ID: 959039525

View in Genome Browser
Species Human (GRCh38)
Location 3:101405156-101405178
Sequence TGTACTCTGCTTCCTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 418}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959039525_959039527 -8 Left 959039525 3:101405156-101405178 CCTCCTGAAGGAAGCAGAGTACA 0: 1
1: 0
2: 1
3: 38
4: 418
Right 959039527 3:101405171-101405193 AGAGTACACCAGCATGACCCAGG 0: 1
1: 0
2: 0
3: 12
4: 257
959039525_959039535 22 Left 959039525 3:101405156-101405178 CCTCCTGAAGGAAGCAGAGTACA 0: 1
1: 0
2: 1
3: 38
4: 418
Right 959039535 3:101405201-101405223 AAATACTATGCTGGTATCCATGG 0: 3
1: 18
2: 19
3: 24
4: 195
959039525_959039531 13 Left 959039525 3:101405156-101405178 CCTCCTGAAGGAAGCAGAGTACA 0: 1
1: 0
2: 1
3: 38
4: 418
Right 959039531 3:101405192-101405214 GGACACCCCAAATACTATGCTGG 0: 1
1: 1
2: 23
3: 39
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959039525 Original CRISPR TGTACTCTGCTTCCTTCAGG AGG (reversed) Intronic
900832611 1:4975972-4975994 CGTTCTATGCCTCCTTCAGGAGG - Intergenic
901215687 1:7553962-7553984 TGTACTCAGGTTCTTTCAGTGGG + Intronic
903037072 1:20499866-20499888 TCCACACTGCGTCCTTCAGGAGG + Exonic
904572638 1:31478172-31478194 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
905750352 1:40457238-40457260 TCTACTCTGCTTTCTTTAGAAGG + Intronic
905773459 1:40653317-40653339 TGGACTCTCCCTCCTTCAGTTGG - Intronic
906292150 1:44626304-44626326 TGTTGTCTGCTTCCATCAAGAGG + Exonic
906569412 1:46823294-46823316 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
907349008 1:53810892-53810914 AGCAGTCTGCTTCCTTCAGAGGG - Intronic
908262151 1:62347542-62347564 TGTCCTCTGCCTCCTTCCTGTGG + Intergenic
908297179 1:62724361-62724383 TATACTCTGCTTCCTCATGGTGG - Intergenic
908976874 1:69909425-69909447 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
908978548 1:69926962-69926984 TGTTTAATGCTTCCTTCAGGAGG + Intronic
910380601 1:86622857-86622879 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
911717529 1:101151189-101151211 TGTCTTCTGCTTTCTTCAGTAGG + Intergenic
912661150 1:111532089-111532111 TGTACTCTGCTTCTTTGGCGTGG + Intronic
912925846 1:113912184-113912206 TGTACTCTCCTGTCTTCAGCAGG - Exonic
913588094 1:120296312-120296334 AGCCATCTGCTTCCTTCAGGGGG + Intergenic
913620091 1:120602057-120602079 AGCCATCTGCTTCCTTCAGGGGG - Intergenic
914387189 1:147181161-147181183 TGTGCTCTAATTCCTTGAGGGGG - Intronic
914570111 1:148908185-148908207 AGCCATCTGCTTCCTTCAGGGGG + Intronic
914602718 1:149222084-149222106 AGCCATCTGCTTCCTTCAGGGGG - Intergenic
914927031 1:151897708-151897730 AGTAGTCCGCTTCCTTCAGAGGG - Intronic
916566110 1:165979648-165979670 TGTTCTCTAGTTCCTTGAGGTGG + Intergenic
917172721 1:172195016-172195038 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
918750778 1:188266471-188266493 AGGAGTCTGCTTCCTTCAGAGGG + Intergenic
918943360 1:191028838-191028860 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
919848332 1:201655570-201655592 GGTGTCCTGCTTCCTTCAGGAGG - Intronic
921409946 1:214824241-214824263 AGTAGTCCGCTTCCTTCAGAGGG + Intergenic
921818458 1:219590199-219590221 TGTATGTTCCTTCCTTCAGGTGG + Intergenic
922346481 1:224700744-224700766 TGCACTCTGCTCCCTGCAAGAGG - Intronic
923923668 1:238598844-238598866 TGAACTCTGCTTCCTGCACAGGG - Intergenic
924172831 1:241358809-241358831 GGAAGACTGCTTCCTTCAGGCGG - Intergenic
924302461 1:242652875-242652897 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1063536873 10:6891997-6892019 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1064539446 10:16390632-16390654 TGTTATCTACTTTCTTCAGGAGG - Intergenic
1064908341 10:20371352-20371374 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1067528680 10:47054904-47054926 TGCACTCTGCCCCCATCAGGTGG - Intergenic
1069110462 10:64440526-64440548 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1069242848 10:66163581-66163603 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
1069938800 10:71939118-71939140 TGCACTCTGCTTCGGTCAGCTGG - Intergenic
1073226745 10:101927354-101927376 TGTACTCTCCTGCCATCAGGGGG + Intronic
1073268494 10:102242400-102242422 TGTGCTCTCCCTCCTTCAGCAGG + Intergenic
1075490965 10:122868770-122868792 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
1076506983 10:130984777-130984799 TGTGCTCTGCTGCCCTCATGGGG - Intergenic
1078033541 11:7779560-7779582 TGAACTCTGCCTCAGTCAGGAGG - Intergenic
1079653820 11:22964063-22964085 TTTATAGTGCTTCCTTCAGGAGG + Intergenic
1079964087 11:26959321-26959343 TGTTCTCTGGTTCCTTAATGTGG - Intergenic
1081457810 11:43242655-43242677 TGAACTCTGCTTAGTTCAGCTGG - Intergenic
1082134474 11:48532063-48532085 TGTTCAGTGCTTCCTTCAGGAGG + Intergenic
1082568745 11:54712721-54712743 TGTTTATTGCTTCCTTCAGGAGG + Intergenic
1083052626 11:59790773-59790795 TGTACTCTCCTTCTCTAAGGAGG + Intronic
1083590378 11:63890202-63890224 TTTTCTCTGCTTCCTTCCAGTGG + Intronic
1083682234 11:64356997-64357019 TGAGATCTGCTTCCCTCAGGAGG - Intronic
1084151726 11:67290677-67290699 GGTAATCTGCATTCTTCAGGAGG - Intronic
1084840432 11:71842303-71842325 AGCAGTCTGCTTCCTTCGGGGGG - Intergenic
1085299654 11:75450618-75450640 TGTGCTTTGCTTTCTTCTGGAGG - Intronic
1085640950 11:78192337-78192359 TGCACTCTGCCTCCCTCAGGAGG - Intronic
1085917031 11:80902756-80902778 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1086880370 11:92146578-92146600 TGAACTGTGCTACCTTCGGGAGG + Intergenic
1087241686 11:95789023-95789045 TGTCCTCTTCTTCCACCAGGAGG - Intronic
1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG + Intronic
1088137772 11:106578266-106578288 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1088179351 11:107092016-107092038 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1088730451 11:112677125-112677147 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1088819043 11:113441628-113441650 TGTCCTCTGCTTTCTTCAATCGG - Intronic
1089826452 11:121282075-121282097 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1089954371 11:122556435-122556457 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1090757195 11:129803116-129803138 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1091094235 11:132803685-132803707 TATACTATGCTACCTTCTGGTGG - Intronic
1092303836 12:7279472-7279494 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1093208255 12:16277538-16277560 TGGAATCTGCTTGCTTCTGGTGG - Exonic
1093991288 12:25592336-25592358 AGCAATCTGCTTCCTTCAGAGGG - Intronic
1094163236 12:27414328-27414350 TGTATTCTGCTGCCATCAGATGG - Intronic
1095118631 12:38385761-38385783 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1095661642 12:44743288-44743310 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
1095664234 12:44776793-44776815 TATACACTGCTTACTACAGGAGG - Intronic
1095665056 12:44788281-44788303 AGCAATCTGCTTCCTTCAGAGGG - Intronic
1095732516 12:45521395-45521417 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1096347819 12:50866162-50866184 AGCAGTCTGCTTCCTTCAGAGGG - Intronic
1096956720 12:55534118-55534140 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1097760400 12:63458796-63458818 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1098420357 12:70290202-70290224 TTTTCTCTGTTTCTTTCAGGTGG + Intronic
1098961055 12:76739859-76739881 AGTAGTCCGCTTCCTTCAGAAGG + Intergenic
1098982636 12:76973975-76973997 AGAAGTCTGCTTCCTTCAGTGGG + Intergenic
1099777547 12:87152047-87152069 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1099803574 12:87488408-87488430 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1099892430 12:88606310-88606332 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1100697195 12:97107779-97107801 GGCAATCTGCTTCCTTCAGGAGG + Intergenic
1101473175 12:105018584-105018606 TGTACTCACCTTCCTGCAAGGGG - Intronic
1103217931 12:119217687-119217709 TGTCCTCAGTTTTCTTCAGGTGG + Intronic
1105930628 13:25048772-25048794 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG + Intronic
1106948391 13:34854531-34854553 TGTGATCTGCTTACTTCAGTGGG + Intergenic
1108787452 13:53921672-53921694 TGTGCCCTGCGTCCTTGAGGTGG - Intergenic
1110153110 13:72278782-72278804 TGTTCCCAGCTTCCATCAGGAGG - Intergenic
1110206985 13:72926498-72926520 TGTAGTCTTCTTCCTTCTGCAGG + Intronic
1110793573 13:79612163-79612185 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1111055269 13:82940497-82940519 TGCACTCAACTTCCTTGAGGGGG - Intergenic
1111748650 13:92298696-92298718 AGCAATCTGCTTCCTTTAGGGGG + Intronic
1113284222 13:108828850-108828872 TGTACCCTGCATCCTTGGGGAGG + Intronic
1113294891 13:108948039-108948061 TGTACTCATATTCCTTGAGGAGG + Intronic
1113316683 13:109187818-109187840 TGTATTCTGCTTCCATTGGGTGG + Intronic
1114264207 14:21062430-21062452 TGCACTGTGCTGCCTTCAGTTGG + Intronic
1115133776 14:30085056-30085078 TTTCCTCTGCTTCCTCCAGATGG - Intronic
1115265017 14:31492387-31492409 AGCAGTCTGCTTCCTTCAGAGGG - Intronic
1115527193 14:34293159-34293181 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
1117231720 14:53725669-53725691 TATACCCTGCTTCCATCAGAGGG + Intergenic
1117639698 14:57785536-57785558 AGCAGTCTGCTTCCTTCAGAGGG - Intronic
1117856598 14:60040914-60040936 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
1119144992 14:72304073-72304095 TGTCCTCAGGTTCCTACAGGAGG - Intronic
1120065949 14:80040787-80040809 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1120537547 14:85715474-85715496 AGCAATCTGCTTCCTTCAGGGGG + Intergenic
1121691180 14:95877934-95877956 TGTCCTTTCCATCCTTCAGGAGG - Intergenic
1122825127 14:104367077-104367099 TGTGAACTTCTTCCTTCAGGAGG - Intergenic
1123154320 14:106209842-106209864 TGCACTGTGCTCCCTGCAGGTGG - Intergenic
1124373554 15:29116676-29116698 TGCACTCTGCTTCACTGAGGAGG - Intronic
1124556993 15:30735726-30735748 AGCAGTCTGCTTCCTTCAGAGGG - Intronic
1124674271 15:31670018-31670040 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
1125877777 15:43166043-43166065 TGTACTCATCCTCCTTGAGGAGG + Intronic
1126460939 15:48913972-48913994 AGCAATCTGCTTCCTTCAGAGGG + Intronic
1126466585 15:48966177-48966199 TGTACTCTGCTGCCTCCCAGGGG + Intergenic
1127194332 15:56568125-56568147 AGCAATCTGCTTCCTTCAGAAGG - Intergenic
1127638111 15:60890353-60890375 TGTACTCTGCATTCTTCTGAGGG - Intronic
1128238583 15:66084426-66084448 AGCAGTCTGCTTCCTTCAGAGGG - Intronic
1129690656 15:77711470-77711492 TGCATCCTGCTTCCTTCATGAGG + Intronic
1130053256 15:80501705-80501727 TGTACTCTGATTCTCTAAGGGGG + Intronic
1130822711 15:87511739-87511761 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1130910562 15:88267973-88267995 TGTACTCTGCTGGATTCTGGGGG - Intergenic
1131156055 15:90076360-90076382 TCTGCTCTGGTTCCTTCTGGTGG - Intronic
1132168266 15:99619315-99619337 TGTATTCTGCTGCCTTCATGAGG - Intronic
1132210433 15:100017735-100017757 AGCAGTCTGCTTCCTTCAGTGGG + Intronic
1133969248 16:10555381-10555403 TGCAGTCTCCTACCTTCAGGTGG - Intronic
1138124457 16:54427266-54427288 TGCTCTCTTCTTGCTTCAGGCGG - Intergenic
1138878660 16:60983378-60983400 TTTTCTCTGATACCTTCAGGAGG - Intergenic
1139486507 16:67259801-67259823 TGTCCCCTGCCTCCTGCAGGAGG + Exonic
1140402820 16:74685304-74685326 TGTTCTCATCTTCTTTCAGGAGG - Intronic
1140953051 16:79837657-79837679 TGTACTATGAATCCTTCATGGGG + Intergenic
1143129031 17:4664465-4664487 TCTTCTCTCCTTCCTTCACGAGG + Intergenic
1144056035 17:11541405-11541427 CTTCCTCTGCCTCCTTCAGGTGG - Intronic
1144139810 17:12337259-12337281 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1145002275 17:19313606-19313628 TGTATTTTGGTTCCTTCAGCTGG - Intronic
1147326638 17:39672820-39672842 TGTCCTCTGATTCCTTCAGCAGG + Exonic
1151368055 17:73629950-73629972 TCTTCACTTCTTCCTTCAGGAGG - Intronic
1151733999 17:75927529-75927551 TGTCTTCTGCTTCCTGCAGGGGG - Exonic
1153065316 18:1039124-1039146 AGCAATCTGCTTCCTTCAGGGGG - Intergenic
1153137528 18:1933838-1933860 TGTATTCAGCTACCTACAGGTGG + Intergenic
1155218957 18:23667302-23667324 TCTGCTCTGCCACCTTCAGGGGG - Intergenic
1156013914 18:32526583-32526605 TCTACTCTTCTTCCTTGAGAGGG + Intergenic
1157218477 18:45806466-45806488 GGCAATCTGCTTCCTTCAGAGGG - Intergenic
1158351267 18:56566948-56566970 TGTACCTTGCTTCCTCCTGGTGG + Intergenic
1159906409 18:74096844-74096866 AGTAATCTGCTTCTTTCAGAGGG - Intronic
1160216480 18:76937054-76937076 TGAATGCTGCTTCCTGCAGGTGG + Intronic
1164044705 19:21526804-21526826 AGCAGTCTGCTTCCTTCAGATGG + Intronic
1164288094 19:23839986-23840008 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1164320296 19:24138134-24138156 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1164558375 19:29270552-29270574 GGATCTCTGGTTCCTTCAGGAGG - Intergenic
1166429930 19:42716141-42716163 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
1166433600 19:42748100-42748122 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
1166436703 19:42773241-42773263 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
1166613782 19:44224922-44224944 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
925702735 2:6655145-6655167 TGTACTCTGGAAACTTCAGGAGG - Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
928580703 2:32704842-32704864 AGTACTCTTCTTCCCTCAGGTGG + Intronic
929010232 2:37434815-37434837 TGCAATCTGCTTCCTTCAGATGG + Intergenic
929805878 2:45144812-45144834 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
931992880 2:67809080-67809102 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
932773275 2:74513422-74513444 TGAACTCTGCGTCCTTCCCGGGG - Intergenic
933302742 2:80561043-80561065 TGGCCTATGCTTCCTTCAGTTGG + Intronic
933756399 2:85642301-85642323 TGTTCTCTGCCTCCTTGAGTAGG + Intronic
935527426 2:104187828-104187850 TTTCCTCTGTTTCTTTCAGGTGG + Intergenic
935619586 2:105117120-105117142 TGCACTGTGCTCCCTTCTGGGGG - Intergenic
936843758 2:116804906-116804928 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
937089018 2:119193071-119193093 TGTAACCTGCTGCCTCCAGGTGG - Intergenic
937240546 2:120459463-120459485 TGTATTCTGCTGCCTTTAGGTGG - Intergenic
937572366 2:123380291-123380313 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
937829066 2:126400064-126400086 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
937879610 2:126855701-126855723 TGTCCTCCTCCTCCTTCAGGTGG + Intergenic
939240216 2:139548403-139548425 AGCAATCTGCTTCCTTCAGTGGG + Intergenic
940172500 2:150843756-150843778 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
940628419 2:156206756-156206778 TATACTCTGCTGCCTTCTTGAGG - Intergenic
940709521 2:157144681-157144703 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
940802083 2:158144549-158144571 AGCAATCTGCTTTCTTCAGGGGG - Intergenic
941396601 2:164981717-164981739 TCTACTCTGCTTTGTTCTGGGGG + Intergenic
941631758 2:167891824-167891846 AGTAATACGCTTCCTTCAGGGGG + Intergenic
942209695 2:173658200-173658222 TTTCCTCACCTTCCTTCAGGTGG + Intergenic
942714362 2:178874634-178874656 AGTTCTCTGCTTCCTTCAAATGG - Intronic
943017936 2:182537169-182537191 TTTACTCTGCTTCTTCCAGTTGG - Intergenic
943148126 2:184071953-184071975 TTTACTGTGTTTCCTTCATGCGG + Intergenic
945132225 2:206585088-206585110 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
945667340 2:212758610-212758632 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
945669629 2:212787094-212787116 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
946036394 2:216745973-216745995 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
946501337 2:220250452-220250474 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
947457226 2:230265821-230265843 TGCAATCTGCTTCCTTCAGAGGG + Intronic
947838575 2:233192492-233192514 TATACTCTGCTTCCCTCACCTGG + Intronic
948556672 2:238816348-238816370 TGTCCTCTGCTGCTTTCTGGGGG - Intergenic
1169041963 20:2502799-2502821 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
1169369950 20:5021022-5021044 TCCTCTCTGCTTCCTGCAGGTGG + Intergenic
1169401194 20:5282258-5282280 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1169517605 20:6333906-6333928 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1169831016 20:9824900-9824922 ACTATTCTGCTTACTTCAGGTGG - Intronic
1170049587 20:12127855-12127877 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1170097640 20:12664122-12664144 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1170863297 20:20128558-20128580 GGCAGTCTGCTTCCTTCAGAGGG + Intronic
1171165472 20:22966815-22966837 AGAAGTCTGCTTCCTTCAGAGGG - Intergenic
1173163325 20:40668760-40668782 TGGACTCTGCTCTCTCCAGGCGG - Intergenic
1173722219 20:45269322-45269344 TGTTCTCTGCCTCCCACAGGAGG + Intergenic
1175262391 20:57682728-57682750 TGAACTTTCCTTCCTCCAGGAGG - Intronic
1175388613 20:58612558-58612580 TGTTCTCTGCTTCCTTGGGGAGG + Intergenic
1183544697 22:38449207-38449229 TGTACCCACCTCCCTTCAGGTGG + Intronic
949783631 3:7716941-7716963 TGTACTCTGTTTACTTGATGAGG + Intronic
950013034 3:9736837-9736859 TCTAATATGCTTCCTTGAGGGGG + Intronic
950335906 3:12192784-12192806 TGTTCCCTTCTTCCTTCTGGGGG + Intergenic
950410059 3:12830377-12830399 TGTACTCAGCTTCCATCATCTGG + Intronic
950599327 3:14017803-14017825 AGCAATCTGCTTCCTTCAGAGGG + Intronic
950689329 3:14643186-14643208 TGTGCCCTGCTTCCTTGTGGGGG + Intergenic
951769807 3:26243218-26243240 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
951851889 3:27150933-27150955 AGCAGTCTGCTTCCTTCAGAGGG - Intronic
953022564 3:39125091-39125113 GGTACTCAGCTTCCTCCAGGTGG - Exonic
953037041 3:39221053-39221075 TGGTGTCTGCTTCCTTCATGTGG + Intergenic
953551809 3:43908902-43908924 TGTTCTCTGCTTCCTTCTCCAGG - Intergenic
953555570 3:43944166-43944188 TGTTTAATGCTTCCTTCAGGAGG + Intergenic
954572121 3:51649772-51649794 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
955461753 3:59190374-59190396 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
955477502 3:59353229-59353251 AGCAATCTGCTTCCTTCAGGGGG + Intergenic
956215561 3:66844770-66844792 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
957040212 3:75330499-75330521 CTTTCTCTTCTTCCTTCAGGTGG + Intergenic
957213135 3:77286702-77286724 TGTTTTCTGCTTTCTTCATGAGG + Intronic
957947555 3:87084160-87084182 TGTGCTCTCTTTCCTTCAGAAGG - Intergenic
958013676 3:87913991-87914013 AGCAATCCGCTTCCTTCAGGGGG - Intergenic
958498844 3:94879429-94879451 TCTACTCAGCATCATTCAGGTGG - Intergenic
958970079 3:100601341-100601363 AGTAGTCTGCTTCCTTCAGAGGG + Intergenic
959039525 3:101405156-101405178 TGTACTCTGCTTCCTTCAGGAGG - Intronic
959504887 3:107146067-107146089 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
959553961 3:107696352-107696374 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
959663515 3:108896116-108896138 TGTACTCTGCTTCTCTGAGTTGG - Intergenic
959757094 3:109911532-109911554 AGCAGTCTGCTTCCTTCAGAAGG + Intergenic
961042119 3:123684835-123684857 TGTACTCCTCTTCCTTAAGAAGG - Intronic
961045007 3:123702079-123702101 CTTTCTCTTCTTCCTTCAGGTGG + Intronic
961984655 3:131120133-131120155 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
962343633 3:134604688-134604710 GGTTCCCTGCTCCCTTCAGGTGG + Intronic
964040581 3:152256643-152256665 TGGACACTGCTTCCTTTAAGGGG + Intronic
964120465 3:153177979-153178001 AGCAATCTGTTTCCTTCAGGGGG + Intergenic
964140689 3:153396102-153396124 TGTACTCTTCCTTCTTGAGGAGG + Intergenic
964188869 3:153979693-153979715 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
965217020 3:165875570-165875592 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
966686770 3:182703845-182703867 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
966992143 3:185243234-185243256 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
970386515 4:15562254-15562276 GGTTCTCTGCTTCCTTCCTGAGG - Intronic
970600262 4:17636545-17636567 TGTCCTCTCTCTCCTTCAGGCGG + Exonic
970658752 4:18260915-18260937 AGCAGTCTGCTTCCTTCAGAAGG + Intergenic
970917659 4:21354135-21354157 TGTTTATTGCTTCCTTCAGGAGG - Intronic
971183266 4:24350163-24350185 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
972097437 4:35365113-35365135 GGCAATCTGCTTCCTTCAGAGGG + Intergenic
972774045 4:42225158-42225180 TGGTCTCTGCTTCCTGGAGGAGG + Intergenic
973069272 4:45836343-45836365 AGCAATTTGCTTCCTTCAGGGGG + Intergenic
974562005 4:63534373-63534395 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
975309106 4:72882906-72882928 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
975382217 4:73714271-73714293 TGTATTCTGCTTCATTCCAGAGG + Intergenic
975483518 4:74908673-74908695 TGCACCCTGATTGCTTCAGGGGG + Intergenic
976856340 4:89609533-89609555 AGCAGTCTGCTTCCTTCAGGGGG - Intergenic
976924770 4:90483527-90483549 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
977163235 4:93662811-93662833 AGCACTCTTCTTCCTTCATGAGG - Intronic
977746658 4:100558008-100558030 AGAAGTCTGCTTCCTTCAGAGGG - Intronic
977813833 4:101390155-101390177 ATTAATCTGCTTCCTTCAGAGGG + Intergenic
977975011 4:103254423-103254445 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
979588031 4:122444464-122444486 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
979704715 4:123708624-123708646 AGTAGTCTGCTTCCTTCAGAGGG - Intergenic
979795031 4:124835036-124835058 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
980153170 4:129073211-129073233 TGCAATCTGCTTCCTTCAGAGGG + Intronic
980858043 4:138464059-138464081 TGTACTCTGAAGCCTGCAGGCGG - Intergenic
981165116 4:141548836-141548858 TGTTCTCTGATTTCTTCAGAGGG - Intergenic
981401105 4:144314340-144314362 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
981496626 4:145401013-145401035 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
981524538 4:145696774-145696796 TGTACTCTCAGTACTTCAGGAGG + Intronic
981559599 4:146032858-146032880 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
981796115 4:148597425-148597447 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
982312282 4:153998063-153998085 AGCAGTCTGCTTCCTTCAGAAGG + Intergenic
982680285 4:158419738-158419760 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
984069194 4:175091597-175091619 TGAATTCTGCTTAATTCAGGTGG + Intergenic
985159796 4:187032814-187032836 GGTTCTCTGGTTCCTTCTGGAGG + Intergenic
985766930 5:1785005-1785027 TGGACCCTTCTTCCTTGAGGAGG - Intergenic
986018056 5:3775173-3775195 TGTTCTCTGCTCCCTTCAGAAGG + Intergenic
987292893 5:16524989-16525011 TGTCCTCCGGTTCCTGCAGGTGG + Intronic
987577625 5:19751950-19751972 AGCAATCTGCTTCCTTCAGAGGG - Intronic
988381109 5:30497982-30498004 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
988723690 5:33904029-33904051 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
990396190 5:55381711-55381733 TGTATTCTGCTGCTTTAAGGTGG + Intronic
990572648 5:57094708-57094730 AGCAATCTGCTTCCTTCAGGAGG - Intergenic
990776344 5:59309631-59309653 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
991386810 5:66100459-66100481 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
991923744 5:71683695-71683717 AGCAATCTGCTTCCTTCAGTGGG - Intergenic
992340213 5:75815238-75815260 AGCAATCTGCTTCCTTCAGTGGG + Intergenic
993341453 5:86729992-86730014 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
993884004 5:93395447-93395469 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
994303938 5:98180051-98180073 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
995722367 5:115150656-115150678 AGCAGTCTGCTTCCTTCAGGGGG - Intronic
995955198 5:117769229-117769251 AGCAATCTGCTTCCCTCAGGGGG - Intergenic
996002902 5:118384942-118384964 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
996124284 5:119706819-119706841 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
996325293 5:122266833-122266855 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
997765843 5:136502117-136502139 AGTAATCTGCCTCCTTCAGAGGG + Intergenic
998051436 5:139039268-139039290 TGTACTCTGATTCCTCCACCAGG - Intronic
999125676 5:149244200-149244222 TGTCCTGGGCTTACTTCAGGTGG + Intronic
1001177269 5:169481632-169481654 TGCAATCTGCTTCCTTCAGAGGG + Intergenic
1001809432 5:174616404-174616426 TTTACTCTGCTTCCTTCATGAGG + Intergenic
1003297458 6:4844416-4844438 AGCAATCTGCTTCCTTCAGAGGG + Intronic
1004647339 6:17574883-17574905 TATACTCACATTCCTTCAGGGGG - Intergenic
1005760140 6:28960546-28960568 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1006104205 6:31706843-31706865 TGGACTCTGCTTCCTCCCTGGGG + Intronic
1006989116 6:38198337-38198359 TGTCCTCTGCTTCTTTCCGATGG - Intronic
1007272997 6:40652499-40652521 TTGACACTCCTTCCTTCAGGAGG - Intergenic
1007498295 6:42276935-42276957 TGGATTTTGCTTCCTGCAGGTGG + Intronic
1007747341 6:44051330-44051352 TGTACTCTGCTTCCTCCCCATGG - Intergenic
1007890938 6:45291023-45291045 AGGAATCTGCTTCCTTCAGGGGG - Intronic
1009798379 6:68502212-68502234 AGCAATCTGCTTCCTTCAGGGGG - Intergenic
1010181843 6:73095838-73095860 AGCAATCTGCTTCCTGCAGGGGG + Intronic
1010679201 6:78780578-78780600 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1010707882 6:79135738-79135760 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1010725032 6:79323807-79323829 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1010904401 6:81469989-81470011 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1011040505 6:83024881-83024903 TGTCCTCTCCTTCATTCAAGGGG + Intronic
1011133284 6:84073455-84073477 AGCAATCTGCTTCCTTCAGAGGG + Intronic
1011168496 6:84478780-84478802 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1011233199 6:85187244-85187266 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1011320094 6:86081180-86081202 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1011329200 6:86184560-86184582 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1012155833 6:95819241-95819263 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1012581212 6:100872611-100872633 AGCAATCTGCTTCCTTCAGAAGG - Intronic
1012882008 6:104801706-104801728 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
1013627958 6:111956487-111956509 TTTCCTCTGCTTCATTCAGCTGG + Intergenic
1013801336 6:113948850-113948872 TGTACTCTGCATTTTTCATGGGG - Intronic
1013852763 6:114535302-114535324 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1014304947 6:119728184-119728206 ATCACTCTGCTTCCTTCAGAGGG + Intergenic
1014603767 6:123447856-123447878 AGCAGTCTGCTTCCTTCAGAGGG - Intronic
1014978194 6:127915529-127915551 TGTACTCTGCTTGGGGCAGGAGG + Intronic
1015222191 6:130816985-130817007 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1018665682 6:166135372-166135394 AGCAATCTACTTCCTTCAGGGGG - Intergenic
1019612841 7:1945674-1945696 TGTATTCTGCTGCTTTCTGGAGG + Intronic
1020168720 7:5827947-5827969 TGTACTCTGCCACCTTGTGGTGG + Intergenic
1020860657 7:13488877-13488899 AGCAGTCTGCTTCCTTCAGGGGG - Intergenic
1021847095 7:24774013-24774035 TTTACCCTGCTTCCTTTAGGAGG + Intergenic
1022668933 7:32437373-32437395 TGGAATCTGCTTCCTTCATTTGG + Intergenic
1023301743 7:38780411-38780433 TGCATTCTGCTTTATTCAGGAGG + Intronic
1023472830 7:40543212-40543234 TGATCTCTGCTTCCTACAGCAGG - Intronic
1027295249 7:76763507-76763529 AGTAGTCCGCTTCCTTCAGAGGG - Intergenic
1027328988 7:77071403-77071425 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1027350591 7:77307065-77307087 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
1027417788 7:77990921-77990943 AGCAGTCTGCTTCCTTCAAGAGG + Intergenic
1027820534 7:83037498-83037520 TGTACTCTACTTTTTTCAGATGG + Intronic
1027989928 7:85345237-85345259 TGAACACTGCTTCCTTTAGTGGG + Intergenic
1028962290 7:96762117-96762139 AGCAGTCTGCTTCCTTCAGAAGG + Intergenic
1029786783 7:102799975-102799997 AGCAATCTGCTTCCTTCAGAGGG - Intronic
1030081786 7:105784706-105784728 GGTACTCTGCCTGCCTCAGGGGG - Intronic
1030390460 7:108921056-108921078 AGCACTCTGCTTTCTTCAGAGGG + Intergenic
1030435219 7:109509262-109509284 TGTACTTTGCTTTCTTCCAGTGG + Intergenic
1030958237 7:115882257-115882279 AGTACTGTGCTTTATTCAGGTGG + Intergenic
1031739982 7:125418079-125418101 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1033427569 7:141258545-141258567 TGTGCTCTGTTTTCTTCATGTGG + Intronic
1034426609 7:151017355-151017377 TGTGGTCTGTTTCCTTCACGTGG - Intronic
1035043189 7:155945826-155945848 TTTACTCTGCTTCATTCAGAAGG + Intergenic
1035252857 7:157608471-157608493 CGGACTCTGATTCCTGCAGGGGG + Intronic
1035312673 7:157979705-157979727 TGTATTCTGCTCTCTGCAGGGGG + Intronic
1035886036 8:3292981-3293003 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
1035980242 8:4362279-4362301 TGGACTCCTCCTCCTTCAGGTGG + Intronic
1036987027 8:13544922-13544944 AGTACTCTGCCACCTTCAGGGGG + Intergenic
1037882935 8:22581677-22581699 TGGGCTCTGCTTCCTGCAGCAGG + Intronic
1038377943 8:27061998-27062020 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1039095671 8:33881580-33881602 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1039810630 8:41044652-41044674 AGTAATCTTCTTCCTTCAGAGGG + Intergenic
1040442809 8:47462332-47462354 AGCAATCTGCTTCCTTCAGAGGG + Intronic
1041717281 8:60943668-60943690 TCCATGCTGCTTCCTTCAGGAGG + Intergenic
1041878113 8:62713099-62713121 AGCAGTCTGCTTCCTTCAGAGGG + Intronic
1042086931 8:65119944-65119966 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1042123011 8:65508090-65508112 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1043040660 8:75258953-75258975 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1043187817 8:77177348-77177370 AGAAATCTGCTTCCTTCAGTTGG - Intergenic
1043729148 8:83652242-83652264 TTTACTCTGCTTTCATGAGGTGG - Intergenic
1043817012 8:84813287-84813309 AGCACTCTGCCTCCTTCAGAGGG + Intronic
1044279015 8:90335148-90335170 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1044550501 8:93506889-93506911 TGTGCTCTGCATCCATCATGTGG + Intergenic
1044907117 8:97017017-97017039 AGTAATCTGCTTCCTTCAGAGGG - Intronic
1044928668 8:97231280-97231302 TGAATTCTGCATCCTTCAGGAGG - Intergenic
1045417819 8:101984691-101984713 TGTACTCCGCTTGCTTCAAATGG - Intronic
1045779246 8:105844811-105844833 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1045792295 8:105997447-105997469 TTTAATCTCCTTCCTTCTGGGGG + Intergenic
1046115058 8:109775091-109775113 TGTTTAGTGCTTCCTTCAGGTGG + Intergenic
1046498334 8:115043062-115043084 AGTAGTCTGCTTTCTTCAGAGGG - Intergenic
1048466595 8:134669589-134669611 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
1048467256 8:134675931-134675953 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
1048491501 8:134897885-134897907 TGTACTCAACTTGCTTCTGGTGG + Intergenic
1048650271 8:136468322-136468344 TGAACAGTGCTTCCTTCACGAGG - Intergenic
1048907913 8:139105975-139105997 TGTACTCTACTTCCTGCACTTGG + Intergenic
1049291969 8:141808274-141808296 TGTGCTCTTACTCCTTCAGGAGG + Intergenic
1049515085 8:143050092-143050114 TGGACTCTGCGCCCTGCAGGTGG + Intronic
1049615668 8:143574897-143574919 TGTCCTCTGCTCCCTGCAGGTGG - Exonic
1050071794 9:1822806-1822828 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1050083017 9:1935215-1935237 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1051452599 9:17214209-17214231 TGTTTAGTGCTTCCTTCAGGAGG + Intronic
1052165132 9:25317334-25317356 TGTTTACTGCTTCCTTTAGGAGG + Intergenic
1054744013 9:68836041-68836063 TGTACTCTCTGTCCTTCAAGAGG - Intronic
1055905956 9:81293165-81293187 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1056590030 9:87959417-87959439 AGGACTCTGCCTCCTTCAAGAGG + Intergenic
1056829956 9:89908065-89908087 TGTTTATTGCTTCCTTCAGGAGG - Intergenic
1057891532 9:98873709-98873731 TTTTCTCTGCTTCCTTCTGCTGG + Intergenic
1058128317 9:101221697-101221719 TGTGTACTGCTTCCTGCAGGTGG - Intronic
1058156803 9:101524842-101524864 AGTAGTCCGCTTCCTTCAGAGGG + Intronic
1059414287 9:114153889-114153911 TGTGCGCTGCTTCCTGCAGAGGG - Intergenic
1060194024 9:121611376-121611398 TGTACTCAGCTTCCTTGGGGTGG - Intronic
1060610538 9:124960349-124960371 TGTAATCTGAATACTTCAGGAGG - Intronic
1187197117 X:17098050-17098072 TCTATTATGCTTCATTCAGGTGG - Intronic
1187450049 X:19388019-19388041 TGTCCTCTCCTTCCTGCAGCTGG + Intronic
1187717984 X:22122788-22122810 TGTGTCCTGCTTCCTTCAGCCGG + Intronic
1188046037 X:25426802-25426824 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1188738115 X:33742654-33742676 AGTAGTCCGCTTCCTTCAGAGGG + Intergenic
1188911199 X:35849581-35849603 TGAACACTGCCTCCTTCAGAAGG - Intergenic
1189019444 X:37319366-37319388 TATATTCTGTTTCCTTCAGTAGG + Intergenic
1189704361 X:43744985-43745007 TGGAGGCTGCTTCCTCCAGGAGG - Exonic
1189879314 X:45472071-45472093 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1190448788 X:50557372-50557394 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1190834841 X:54090886-54090908 TGTGCTCTACTGCCTTCAGTGGG + Intronic
1190895608 X:54614791-54614813 TGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1190991291 X:55553249-55553271 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1191018996 X:55840489-55840511 AGCAATCTGCTTCCTTCAGAGGG + Intergenic
1191125793 X:56952894-56952916 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1191625358 X:63265231-63265253 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1191635305 X:63369396-63369418 TGTTTCGTGCTTCCTTCAGGAGG - Intergenic
1191647161 X:63494076-63494098 TGTTTTGTGCTTCCTTCAGGAGG - Intergenic
1191649510 X:63521100-63521122 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1191681102 X:63840614-63840636 TGTGTAGTGCTTCCTTCAGGAGG - Intergenic
1191687051 X:63902828-63902850 TGTGTAGTGCTTCCTTCAGGAGG + Intergenic
1191787953 X:64936760-64936782 TGTTTAGTGCTTCCTTCAGGAGG - Intronic
1192878117 X:75253686-75253708 GGCAATCTGCTTCCTTCAGAGGG - Intergenic
1192932004 X:75816164-75816186 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1193033701 X:76926344-76926366 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1193059182 X:77186438-77186460 TGTTTAGTGCTTCCTTCAGGAGG - Intergenic
1193062637 X:77222809-77222831 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1193779776 X:85686931-85686953 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1194237069 X:91398500-91398522 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1194508882 X:94767728-94767750 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1195075690 X:101325670-101325692 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1196555417 X:117079401-117079423 TGTTATCTGCCTCCTTCATGGGG - Intergenic
1196675883 X:118419551-118419573 AGCATTCTGCTTCCTTCAGAGGG + Intronic
1196948404 X:120850973-120850995 AGCAATCTGCTTCTTTCAGGGGG + Intergenic
1197132263 X:123019435-123019457 AGCAGTCTGCTTCCTTCAGAGGG - Intergenic
1197157129 X:123283039-123283061 TGTACCCAGCTTACTTCATGGGG + Intronic
1197372240 X:125639359-125639381 TGGACTCTTCTTCATTCAAGGGG + Intergenic
1197463293 X:126770930-126770952 AGCAATCTGCTTCCTTCAGGGGG - Intergenic
1197572287 X:128163879-128163901 AGTAATCTGCTTCCTTCAAAGGG + Intergenic
1197957019 X:131962389-131962411 TGTTTAGTGCTTCCTTCAGGAGG + Intergenic
1198189877 X:134292039-134292061 TGTATTCTGCTGCCATCAGATGG + Intergenic
1198582939 X:138086976-138086998 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1201315685 Y:12643486-12643508 AGCAATCTGCTTCCTTCAGAGGG - Intergenic
1201682288 Y:16660400-16660422 AGCAGTCTGCTTCCTTCAGAGGG + Intergenic
1201856916 Y:18554821-18554843 TCTCCTCTGCTTTCTCCAGGAGG + Intronic
1201876405 Y:18765559-18765581 TCTCCTCTGCTTTCTCCAGGAGG - Intronic