG + Intronic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1115989178 14:39134179-39134201 TCTTACATAGAAATTCTTCTTGG + Intronic
1116246658 14:42423614-42423636 TCTTACATTGAAATTTTTCAGGG - Intergenic
1117505483 14:56398284-56398306 CCTTACATGATTATTGGTCATGG + Intergenic
1117586130 14:57207506-57207528 TCCTACTTGGATATAGTTAATGG - Exonic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118921307 14:70152175-70152197 TCTGACATGAATACTGCTCAGGG - Intronic
1119762182 14:77159383-77159405 TCTGCCAGGAATATTGTTCAGGG - Intronic
1119941998 14:78650793-78650815 TCTTACATGATTGTTATTCATGG - Intronic
1119957772 14:78818918-78818940 TCTCTTATGGATTTTGTTCAGGG + Intronic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122005704 14:98701803-98701825 TGTTACATGGATATATTGCATGG + Intergenic
1122175689 14:99916912-99916934 TCTTTCATGGATCTCTTTCATGG + Intronic
1122442053 14:101738696-101738718 TCTTGCATGGATACAGATCATGG + Intergenic
1123013829 14:105364000-105364022 TCTTACATGGGTGATGTTCGTGG + Intronic
1123138960 14:106056458-106056480 TCTTACCTGGAGTTGGTTCAGGG - Intergenic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1124901580 15:33828167-33828189 TCTTACAAGGGCATAGTTCATGG - Intronic
1125870618 15:43098228-43098250 TCTTTTATGGATGTGGTTCATGG + Intronic
1128690170 15:69718459-69718481 TCTTACATGGGTGCAGTTCATGG + Intergenic
1129293151 15:74584085-74584107 TTTTACATGGATATACTGCAGGG + Intronic
1130330053 15:82915223-82915245 TGTTACATGTATAGAGTTCAGGG - Intronic
1130414610 15:83680821-83680843 TCTTAATAAGATATTGTTCATGG + Intronic
1132420998 15:101668417-101668439 TTTTAAATGGGTATAGTTCATGG + Intronic
1137234136 16:46599473-46599495 TCTTTTATGGATGTGGTTCATGG + Intronic
1137577264 16:49608510-49608532 TCTTTCATATATAATGTTCAGGG - Intronic
1140748382 16:78001042-78001064 TCGTACTTTGATATTGTTCATGG + Intergenic
1149322893 17:55499396-55499418 TCTTACATGGATAAACTGCATGG + Intergenic
1149712840 17:58758160-58758182 TCTTACATGGCAAATGTTCAGGG - Intronic
1150090023 17:62315543-62315565 TCTTACATGGTTGCTGTTCATGG - Intergenic
1151167179 17:72214604-72214626 TCTTGCATGAATATTTTTCATGG + Intergenic
1153001263 18:457434-457456 TGTGACATGGACATTCTTCAAGG - Intronic
1153181534 18:2440738-2440760 TCTTATATGGATGCAGTTCATGG + Intergenic
1153312230 18:3688254-3688276 TCTAAAATGGATATAGTTAATGG + Intronic
1153395397 18:4614538-4614560 TCTTACATGGATTCTGTTTGTGG + Intergenic
1153491258 18:5650527-5650549 TCTTATATGGATGCAGTTCATGG - Intergenic
1153975057 18:10261973-10261995 TCTTTCATGGATGATGCTCAGGG + Intergenic
1155263775 18:24072119-24072141 TTTTACATGGATAATTTTCTTGG + Intronic
1155580226 18:27296751-27296773 TCTTATATGGGGACTGTTCATGG + Intergenic
1155856986 18:30846685-30846707 TTTTGCATCGATATTCTTCAGGG + Intergenic
1156902392 18:42315713-42315735 TCTTATATGCATAATGTCCAGGG - Intergenic
1158359328 18:56653607-56653629 TATTAAATGTATATTGTTCTGGG + Intronic
1159299003 18:66538099-66538121 TTTTACATGGATACTATTTAGGG - Intronic
1160355752 18:78226991-78227013 TCTTACAAGGACATCGGTCATGG + Intergenic
1165718152 19:38060402-38060424 TCCAACATGGATATTCTTAAGGG + Intronic
1166189686 19:41167922-41167944 TCTCCCATGGAAAATGTTCACGG - Intergenic
1167626824 19:50595833-50595855 TCTGATATGGATGTGGTTCATGG - Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
926467462 2:13208280-13208302 TCTTACATGTATATAATTAAGGG + Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
929063629 2:37949650-37949672 TCTTAAAAGGAATTTGTTCAAGG + Intronic
930277791 2:49333815-49333837 TCTCACATGGAAATTCTTCAAGG + Intergenic
930323667 2:49885910-49885932 TTTCACATCGATATTCTTCAGGG - Intergenic
930505478 2:52278324-52278346 TCTTGAATGCATATTGTTAAAGG - Intergenic
930969531 2:57378060-57378082 TTTTAAATGAATATTTTTCATGG - Intergenic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
933182049 2:79238304-79238326 TCTTACATGGCTGTGATTCATGG + Intronic
933986717 2:87597792-87597814 TGTTAAATGCATATTGTTGAAGG - Intergenic
935226251 2:101055494-101055516 CCTTAAATGGATATTGGCCAAGG + Intronic
935796917 2:106651498-106651520 TCTTATATGGCTGTGGTTCACGG + Intergenic
936005298 2:108881800-108881822 TCTTACATGGGTGTGGTTCTTGG + Intronic
936307126 2:111353017-111353039 TGTTAAATGCATATTGTTGAAGG + Intergenic
936646993 2:114383607-114383629 TCTTACATGGTTATTCATAAGGG - Intergenic
937563282 2:123251513-123251535 TTTTACATGGTGATAGTTCATGG + Intergenic
939207560 2:139127230-139127252 TCTTACATATGTATTGTTTATGG - Intergenic
939636272 2:144586101-144586123 TCTTACATACATATTGTACTTGG + Intergenic
939653376 2:144791473-144791495 TCTTACATTGGTGTGGTTCATGG + Intergenic
939942414 2:148366047-148366069 TTTTACATCGATATTCATCAAGG - Intronic
940418024 2:153444719-153444741 TCTTAAATGCATTTTGTTAAAGG - Intergenic
940424238 2:153512361-153512383 ACTTCCACGGGTATTGTTCATGG - Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
943227300 2:185194189-185194211 TTTTGCATGGATATTCATCAGGG - Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943690369 2:190863426-190863448 TAATGCATGCATATTGTTCAGGG - Intergenic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG + Intergenic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
946317328 2:218925491-218925513 GCTTACATGGATGTTTTCCAGGG + Intergenic
946655814 2:221945968-221945990 TCCTAAATGAAGATTGTTCAAGG + Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
948390345 2:237607267-237607289 TCGTAGGTGGATATTTTTCATGG - Intergenic
1169246267 20:4027648-4027670 TGTTACATGGATATATTGCATGG + Intergenic
1169863473 20:10175371-10175393 TGTTACATGGCAATTGTTCATGG - Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1170296397 20:14831403-14831425 TCTTACATGGATATTCCAAAAGG - Intronic
1170454389 20:16518740-16518762 TCTTACTTGGTATTTGTTCAAGG + Intronic
1171394265 20:24821434-24821456 TTTTACATGGCTATTTTTCTGGG - Intergenic
1174650527 20:52121023-52121045 TCTTACATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1174873841 20:54207541-54207563 TATTACATGGATATACTGCATGG - Intergenic
1174998391 20:55598737-55598759 TGTTAGATGGATATTGCTCTTGG - Intergenic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1177543324 21:22523642-22523664 TGTTACATGGATATATTACATGG - Intergenic
1179772038 21:43627970-43627992 TCTTACATGGGTGTGGCTCATGG - Intronic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1182917570 22:34049176-34049198 TCTCACTTGGAACTTGTTCATGG - Intergenic
950632407 3:14291514-14291536 TCTTACATGGGCACAGTTCATGG - Intergenic
951287095 3:20826210-20826232 GCTAACATGGATATTGATAATGG - Intergenic
951416521 3:22430020-22430042 TCTTTCATGGGTAGTGTGCATGG - Intergenic
952084219 3:29798095-29798117 TCTTAAATGGGTGCTGTTCATGG + Intronic
952332049 3:32372817-32372839 TATTACAGGGATAGTGTACAAGG + Intergenic
952761565 3:36919406-36919428 TCTCACATGGATAATCTTTAAGG - Intronic
953379577 3:42458041-42458063 TCTAACCTCCATATTGTTCAAGG - Intergenic
955448415 3:59038702-59038724 TCTTATATGGGGTTTGTTCATGG - Intronic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959435091 3:106305205-106305227 TCTTACTTGGTTTTTATTCACGG + Intergenic
960455745 3:117869495-117869517 TCTTCCATAGAAATTGTTAAAGG + Intergenic
960794040 3:121465702-121465724 TCTTACATGAGTGTGGTTCATGG - Intronic
960935869 3:122901635-122901657 TTTGTCATGGATATTGTACATGG + Intergenic
961747383 3:129073189-129073211 TCTGAGATGGATGGTGTTCATGG + Intergenic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963497266 3:146081747-146081769 GATTATGTGGATATTGTTCAAGG - Exonic
964287439 3:155134180-155134202 TGTTACATGGATATATTGCATGG + Intronic
964535007 3:157711186-157711208 TCTTACATGGATGTAGTTCATGG - Intergenic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
966170286 3:177072489-177072511 TCATTCAAGGATATTCTTCAGGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
969459073 4:7318232-7318254 TCTTAGCTGGATAATCTTCAGGG - Intronic
970631870 4:17955816-17955838 TCTTACATGAAAAATGATCATGG + Intronic
970822123 4:20229948-20229970 TTTTACATGGATCATGTCCAAGG - Intergenic
970884638 4:20973862-20973884 TCTTACATGGATGTAGTTCATGG + Intronic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
973658388 4:53075734-53075756 TCTTACATGGGGGTAGTTCATGG + Intronic
974162097 4:58153238-58153260 TTTTACATTGATATTCATCAGGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
975900383 4:79144738-79144760 TCTTACATGGGTGCAGTTCATGG + Intergenic
976328553 4:83800792-83800814 TGTTACATGGATATAGTTTGTGG + Intergenic
977106064 4:92886509-92886531 TCTTTCTTGGATATTTTTCTTGG - Intronic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
980374697 4:131929097-131929119 TCTTATATAGATGTGGTTCATGG + Intergenic
982425239 4:155250679-155250701 CTTTACATGAATATTGTTAAAGG + Intergenic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983811597 4:172068856-172068878 CCTAACATGGATATTTTACAAGG + Intronic
983868200 4:172793120-172793142 TATTACATTTATTTTGTTCACGG + Intronic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984479115 4:180276302-180276324 TTTTACATGGTTCTGGTTCATGG - Intergenic
985166898 4:187105544-187105566 TCATACATGGCAATAGTTCAAGG - Intergenic
985185613 4:187311948-187311970 TCTTACATGGGTGCAGTTCATGG + Intergenic
986310920 5:6550645-6550667 TCTACCCTGAATATTGTTCAAGG - Intergenic
987221179 5:15791966-15791988 TATTAAATGGATGTTTTTCACGG - Intronic
987595886 5:19998612-19998634 TTTTTCATGGATTTTTTTCAAGG + Intronic
987922951 5:24307677-24307699 TTTCACATTGATATTCTTCAAGG + Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988491757 5:31711156-31711178 TCATGGATGGATATTGGTCAAGG + Intronic
989589980 5:43104318-43104340 TCTTAGATGAAAATTGTCCAAGG + Intronic
989707424 5:44353205-44353227 TCTTACATGGATATTGAAGAGGG - Intronic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990797375 5:59559424-59559446 TATTACATGGACTTTGTTTAAGG + Intronic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
992749122 5:79846110-79846132 GTTTTCATGGATATTATTCAGGG - Intergenic
993068515 5:83130388-83130410 TTTTGCATCGATATTCTTCAGGG + Intronic
993250718 5:85518513-85518535 TATTACAAGGACATTGTTCTAGG + Intergenic
993322736 5:86494196-86494218 TGTTACATGGATATATTGCATGG + Intergenic
993359259 5:86953677-86953699 TCTTGCATAGAGATAGTTCAAGG - Intergenic
994492586 5:100465281-100465303 TCCTACATGGATTTTGTGCTTGG + Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995285714 5:110386015-110386037 TCTTACATGGATTTAATTGATGG + Intronic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
996254075 5:121376549-121376571 TCTTACCTGGATTGTGTTTATGG - Intergenic
997078245 5:130706676-130706698 TCTTTCATAGCTATTCTTCAGGG - Intergenic
997463648 5:134072219-134072241 TCTTGACTGGTTATTGTTCATGG - Intergenic
998451908 5:142241259-142241281 ATATACATGGATATTGTTCTAGG + Intergenic
1000680800 5:164181837-164181859 TCTTAGATGAATTTTGTGCAAGG - Intergenic
1001576671 5:172769256-172769278 CATCACATGGATACTGTTCATGG + Intronic
1004766697 6:18736960-18736982 ACTTAGATGGATAATTTTCAAGG + Intergenic
1005140056 6:22621155-22621177 TCTCACATAGATATTGTCTATGG - Intergenic
1005231929 6:23711710-23711732 TTTAACAAGGTTATTGTTCATGG - Intergenic
1007685292 6:43663641-43663663 TCTTAAATGGATGTAGTTCGTGG + Intronic
1007874762 6:45084039-45084061 TGTTTCATGGATATTCTTCTAGG - Intronic
1008186797 6:48402596-48402618 TCTTAAATAGTTATTGTTCTGGG + Intergenic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010914416 6:81598022-81598044 TATTACATGGATACTTTACAAGG - Intronic
1011716766 6:90114237-90114259 TTTTGCATGGATATTCATCAAGG - Intronic
1011826771 6:91316619-91316641 TGTTTCATGTATATTCTTCATGG + Intergenic
1011937517 6:92799452-92799474 TTCTCCTTGGATATTGTTCAAGG + Intergenic
1012085111 6:94814942-94814964 TGTTGCATGGTTATTGTTCTTGG - Intergenic
1012541891 6:100370962-100370984 TGTTACATGGATAGATTTCAAGG + Intergenic
1013172627 6:107650603-107650625 TCTTACATGGGTGCAGTTCATGG - Intronic
1013381868 6:109581058-109581080 TCTTATATAGATGTGGTTCATGG - Intronic
1014319597 6:119910462-119910484 TCTCATATGGGTATAGTTCAAGG - Intergenic
1014419197 6:121219940-121219962 TCTTATCTGGATACAGTTCATGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1014833068 6:126125530-126125552 TATTTCATGGATATTTATCAAGG + Intergenic
1014842047 6:126231268-126231290 GTTTAAATGCATATTGTTCAAGG - Intergenic
1015559677 6:134501318-134501340 TCTTACATGGAAATGGATGAAGG - Intergenic
1015668658 6:135661897-135661919 TTTTACATGTATATTCATCAGGG - Intergenic
1016536335 6:145110882-145110904 TCTTAAATAGATATAATTCAGGG + Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016931492 6:149415297-149415319 CCTTAGATGGATATGCTTCATGG - Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018305024 6:162445858-162445880 TTGTTCATGGTTATTGTTCACGG - Intronic
1018666331 6:166141715-166141737 TCTACCATGGAGATTCTTCATGG + Intergenic
1018843753 6:167539535-167539557 TCTTACATGGGTGTGGCTCATGG + Intergenic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021379574 7:19951137-19951159 TTTTATATTGATATTCTTCAGGG + Intergenic
1021475951 7:21060623-21060645 TCCTCAATTGATATTGTTCAAGG + Intergenic
1022155002 7:27651904-27651926 TCTGACCTGGATATTATACAAGG + Intronic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1023521507 7:41054490-41054512 TATTACATGGAAATTCTTCAAGG + Intergenic
1023636803 7:42220180-42220202 TTATAAATGGATATAGTTCAGGG + Intronic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1027437988 7:78186381-78186403 TCATACATGAACATTTTTCAGGG + Intronic
1027536469 7:79408894-79408916 TTTTATCTGGATAATGTTCAAGG - Intronic
1027556322 7:79669095-79669117 TCTTTCATGGCTCTGGTTCAAGG + Intergenic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028591429 7:92500161-92500183 CCTTTCATGGATATGCTTCATGG + Intronic
1028652515 7:93166868-93166890 TTTTGCATGGATATTCATCAGGG + Intergenic
1029808351 7:103020045-103020067 TTTTGCATGGATATTCATCAGGG - Intronic
1030549371 7:110938682-110938704 TGTTACATGGATATATTGCATGG - Intronic
1030812773 7:113995148-113995170 TTTTACATCAATATTTTTCAAGG - Intronic
1030861308 7:114633917-114633939 TTTTATATGGCTATTTTTCAAGG - Intronic
1031226467 7:119044258-119044280 TGTTACATAGATTTTTTTCAAGG + Intergenic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033467391 7:141607666-141607688 TCTTTCATGGATATTGCTTTTGG + Intronic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1037218554 8:16488026-16488048 TCTTATATGGGTACAGTTCATGG + Intronic
1037447696 8:18983656-18983678 TCTTACATGGACACAGTTCTTGG + Intronic
1038033677 8:23667405-23667427 TCTTTCATGGAAATCATTCATGG + Intergenic
1038292825 8:26265274-26265296 TTTTACATATATATTTTTCAAGG + Intergenic
1040101028 8:43505165-43505187 TCTTAAATGTATATTATTTAAGG + Intergenic
1040718141 8:50283434-50283456 TTTTACATGGCCATTGTTGAAGG + Intronic
1042419432 8:68568111-68568133 TCTTATATGGACAGAGTTCATGG + Intronic
1043062419 8:75521085-75521107 TTATACATGGATATTTTTAATGG + Intronic
1043173144 8:76990669-76990691 TCTTATATGGATACAGTTCTTGG + Intronic
1043173150 8:76990719-76990741 TCTTATATGGATACAGTTCGTGG + Intronic
1043442634 8:80289752-80289774 TCTTTAATGTATATTATTCAAGG + Intergenic
1043689321 8:83130851-83130873 TCTTACATGAATATTCATAAAGG - Intergenic
1043779658 8:84315178-84315200 TCTTACATGGATTGTGTATATGG - Intronic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1044092775 8:88022704-88022726 TCTTACAAGGAAAGTCTTCAGGG + Intergenic
1044364494 8:91326955-91326977 TCTTACAAGGATACTGATCATGG + Intronic
1044384472 8:91571000-91571022 TTTTACATCGATATTCATCAGGG - Intergenic
1044889521 8:96818299-96818321 TCTTACATGGGTGTAGTTCGTGG + Intronic
1045389097 8:101697516-101697538 TCTTCCATCGATGTTCTTCAAGG - Intronic
1046111529 8:109731647-109731669 TGTTACATGGATATATTGCATGG - Intergenic
1047816032 8:128463801-128463823 CCTAACATGGATATTATTCAGGG - Intergenic
1048102020 8:131362644-131362666 TGTTACATGGATATATTGCATGG - Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1050159994 9:2708450-2708472 TTTTAAATGGATATTGTGTAAGG - Intergenic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050941701 9:11468850-11468872 TCTTAAATGCAGGTTGTTCATGG + Intergenic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1051934462 9:22429318-22429340 TCTGACAGGGTTATTGTGCATGG - Intergenic
1052819587 9:33128435-33128457 GCTTCCATGGACATTGTTCTGGG - Intronic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1053766409 9:41406040-41406062 TCATATATGGATGTGGTTCATGG - Intergenic
1053848465 9:42266147-42266169 TGTTACATGCATAGTGGTCAAGG - Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1055591852 9:77823914-77823936 TATTACATTGATATTATTCAAGG + Intronic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1056168543 9:83960771-83960793 TCTAACTTGGATACTGTTCAAGG - Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1056490339 9:87100485-87100507 TCTGACATGAATATTTTTCTTGG - Intergenic
1057287378 9:93768958-93768980 GCTCACATGGATGTGGTTCATGG + Intergenic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1060334414 9:122707977-122707999 TCTTACATGGATGTTGTCTTTGG - Intergenic
1060458229 9:123821111-123821133 TCTTCCATGAATATTGTTCCAGG + Intronic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1185884030 X:3766103-3766125 TGTTACATGGATATATTGCATGG + Intergenic
1185938134 X:4282160-4282182 TTTTACATGGATATATTGCATGG + Intergenic
1186185611 X:7016893-7016915 TCGCAGATGGATATTGTACATGG - Intergenic
1187355198 X:18563102-18563124 TCTCAAATGAATATTGTTCCAGG - Intronic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187855447 X:23632455-23632477 TCTTACATGCATATATTGCATGG + Intergenic
1188802324 X:34547828-34547850 TCTTTGATGGAAATTGTCCATGG - Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1188983310 X:36748112-36748134 TTTTGCATGGATGTTCTTCAAGG + Intergenic
1189486763 X:41439602-41439624 TGTTAAATTCATATTGTTCATGG - Intergenic
1190715729 X:53101647-53101669 TCTTACATGGGTACAGTTCATGG + Intergenic
1191095007 X:56664748-56664770 TTTTACATCGATATTCATCAGGG + Intergenic
1193081211 X:77408200-77408222 TTTTACATTGATATTCATCAGGG + Intergenic
1193424061 X:81319353-81319375 TCCTACTTTGATATGGTTCAAGG - Intergenic
1193524196 X:82568648-82568670 TCTTGCATCAATATTGATCAAGG + Intergenic
1194171199 X:90585504-90585526 TCTTACATGTGTATTCTTCTTGG - Intergenic
1194742605 X:97592608-97592630 TTTCACATTGATATTGTTCACGG - Intronic
1195069231 X:101263292-101263314 TCTTCTAAGGATATTGTGCATGG + Exonic
1195841172 X:109178861-109178883 TCATAGATGGATCTTTTTCACGG - Intergenic
1195863008 X:109401065-109401087 ACTTACATGTATGTTGTTAATGG + Intronic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196221274 X:113113890-113113912 TCATAGATGGATCTTTTTCACGG + Intergenic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1196529352 X:116766190-116766212 TGTTACATGGATATATTGCATGG + Intergenic
1197387954 X:125823885-125823907 TATTTCATTGATATTTTTCATGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1197869234 X:131050058-131050080 TGTAACATGGATATAGGTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198341805 X:135721453-135721475 TCTTACTTGGTTATGGTTAAAGG + Intronic
1198346189 X:135761909-135761931 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198348094 X:135779194-135779216 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198350000 X:135796456-135796478 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198351912 X:135813729-135813751 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198353814 X:135830998-135831020 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198355728 X:135848247-135848269 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198357639 X:135865526-135865548 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198359547 X:135882809-135882831 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198867294 X:141137749-141137771 TCTAACATCAATATTTTTCATGG - Intergenic
1199820067 X:151435936-151435958 TTTTACATGTACATTGCTCAGGG + Intergenic
1200272039 X:154695103-154695125 TCTTAGAAGGACAATGTTCAAGG - Intronic
1200517430 Y:4163252-4163274 TCTTACATGTGTATTCTTCTTGG - Intergenic
1200781339 Y:7218836-7218858 TGTTACATGGATATATTGCATGG - Intergenic
1201644958 Y:16220281-16220303 TTTTACATCGATATTCATCAGGG + Intergenic
1201657856 Y:16365041-16365063 TTTTACATCGATATTCATCAGGG - Intergenic