ID: 959040286

View in Genome Browser
Species Human (GRCh38)
Location 3:101414520-101414542
Sequence CAGGTGAAGCAGCAGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 3, 1: 0, 2: 3, 3: 51, 4: 529}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959040281_959040286 12 Left 959040281 3:101414485-101414507 CCAAAGATTCAATAGCTGCTGGG 0: 1
1: 4
2: 0
3: 11
4: 145
Right 959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG 0: 3
1: 0
2: 3
3: 51
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959040286 Original CRISPR CAGGTGAAGCAGCAGCTGGA CGG Intronic
900034259 1:393815-393837 CAGGTGAAGCAGCAACCATAAGG + Intergenic
900055094 1:623707-623729 CAGGTGAAGCAGCAACCATAAGG + Intergenic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900508940 1:3049062-3049084 CAGGGGAAGGAGACGCTGGATGG + Intergenic
901691502 1:10976292-10976314 TAGATGAGGCAGCAGCTGGGCGG - Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902123102 1:14184509-14184531 GAGCGGAAGCAGCAGCAGGAGGG + Intergenic
903825813 1:26145153-26145175 CAGGTGAAACAGCAGCTCTGAGG + Intergenic
903834070 1:26191351-26191373 CAGGGCCAGCAGCAGTTGGAAGG - Exonic
905522204 1:38608823-38608845 CAGCTGAAGCAGCAGCCAGTAGG - Intergenic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906791242 1:48660284-48660306 CAGGTGCATCAGCAGCTCGGCGG + Intronic
907327976 1:53653235-53653257 CTGGTAAAGAAGCAGATGGATGG + Intronic
907634162 1:56116829-56116851 CAGGTGAAGAAACAGCAGGAAGG + Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
907734365 1:57097415-57097437 CAGGAGAAGAAGGAGCTGGAGGG + Intronic
907904976 1:58776314-58776336 CAGGTGAAGAATCAGCATGAAGG - Intergenic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
910599134 1:89011834-89011856 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910603503 1:89056941-89056963 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910608517 1:89114103-89114125 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910621908 1:89264773-89264795 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910637215 1:89422175-89422197 CAGGTCCAGCAGCTCCTGGAGGG - Intergenic
914747744 1:150512078-150512100 CAGGTGAGGCCAGAGCTGGACGG - Intronic
914959932 1:152196580-152196602 CAGGTGGGGCGGCTGCTGGACGG + Intergenic
915116892 1:153607014-153607036 CAGATGAAGAGGCAGCTGGAGGG + Exonic
916348920 1:163826772-163826794 CAGGTGATATAGCAGCTGAAAGG - Intergenic
916686571 1:167152563-167152585 CTGGTGAAGCAGCAAAGGGATGG - Intergenic
917478105 1:175386141-175386163 CAGGGGAGGCTGCAGCCGGAAGG + Exonic
917725734 1:177825491-177825513 CAGAGGAAGCAGCCGCTGGTTGG - Intergenic
918860984 1:189826064-189826086 TTGGTGAAGCAGCAGCACGATGG - Intergenic
919657125 1:200208160-200208182 CATGTGAAGAAGCAGCAAGAAGG + Intergenic
920730819 1:208482508-208482530 CTGGTTATACAGCAGCTGGATGG + Intergenic
921079239 1:211725491-211725513 GAGGTAAAGTAGCAACTGGAAGG - Intergenic
921583922 1:216926185-216926207 CTGCGGAAGCAGCAGCTCGAGGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
922155827 1:223039103-223039125 CAGATGAAGCAGCAGGTAGTGGG + Intergenic
922256615 1:223898012-223898034 CAGGTGAAGCAGCAACCATAAGG + Intergenic
922449288 1:225723800-225723822 CTGTTGAAGCATCAGCTGGGAGG + Intergenic
923175802 1:231463739-231463761 CAGGTGAGGTCCCAGCTGGAAGG + Intergenic
923591745 1:235326954-235326976 CAGGTTCAGCTGCACCTGGAGGG + Exonic
923603915 1:235426188-235426210 CAGGTGCAGCACCATCAGGAAGG - Intronic
923628500 1:235633822-235633844 TGGGTGAAGAAGCAGCTGGATGG + Intronic
923716017 1:236425355-236425377 CAAGGGAAGCAGCAGCTGAGGGG + Intronic
924337820 1:243000865-243000887 CAGGTGAAGCAGCAACAATAAGG + Intergenic
1062771622 10:105427-105449 CAGCTGCAGCTGCACCTGGAAGG + Intergenic
1062895746 10:1101863-1101885 CAGGACAAGGGGCAGCTGGATGG - Intronic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1063823365 10:9863832-9863854 CATGTGAAGCGGCAACAGGAGGG + Intergenic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1065045476 10:21744482-21744504 CATGTGAACCAGCAGCTGCCAGG - Intergenic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065874391 10:29984187-29984209 CAGGTGAGCCAACAGGTGGAGGG + Intergenic
1065997292 10:31070808-31070830 GAGGTGAGGCATGAGCTGGAAGG + Intergenic
1066745980 10:38604469-38604491 CGGCTGGAGCAGCAGCTGGCGGG + Intergenic
1068033986 10:51737250-51737272 CATGTGAAGCAGTAGCTATATGG - Intronic
1069587692 10:69619497-69619519 CATGTGAAGATGCAGCAGGAAGG - Intergenic
1070686137 10:78483820-78483842 CAGGGGAGGAAACAGCTGGAGGG + Intergenic
1070768875 10:79070852-79070874 CGGGGGAAGGAGCAGCGGGAGGG - Intronic
1071162798 10:82770657-82770679 CAGGTTAAGCAGCATCAGAATGG + Intronic
1072276486 10:93828381-93828403 CAGCTGAGGCAGGAGCTGAAGGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1073085457 10:100885565-100885587 CAGGTCTAGTACCAGCTGGAAGG + Intergenic
1074917180 10:117968739-117968761 AAAGTGAAGCAACAGCTGGCGGG - Intergenic
1076586298 10:131550287-131550309 GAGCTGAAGCCCCAGCTGGAAGG - Intergenic
1076752301 10:132549638-132549660 CAGGTGAAGCAGGAGCAGACAGG + Intronic
1076888960 10:133274776-133274798 CAGGTCCGGCAGCTGCTGGAAGG - Intronic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077469156 11:2748696-2748718 GAGGGGCAGCAGCAGCTGGCTGG - Intronic
1077483272 11:2826528-2826550 TCGGGGAAGCAGCAGCAGGAGGG - Intronic
1077506440 11:2931882-2931904 CAGGTGGGGCAGGAGCTGGGAGG + Intergenic
1077541780 11:3150092-3150114 CAGGGGAAACAGCTGCTGGTTGG - Intronic
1077556453 11:3228332-3228354 CAGGTGCAGCAGCAGGCAGAGGG + Exonic
1077592188 11:3500673-3500695 CAGCGGTAGCAGCAGCTGGAGGG + Intergenic
1077971562 11:7197727-7197749 CTGTTGGAGAAGCAGCTGGAAGG - Intergenic
1078508323 11:11967984-11968006 CAGGGGAAGCAACAGGTGTAGGG + Intronic
1079380595 11:19934042-19934064 CAGCAGAAGCCCCAGCTGGACGG + Exonic
1079882444 11:25944307-25944329 CTGGTGCAGCTGCAGCTGGAGGG - Intergenic
1080293851 11:30702630-30702652 GAAGTGGAGCAGCAGCAGGATGG + Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081620291 11:44615269-44615291 CAGCTGAAGCAGGAGATGGGCGG + Exonic
1081743510 11:45457295-45457317 CAGGAGAAACAGCAGCTGTAAGG + Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082084786 11:48041017-48041039 CAGGTGGAGGAGGAGCAGGAGGG - Intronic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082937774 11:58672276-58672298 AAGGTGAAGCAGGGACTGGAAGG - Intronic
1083151476 11:60794363-60794385 GAGGTCAAGCAGCAACTTGACGG + Intronic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083538644 11:63495169-63495191 GAGGTACAGCAACAGCTGGACGG - Intergenic
1083746398 11:64739462-64739484 CAGCTGTAGCAGCTTCTGGAAGG + Exonic
1083903873 11:65657592-65657614 CAGGTGGCCCAGCACCTGGAAGG - Intronic
1083940063 11:65890925-65890947 GAGGTGAATCGGCAGCTGCAGGG + Exonic
1084564315 11:69920669-69920691 CAGGGGATGCACCAGCTGCATGG + Intergenic
1084824796 11:71722079-71722101 CAGCGGTAGCAGCAGCTGGAGGG - Intergenic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1085932555 11:81101933-81101955 CAGAGGAAGTAGCAGATGGAAGG - Intergenic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1086592345 11:88530776-88530798 TAGGTGAAGTAGCAGATAGATGG + Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1087133852 11:94694660-94694682 CAGCTGGAGCAGCAGCAGCACGG + Intergenic
1089283521 11:117391180-117391202 CAGCTGAGGGAGCAGCTGGAAGG + Exonic
1089294564 11:117459866-117459888 CAGGGAAAGCAGCAGCTGCTGGG + Intronic
1089615821 11:119694212-119694234 CAGGGGAAGCAGGAGCTGGCAGG + Intronic
1090266892 11:125359004-125359026 GAGTTGAAGCTGCAGCTGGGTGG + Intronic
1090777329 11:129977012-129977034 CACGTGAAACAGCATCTGGGAGG - Intronic
1091258567 11:134214401-134214423 CAGATGAAGCTGTACCTGGAGGG + Intronic
1091332152 11:134738035-134738057 GAGGTGAGGCAGGAGCTGGTGGG + Intergenic
1091375588 12:22847-22869 AAGAGGGAGCAGCAGCTGGAGGG + Intergenic
1091391370 12:128326-128348 CTGGCGAAGAAGCTGCTGGAAGG + Intronic
1092418308 12:8308801-8308823 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
1093214134 12:16343274-16343296 CATGTGAGGAAGCAGCAGGAAGG + Intergenic
1096745173 12:53722119-53722141 CAGCTGAAGCTACAGCTGGAGGG - Exonic
1099672664 12:85715076-85715098 CAGGTGAAGACACAGCTAGAAGG - Intergenic
1100698263 12:97119025-97119047 GAGATGAAACAGCAGCTGGAAGG - Intergenic
1101506787 12:105354477-105354499 GAGCTGAAGTAGCTGCTGGAGGG + Intronic
1103238490 12:119394704-119394726 CAGGAGATGCAACAGCTGGAAGG - Intronic
1103293175 12:119863894-119863916 CAGGTGAAGATGCAGCAAGAAGG + Intronic
1104612451 12:130240905-130240927 GAAGTGGTGCAGCAGCTGGACGG - Intergenic
1104830502 12:131747622-131747644 CAGGAGGTGCTGCAGCTGGAGGG + Intronic
1105943266 13:25170073-25170095 CCGGAGAAGGAGCAGCAGGAAGG - Exonic
1106316456 13:28598646-28598668 CAAGTGAGGCAGAAGCTGCAAGG + Intergenic
1106689649 13:32100826-32100848 CATGTGAAGATGCAGCGGGAAGG - Intronic
1106717926 13:32410174-32410196 CAGGTGACGCAGCTGCCGCAGGG - Intronic
1106906602 13:34415894-34415916 GAGGAGACACAGCAGCTGGAAGG + Intergenic
1110429264 13:75404899-75404921 GAGGATAAGCAGCAGCTGGTGGG - Intronic
1110817235 13:79875770-79875792 CATGTGAAGGCACAGCTGGAAGG - Intergenic
1113229258 13:108194813-108194835 GAGCTGAGGCAGCAGGTGGATGG - Intergenic
1113399288 13:109976383-109976405 GAGGAGAGCCAGCAGCTGGAAGG - Intergenic
1113937724 13:114003242-114003264 CAGGTGGTGCAGCTGCTGGAAGG + Intronic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114241298 14:20870884-20870906 CAGCTGAAGCAGCAGCTAAGAGG + Intergenic
1115341341 14:32295958-32295980 CTGGTCAAGCAGTATCTGGAAGG + Intergenic
1115514875 14:34175097-34175119 CAGGTGCAGCAGCAGGTAAAGGG + Intronic
1115908375 14:38227162-38227184 GAGGTAGAGAAGCAGCTGGATGG - Intergenic
1117013168 14:51491322-51491344 CAAGAGAAGAAGCAGCTGTAAGG - Intronic
1117602734 14:57391192-57391214 CAGGAGCAGCAGCAGCTCAACGG + Exonic
1117745050 14:58860773-58860795 CAGGGGAAGTAGCTGCTGGTGGG + Intergenic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1119196477 14:72720498-72720520 CTGGCCAAGCAGCAGCTGAATGG - Intronic
1119712787 14:76835006-76835028 CAAGAGAAGTAGCAGGTGGAAGG - Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1121511553 14:94516509-94516531 CAGGTGCACCAGCAGGTGAAGGG + Intronic
1122126954 14:99584376-99584398 CAGGTGAGATAGCAGCTGGGAGG + Intronic
1122661341 14:103297599-103297621 CAGGGGAAGCCACAGCTGGGAGG + Intergenic
1122741289 14:103872804-103872826 CAGCTGAAGAAGGGGCTGGAGGG + Intergenic
1122924779 14:104894567-104894589 CGGGTGCAGAAACAGCTGGAAGG + Exonic
1123744695 15:23310817-23310839 CAGCTGAAGCAACAACAGGATGG - Intergenic
1124270097 15:28272350-28272372 CAGCTGAAGCAACAACAGGATGG + Exonic
1124904636 15:33857299-33857321 CAGGGGAAGCGGCAGCGAGAGGG - Intronic
1125707960 15:41757808-41757830 CAGATGAAAAAGCAGCTGAAAGG + Exonic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127570619 15:60237565-60237587 CCTGTGATGCTGCAGCTGGATGG + Intergenic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1129184598 15:73898173-73898195 CTGGTGAAGCAGCAGCTCCCTGG - Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1130395162 15:83494980-83495002 CAAGGGAAGGAGCATCTGGAAGG - Intronic
1130904035 15:88227529-88227551 CAGGTGAAGGGGCAGCAAGAAGG + Intronic
1131026761 15:89149499-89149521 GAGGTGAATGAGCAGCAGGAGGG + Intronic
1131510434 15:93046876-93046898 CTGCTGGAGCAGCAGCTGGCTGG + Intronic
1131564536 15:93473778-93473800 CAGGTGAAGAACCAGTTTGAGGG - Intergenic
1132397140 15:101482309-101482331 CAGGAGAAACATCAGCTGGTGGG + Intronic
1132571876 16:647791-647813 CAGGTGCAACAGCAGCTGGATGG + Exonic
1132731991 16:1367213-1367235 CAGCTGCAGGAGGAGCTGGAGGG - Intronic
1132875952 16:2137274-2137296 CAGGTCACACAGCAGGTGGATGG + Intergenic
1132890273 16:2200287-2200309 CAGGTGGAGCCCCAGCAGGATGG + Intergenic
1133040022 16:3055839-3055861 CAGCTGGAGCAGGAGCTGGCAGG + Intronic
1133043892 16:3075666-3075688 CAGCTGGAGCAGGAGCTGGCAGG + Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134093506 16:11404002-11404024 CATGTGGAGCAGCAGCTGCGGGG - Intronic
1134507627 16:14821006-14821028 CAGGCAAAGCAGCAGCTGGGAGG + Intronic
1134695325 16:16219768-16219790 CAGGCAAAGCAGCAGCTGGGAGG + Intronic
1134976507 16:18574918-18574940 CAGGCAAAGCAGCAGCTGGGAGG - Intergenic
1136705095 16:32180720-32180742 CAGCTGAAGCAACAACAGGATGG + Intergenic
1136737082 16:32475175-32475197 CGGCTGGAGCAGCAGCTGGTGGG - Intergenic
1136762817 16:32748685-32748707 CAGCTGAAGCAACAACAGGATGG - Intergenic
1136805283 16:33121701-33121723 CAGCTGAAGCAACAACAGGATGG + Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1138190669 16:55011061-55011083 CAGCTGGAGCAGCTGCAGGATGG + Intergenic
1138735886 16:59249412-59249434 CGGGTGAAGGAGGAGCTGGGGGG - Intergenic
1139244310 16:65426504-65426526 CAGGTGAAGCAACTGCCTGAAGG + Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139598023 16:67969150-67969172 CAGGAGAGGCTGCAGCTAGAGGG - Intronic
1141608706 16:85169660-85169682 CAGGTGAAGCAGCCGGCGGCGGG + Intergenic
1142132539 16:88437516-88437538 CAGGTGGCGCTGCAGCTTGAAGG - Exonic
1203015989 16_KI270728v1_random:354402-354424 CGGCTGGAGCAGCAGCTGGCGGG + Intergenic
1203034324 16_KI270728v1_random:627560-627582 CGGCTGGAGCAGCAGCTGGCGGG + Intergenic
1203064973 16_KI270728v1_random:1009005-1009027 CAGCTGAAGCAACAACAGGATGG - Intergenic
1142766286 17:2066027-2066049 CAGGGTATGCAGCAGCTCGAGGG + Intronic
1143114873 17:4576729-4576751 TAGGGGAAGCGGCAGCTTGATGG + Intergenic
1143288893 17:5813683-5813705 CAGCTGGAGGAGCAGTTGGAAGG - Intronic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1144458279 17:15436758-15436780 CAGGTCCAGGAGCAGCTGGATGG + Exonic
1144505134 17:15822969-15822991 CAGGTGGAGTAGAAGCTTGAGGG - Intergenic
1144781276 17:17809782-17809804 AAGGTGAAGGTGAAGCTGGACGG + Intronic
1145764902 17:27451893-27451915 CAGGAGCAGCAGCAACTGTATGG - Intergenic
1146170841 17:30631752-30631774 CAGCTGAAGAAGCATCTGTAGGG + Intergenic
1146344288 17:32047758-32047780 CAGCTGAAGAAGCATCTGTAGGG + Exonic
1146448414 17:32951925-32951947 GAGCTGGAGCTGCAGCTGGAGGG + Intergenic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146830507 17:36065073-36065095 TAGGAGAAGCAGCAGATGCATGG - Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1148484657 17:47982862-47982884 CAGGTGGGGCAGGAGCTAGAAGG - Intergenic
1148818704 17:50347768-50347790 CAGGTGAGGGAGCAGCTGAGGGG - Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149497131 17:57126129-57126151 CAGGTGAGGGAGAAGCTGCATGG + Intergenic
1149518281 17:57297725-57297747 TAGGTGAAAAAGCAGCTGCAGGG - Intronic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1150401570 17:64860954-64860976 CAGCTGAAGAAGCATCTGTAGGG - Exonic
1150781679 17:68128262-68128284 CAGGTGAAGAAGCATCTGTAGGG - Intergenic
1152008254 17:77695680-77695702 CAGGTGAAGCAGCAGCAGATTGG - Intergenic
1152120424 17:78415005-78415027 CTGGTGAAGCTGCTGCTGCAGGG - Exonic
1152546455 17:81002535-81002557 CATGTGATGACGCAGCTGGACGG - Intronic
1152681868 17:81672633-81672655 CAGCGGCAGCAGCAGCTGCACGG + Exonic
1152694043 17:81734919-81734941 CAGGGGAAGCAGCTGCAGGCAGG + Intergenic
1203169605 17_GL000205v2_random:135760-135782 CAGGTGCAGCAGCTGCTGTCTGG - Intergenic
1153763646 18:8354874-8354896 GAGATGAAGCAGCACCTAGAAGG + Intronic
1155086884 18:22467597-22467619 CAGTTGCAGGAGCAGCAGGAGGG + Intergenic
1155101592 18:22615822-22615844 GAGATGAAGCAGCTGCTGGTTGG - Intergenic
1156547830 18:37983156-37983178 GTTGCGAAGCAGCAGCTGGAAGG + Intergenic
1157537609 18:48471564-48471586 CAGTTGCAGCACCAGTTGGAAGG - Intergenic
1157980718 18:52376960-52376982 CAGATGTAGCCGCTGCTGGAAGG - Intronic
1159874952 18:73800626-73800648 CAGCAGAGGCAGCAGCTGGACGG + Intergenic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160893092 19:1389719-1389741 CAAGTGCCGCAGGAGCTGGAGGG - Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161260502 19:3335342-3335364 CAGGAGAAGGAGCTGCTGGTGGG + Intergenic
1161574128 19:5046479-5046501 CAGGTGCAGGAACAGCTGGTGGG + Intronic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162379498 19:10323176-10323198 GGGGTTGAGCAGCAGCTGGAGGG + Exonic
1162529757 19:11229105-11229127 CAGGGGAAGATGCAGCTGGAGGG + Intronic
1162907670 19:13833292-13833314 CAGGTGTTGGTGCAGCTGGATGG + Intergenic
1162958384 19:14112408-14112430 CAGCTGCAGCCACAGCTGGAAGG + Intronic
1163364734 19:16869614-16869636 CTGGTGCAGCAGCTGGTGGATGG - Exonic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1164057393 19:21633291-21633313 CAGATGATCCAGCAGCAGGACGG + Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166978852 19:46621144-46621166 CAGGAGAAACAGCAGCTGATCGG + Exonic
1167246434 19:48375892-48375914 CAGAGGAAGCGGCACCTGGAAGG - Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167571905 19:50293577-50293599 GAGGAGAAGCGTCAGCTGGAGGG + Exonic
1167648769 19:50718945-50718967 AAGGAGAAGCGGGAGCTGGAGGG + Intronic
1167818195 19:51903061-51903083 CAGATGAAGAGGCAGATGGAAGG + Intronic
1168110054 19:54187164-54187186 CAGCGTCAGCAGCAGCTGGACGG + Exonic
1168498446 19:56873683-56873705 AAGGTGAGCCAGCAGCTGGCAGG - Intergenic
1168498478 19:56874050-56874072 AAGGTGAGGCGGCAGCTGGCAGG - Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925372571 2:3357615-3357637 GAGGTGCAGAAACAGCTGGATGG - Intronic
925444595 2:3916700-3916722 CAGGTGAGGCAGCACCCGAATGG - Intergenic
925534336 2:4900501-4900523 CAGGGGCAGCAGAAGCTGGTGGG - Intergenic
926166483 2:10524433-10524455 GTGGAGGAGCAGCAGCTGGAGGG + Intergenic
926292150 2:11539761-11539783 CAGATGAAGCTCCAGTTGGAAGG + Intronic
927102897 2:19801468-19801490 CGCGTGCAACAGCAGCTGGATGG - Intergenic
927217429 2:20675934-20675956 CAGGAGGAACTGCAGCTGGATGG - Intergenic
927240979 2:20919316-20919338 CAGCTCAAGCAGCAGCTGCTGGG - Intergenic
927266993 2:21162556-21162578 CAGCTGCAGCTGCACCTGGAAGG + Intergenic
927481830 2:23459977-23459999 CAGGTAGAGGAGAAGCTGGAAGG + Intronic
927576764 2:24207381-24207403 CAGGAGGAGCTGCTGCTGGAAGG + Intronic
927661984 2:25001089-25001111 CAGGTGCAGCTGCAGGTGGGGGG - Intergenic
928233208 2:29517902-29517924 CAGGTGAAGGAGGAGATGAAGGG - Intronic
928606406 2:32947796-32947818 CACCAGAAGCAGCAGCTGCAGGG + Exonic
928653116 2:33422592-33422614 CATGTGAAGATGCAGCAGGAAGG + Intergenic
928694603 2:33836582-33836604 CCTGTGGACCAGCAGCTGGAGGG - Intergenic
929326741 2:40621775-40621797 CAGGTAAAGCAGTAGCTAAAAGG + Intergenic
929454789 2:42058059-42058081 CATGTGCAGCAGCAGCAGCAGGG - Exonic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930108019 2:47655274-47655296 CAAGCAAAGCAGCAGCTGGAAGG - Intergenic
930570317 2:53077820-53077842 AAGGTGGAGCAGCAACTGGGAGG - Intergenic
932603292 2:73145150-73145172 CAGGTGCAGGAGAAGCTTGAGGG - Intronic
933946395 2:87289592-87289614 CACGTGGAACAGCAGGTGGAGGG - Intergenic
934188222 2:89764293-89764315 CAGCTGGAGCAGCAGCTGGTGGG - Intergenic
934308384 2:91843661-91843683 CGGCTGGAGCAGCAGCTGGCGGG + Intergenic
935356180 2:102202093-102202115 CAGGGGAGGCCTCAGCTGGAAGG - Intronic
936023166 2:109010853-109010875 GAGGCTCAGCAGCAGCTGGATGG + Intergenic
936333800 2:111571949-111571971 CACGTGGAACAGCAGGTGGAGGG + Intergenic
936400277 2:112159715-112159737 CAGCTGCAGCAGCTGCTGAAGGG + Exonic
937038679 2:118803824-118803846 CTGGGGAAGGAGCAGCGGGAGGG - Intergenic
937278542 2:120702034-120702056 TAGGAGGAGAAGCAGCTGGAAGG - Intergenic
937285104 2:120745779-120745801 CAGGTGAACCAGCTGCAGGGTGG - Intronic
937376334 2:121338355-121338377 CAGGGGAGGCAGCAGCTTGGAGG + Exonic
940046647 2:149416818-149416840 CAGGTGAAGCACCAGCTAGGAGG - Intronic
941732143 2:168930502-168930524 CAGGTGAAGCAGCAAATGACTGG + Intronic
943004324 2:182371081-182371103 CATCCAAAGCAGCAGCTGGATGG + Intronic
943252847 2:185551319-185551341 CAGGTGAAGCAGGTGCTTTAAGG + Intergenic
944621822 2:201523283-201523305 AAGGTTAAGCATCTGCTGGAGGG - Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944881672 2:204018988-204019010 AGGGTGCAGCAGCATCTGGAGGG + Intergenic
945299275 2:208200665-208200687 CAGTTGTAGCTGCAGATGGATGG + Intergenic
946247661 2:218396700-218396722 CAGCTGAAGGAGGAGATGGATGG + Exonic
948356841 2:237384847-237384869 CTGGAGAAGCAGCTGCTGTAGGG - Intronic
948398851 2:237668069-237668091 CAGGAGGAGCAGCTGCTGGCAGG - Intronic
948458488 2:238118207-238118229 CAGATGGAGCAGCAGATGGATGG + Intronic
948817583 2:240520491-240520513 CCGGCGCAGCAGCAGCTTGATGG + Exonic
948829171 2:240589391-240589413 CAGGTGAAGCAGGGGCTGCTGGG + Exonic
948897856 2:240935511-240935533 CAGCGGCAGGAGCAGCTGGAGGG + Intronic
1169197008 20:3688759-3688781 CAGGTGAATCAGCTGCAGAAGGG + Intronic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1169977668 20:11348423-11348445 AAGGAGAAGCAGCAGCTGCCAGG - Intergenic
1170030127 20:11935788-11935810 CAGGTCTTGCAGCAGCTGAAAGG + Intergenic
1171311502 20:24148804-24148826 CAGCTGATGCAGCAGTTGGCTGG + Intergenic
1171502351 20:25603605-25603627 CAAGCTAAGCTGCAGCTGGAGGG + Intergenic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1172061448 20:32189905-32189927 GAGGTGGAGAAGCAGCAGGAGGG - Intergenic
1172301952 20:33856640-33856662 CAGGTGAAGGAAAAGCTGGCGGG - Intergenic
1172511398 20:35503629-35503651 CAGCTGGAGCAGCAGCTCCAGGG + Exonic
1172637386 20:36419062-36419084 GAGGAGAAGCAGCAGCTCAATGG - Intronic
1173156505 20:40616916-40616938 CAGCTGAAGGAGCAGAAGGAAGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173720616 20:45254499-45254521 CAGGGCAAGCAGCACCAGGAAGG + Exonic
1173809628 20:45948095-45948117 CATGAGAAGGAGCTGCTGGAGGG - Intergenic
1175203001 20:57290848-57290870 CAGGTGGAGCAGCAGCAGGCTGG - Intergenic
1175400363 20:58696676-58696698 CGAGTGACGCAGGAGCTGGAAGG - Intronic
1175784673 20:61705060-61705082 GATGGGAAGCAGCAGCTGGCTGG - Intronic
1175789170 20:61730986-61731008 CAGGGGAAGGAGCAGCTGAGGGG + Intronic
1176332099 21:5558607-5558629 CAGGTGCAGCAGCTGCTGTCTGG + Intergenic
1176395658 21:6262344-6262366 CAGGTGCAGCAGCTGCTGTCTGG - Intergenic
1176402150 21:6323389-6323411 CAGGTGCAGCAGCTGCTGTCTGG + Intergenic
1176435007 21:6665715-6665737 CAGGTGCAGCAGCTGCTGTCTGG - Intergenic
1176441499 21:6726760-6726782 CAGGTGCAGCAGCTGCTGTCTGG + Intergenic
1176459269 21:6992785-6992807 CAGGTGCAGCAGCTGCTGTCTGG - Intergenic
1176465761 21:7053829-7053851 CAGGTGCAGCAGCTGCTGTCTGG + Intronic
1176489322 21:7435607-7435629 CAGGTGCAGCAGCTGCTGTCTGG + Intergenic
1178767884 21:35471494-35471516 CATGTGGAGCAGGACCTGGAAGG + Intronic
1178772656 21:35520024-35520046 CACGTGAAGCAGCTGGTGAATGG - Intronic
1179349101 21:40590772-40590794 CAGGTGAAGCAGCATCTTAGAGG + Intronic
1179607722 21:42528274-42528296 CAGCTGGAGCAGCAGATAGAAGG - Intronic
1179886580 21:44316780-44316802 CAGGAGGAGCAACAGCTTGAGGG - Intronic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180535469 22:16390741-16390763 CGGCTGGAGCAGCAGCTGGCAGG + Intergenic
1180916859 22:19494817-19494839 CAGGGGGAACATCAGCTGGATGG - Intronic
1181308147 22:21928516-21928538 CAGCTGAAGGAGCAGCAGGTGGG + Intronic
1181788020 22:25241645-25241667 CAAGTGATGAAGCAGCTGGCTGG + Intergenic
1181819764 22:25466660-25466682 CAAGTGATGAAGCAGCTGGCTGG + Intergenic
1181968222 22:26671365-26671387 CCTCTGAAGCTGCAGCTGGAGGG + Intergenic
1182522418 22:30891999-30892021 GTGAAGAAGCAGCAGCTGGAGGG + Intronic
1182849142 22:33456829-33456851 CAGGTAATGAAGAAGCTGGAGGG + Intronic
1184011884 22:41755025-41755047 CAGGAGGAACAGCAGCTGCAGGG + Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1185412817 22:50694934-50694956 CCGCTGGAGCAGCAGCTGGTGGG - Intergenic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
950410812 3:12835510-12835532 TACCTGAAGCAGCAGCTGGTGGG + Exonic
951044337 3:18021602-18021624 CAGGTAGACCAGCAGCTGAAGGG + Intronic
952119391 3:30223819-30223841 CAGGTGAAGCAGCATGTGTCAGG - Intergenic
952278044 3:31896668-31896690 AAGCAGAAGCACCAGCTGGAAGG + Intronic
952587589 3:34911382-34911404 CAGCTGAAGCAGCTGCTTCAGGG + Intergenic
952752594 3:36837327-36837349 CAGGGTAGGCAGCATCTGGAGGG + Intronic
953450476 3:43001275-43001297 CAAGAAAAGCAGCAGCTGGAAGG - Intronic
953454187 3:43029119-43029141 CACCTGAAGCTGCTGCTGGAGGG - Intronic
953515171 3:43583738-43583760 TAGGTGCAGCAGCAGCTGTGGGG - Intronic
953530237 3:43734189-43734211 CAGGTGAGGAAGCAGCTGTTTGG - Intronic
954293839 3:49663382-49663404 CAGGCGCAGCCGCAGCTGCAAGG + Exonic
954330128 3:49885412-49885434 CAGAGCGAGCAGCAGCTGGATGG + Intergenic
954409611 3:50364723-50364745 CAGGAGGAGCAGCAGTTGCAGGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
955842231 3:63124747-63124769 CAGCTGCAGCAGCAGCTTGAAGG - Intergenic
955884023 3:63578369-63578391 CAGGTGAAGAAGTAGGTGTAAGG + Intronic
956168235 3:66412561-66412583 CAGGTGAAGCTGCAAAGGGAAGG + Intronic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
957956247 3:87191390-87191412 AAAGTGAAGCAACAGATGGAGGG - Intergenic
957970303 3:87375072-87375094 CAGCTGAAGCACCAGCTCAATGG - Intergenic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
959476243 3:106815487-106815509 CAGGGGACTCAGCATCTGGAGGG - Intergenic
961325975 3:126109588-126109610 CAGGTGAAGCAACGGCTGAGAGG + Intronic
961384624 3:126516605-126516627 CAGGTGGAGCGGGTGCTGGAGGG - Intronic
961535953 3:127570673-127570695 CATGTGCAGCAGCAGTGGGAAGG + Intergenic
961895992 3:130168015-130168037 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
963564103 3:146906147-146906169 CAGGTGAGGAAACAGCTAGAAGG - Intergenic
963596728 3:147337002-147337024 CAGGAGAAGCTGCAGCTGCATGG + Intergenic
963806067 3:149724282-149724304 CAGGTGAAGGAGCAGGTAGTTGG - Intronic
963836328 3:150061534-150061556 GAGATGAGGCAGCAGCTGGTTGG - Intergenic
963976046 3:151481381-151481403 CAGGTGCAGCAGCAGCAACATGG - Intergenic
964672527 3:159242381-159242403 GAGTTGAAGCAGCAGCTCCATGG + Intronic
964812900 3:160684713-160684735 CATGTGTAGCAGGAGGTGGAGGG - Intergenic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
966937843 3:184725577-184725599 CAGGGGAAGCTGCATCAGGACGG - Intergenic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967183474 3:186926840-186926862 CATGTGAGGCTGCAGCTAGAAGG - Intergenic
967217311 3:187221280-187221302 CAGGTGAAGGAACAGTTGAATGG + Intronic
967779412 3:193419379-193419401 CAGGGGCAGCAGCAACTGGGAGG - Intronic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
968831201 4:2933789-2933811 CAGGGGCAGCAGCAGCGTGAAGG + Exonic
968969857 4:3788160-3788182 CAGGAGGGGCAGGAGCTGGAGGG - Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969330950 4:6473091-6473113 CATGTGAAGAAGCTGGTGGAGGG + Intronic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
969746776 4:9078951-9078973 CGGCGGCAGCAGCAGCTGGAGGG - Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
970004700 4:11399568-11399590 CAGGATGAGCAGCAGCCGGATGG + Exonic
971222217 4:24718734-24718756 CAGTTGAAGCAGAAGCAAGAGGG + Intergenic
971803024 4:31317310-31317332 CAGCTGATGCAGCAGCTTGAAGG - Intergenic
973010429 4:45065957-45065979 CAGGTGAAGCAGAAAATGCAAGG + Intergenic
973247484 4:48024754-48024776 CTGGTGAATCAGCAACTTGATGG - Intronic
975435547 4:74346646-74346668 CAGCTAAAAGAGCAGCTGGAAGG + Intergenic
977894857 4:102351933-102351955 CAGGTGAAACAGCAGCATAAAGG - Intronic
979239319 4:118434467-118434489 CAGGTGAAGCAGCAACCATAAGG - Intergenic
979577622 4:122313670-122313692 CAGGACAAGCAGCAGCTGGTAGG + Exonic
979846715 4:125522846-125522868 AAGTCGAAGAAGCAGCTGGACGG + Intergenic
980101116 4:128542542-128542564 CAGGTGAGGAAGCAGCAAGAAGG - Intergenic
981497657 4:145411918-145411940 CAGGTGAAGAGGCAGCAAGAAGG + Intergenic
981938524 4:150257987-150258009 CTTATGAAGCAGCAGCAGGAAGG + Intergenic
982219724 4:153114207-153114229 TAGGTGAAGAAGCAGAAGGAAGG - Intergenic
982243169 4:153321038-153321060 CAGGTGAGGAAACAGCAGGAAGG - Intronic
982287359 4:153748986-153749008 CTGGAGAAGGAGCAGCTGGGAGG + Intronic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
982560457 4:156923214-156923236 CTGGTGAAGGAGCAGCAAGAAGG - Intronic
983524709 4:168749178-168749200 AAGGTGAAGCAGGAGCAGGCAGG - Intronic
983871114 4:172826303-172826325 CAGGTGCTGCAACAGCTGAACGG - Intronic
984521045 4:180801294-180801316 CTTGAGAAACAGCAGCTGGAAGG + Intergenic
985067730 4:186139494-186139516 CATGTGAAGACACAGCTGGAAGG + Intronic
985341467 4:188959219-188959241 CAGCCAAAGCAGCAGCAGGAAGG - Intergenic
985520400 5:371519-371541 CAGGTGCAGCAGGGGCTGGCAGG + Intronic
985738729 5:1601819-1601841 CAGGTGGAGCTGCAGCTCCAGGG - Intergenic
985760194 5:1745001-1745023 CCTGGGAAGCAACAGCTGGAGGG + Intergenic
985774796 5:1835266-1835288 CAGGTGTGGCAGCAGCTGACGGG + Intergenic
985991279 5:3563900-3563922 CAGGTGATCCAGCACTTGGAGGG - Intergenic
990684346 5:58284619-58284641 CAGGTGGAGGAGCAGCTATATGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
996155057 5:120088681-120088703 CAAATGAAGCAGCAGCCAGAAGG - Intergenic
997628253 5:135346245-135346267 CAGATGAAGCAGCAATTTGAGGG - Intronic
997823601 5:137087251-137087273 CATGTGCAGCTGCATCTGGAAGG + Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
1000765765 5:165286807-165286829 CAGGTGTGCCAGCTGCTGGAGGG - Intergenic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001117283 5:168950216-168950238 CATGTGAGGAAGTAGCTGGAAGG + Intronic
1001951508 5:175819910-175819932 AAGGTGAAGAAGCAGCTACAAGG + Intronic
1002105639 5:176878253-176878275 CAGCTGGAGAAGCAGCTGGGGGG + Exonic
1002190664 5:177475815-177475837 CAGGGGCAACAGCAGCTGAAAGG - Intergenic
1002426977 5:179182222-179182244 CAGGCTAAGCAGCACCTGGCAGG + Intronic
1002739561 5:181425053-181425075 CAGGTGAAGCAGCAACCATAAGG - Intergenic
1002763791 6:222174-222196 GAGGTGCAGAAACAGCTGGATGG + Intergenic
1003045357 6:2728633-2728655 CAGCTGAGGCTGCAGCTGGGAGG + Intronic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1003276288 6:4655991-4656013 CACGTGAAGCAGAGGCTCGAGGG - Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1005021443 6:21423213-21423235 CAGCCGAAGAAGCAGCCGGAGGG - Intergenic
1005867752 6:29948953-29948975 CAGAGGAAGCAGTAGCTGGGTGG - Intergenic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006451015 6:34105706-34105728 CCAGGGGAGCAGCAGCTGGATGG - Intronic
1006867738 6:37222599-37222621 CAGGTGCAGCTGCAGCTGCCAGG - Intronic
1006956473 6:37877871-37877893 TAAGTGAAGCAGACGCTGGAAGG + Intronic
1006980638 6:38145128-38145150 TGGGTGGAGCAGGAGCTGGAGGG - Intronic
1007109440 6:39304475-39304497 CAGGTGAGGGGGCTGCTGGACGG - Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007410514 6:41658684-41658706 AAGGTGAAGCAGCAGGCTGAAGG + Intergenic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1008453301 6:51678529-51678551 CAGGTGAAGAAAATGCTGGAAGG + Intronic
1008531598 6:52466267-52466289 CAAGAGGAGCAGCCGCTGGAAGG - Intronic
1008891510 6:56497869-56497891 CAAAGGAAGCAGCAGCTGGATGG - Exonic
1009347178 6:62628113-62628135 CAGGTGAAGAGGTAACTGGAGGG - Intergenic
1009349491 6:62656463-62656485 CACGTGAAGATGCAGCTAGAAGG - Intergenic
1009992403 6:70860197-70860219 CAGATGAATCAGCAGATGGCTGG + Exonic
1010456775 6:76064764-76064786 CAGCTGAAGCAGAAGCTGATAGG - Intronic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1011000453 6:82582696-82582718 CATGTAAAGAAGCAGCAGGAAGG + Intergenic
1012412841 6:98979299-98979321 CAGGACAGGCAGCATCTGGAAGG - Intergenic
1013061410 6:106637648-106637670 CAGGAGAAGCAGCGGCTGCCAGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015772631 6:136784615-136784637 CACGTGAAGCAGTGGCTGAAAGG + Intronic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1018277181 6:162145622-162145644 TGGGTGAAGCAGCAGCTCAAGGG + Intronic
1019180109 6:170181378-170181400 CAGGTGAAGCAGGAGCTCAAGGG - Intergenic
1019244678 6:170700624-170700646 CAGGTGAAGCAGCAACCATAAGG - Intergenic
1019295259 7:270518-270540 CAGCTGAAGCTGGAGCTGGCAGG - Intergenic
1019334587 7:476978-477000 CAGGTGAAGCAGCCACGGGCAGG - Intergenic
1019727961 7:2613352-2613374 CAGCAGAGGCACCAGCTGGAGGG + Exonic
1019756947 7:2777619-2777641 CATGTGAGGAAGCAGCAGGAAGG + Intronic
1019914403 7:4123499-4123521 CGGGTGGAGCCACAGCTGGAAGG + Intronic
1019936431 7:4261272-4261294 CAGATGAGGGAGCAGCTGGCAGG + Intronic
1020120792 7:5502115-5502137 CCGGTGGAGCAGCTGCTGCAAGG - Intronic
1020326680 7:6979626-6979648 CGGCGGCAGCAGCAGCTGGAGGG + Intergenic
1020430599 7:8113020-8113042 CAGATAAGGCAGCAGCAGGAAGG - Intergenic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021951914 7:25783280-25783302 TAGGAGAAGCAGCAACTGGAAGG - Intergenic
1022036148 7:26536842-26536864 CAAGAGAAGCAGCAGTTGGCAGG + Exonic
1023200722 7:37694248-37694270 CAGGTGCAGCAGCAAGTGGGAGG + Intronic
1024536472 7:50438934-50438956 AACTTGAAGCAGCAGCTGTAAGG + Intergenic
1024674576 7:51626723-51626745 GAAGGGAAGCAGCAGCAGGAGGG - Intergenic
1025014514 7:55428073-55428095 CAGCTGAAGCGGCAGGAGGAAGG + Intronic
1026057276 7:66995613-66995635 CAGGTGGAGCAGAAGCCGGGAGG + Intronic
1026720838 7:72829438-72829460 CAGGTGGAGCAGAAGCCGGGAGG - Intergenic
1026952243 7:74355304-74355326 CAAGTGAATCAGAAGCTGGATGG + Intronic
1027924704 7:84446785-84446807 CATGTGGAGCAGCTGCTGCAAGG + Intronic
1028084708 7:86622020-86622042 GAGGTGCAGAAACAGCTGGATGG - Intergenic
1028127182 7:87126717-87126739 CAGCTGAAGCATCAGCTTGTAGG + Intergenic
1028640681 7:93039410-93039432 CAGCTGCAGCAGCACCTGGGAGG - Intergenic
1029465636 7:100722992-100723014 CAGCTGAGGCCGCATCTGGAGGG - Exonic
1031539020 7:122970714-122970736 ACGGTGCAGCAGGAGCTGGAGGG - Intergenic
1031652743 7:124311214-124311236 GAGGTGAAGCAGCTGATGAAAGG + Intergenic
1032513270 7:132488880-132488902 CAGATGATGCAGCAGCCAGAAGG + Intronic
1032905486 7:136359763-136359785 CAGGTGAGGGAGCAGGTGGTTGG + Intergenic
1033765622 7:144487184-144487206 CAGCTAAATCAGCAGCTGGCAGG + Intronic
1033808068 7:144977048-144977070 TAGGTGAAGCTCCAGCTTGAAGG + Intergenic
1034322868 7:150201227-150201249 CAGGTGGGGCAGCACCTGGGTGG - Intergenic
1034455057 7:151165602-151165624 CAGATAGAGCAGCAACTGGAAGG - Intronic
1034770317 7:153767896-153767918 CAGGTGGGGCAGCACCTGGGTGG + Intergenic
1035294773 7:157860844-157860866 CAGCTCAGGCAGCAGCTGGCCGG + Intronic
1035503449 8:107552-107574 CAGGTGAAGCAGCAACCATAAGG + Intergenic
1035673781 8:1440395-1440417 CAGGTGTAAAACCAGCTGGATGG + Intergenic
1036256123 8:7208131-7208153 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036361361 8:8079368-8079390 CAGGTGAAGAAGCAGGGAGAGGG - Intergenic
1036369940 8:8154301-8154323 CGGTGGCAGCAGCAGCTGGAGGG - Intergenic
1036462895 8:8969885-8969907 CAGTTGGAGCAGCAGCTCAAGGG + Intergenic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036880952 8:12511329-12511351 CGGTGGCAGCAGCAGCTGGAGGG + Intergenic
1036889613 8:12587655-12587677 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036920593 8:12850747-12850769 GAGGTGCAGAAGCAGCCGGATGG - Intergenic
1037729790 8:21514783-21514805 CAGTTGAAGCCCCAGCTGAAAGG - Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1038918116 8:32050273-32050295 TAGGTTAGGAAGCAGCTGGAAGG + Intronic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1039842287 8:41302800-41302822 CAGGAGAAGGAGGAGCTGGTGGG - Intronic
1039888395 8:41668573-41668595 CAGAAGAAGCAGCAGATGGCCGG + Intronic
1039914376 8:41848957-41848979 CAGGTCAAGCTCCAGGTGGATGG - Intronic
1040422920 8:47257521-47257543 CATGTGAAGATGCAGCAGGAAGG + Intergenic
1040843472 8:51809364-51809386 CACGCGAAGAAGCAGCCGGAGGG + Exonic
1041190546 8:55349473-55349495 CAGAGGATGCAGAAGCTGGAGGG - Intronic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041522419 8:58771005-58771027 GAGGTGAGGAAGCACCTGGAAGG + Intergenic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1043874068 8:85464562-85464584 CAGGTGGTGCTGAAGCTGGAGGG - Intronic
1044927892 8:97224641-97224663 CAGGTGGAGCAGCTGCAGGGAGG + Intergenic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1045721181 8:105112606-105112628 CATCTGCAGCAGCAGCTGGATGG - Intronic
1048008493 8:130438314-130438336 TAGGGGAAGAAGCAACTGGAGGG - Intronic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1049190722 8:141285949-141285971 CAGGAGAACCAGCAGCGTGAAGG + Intronic
1049199515 8:141333215-141333237 CAGGTGAAGGAGGAGATGGGTGG + Intergenic
1049291213 8:141803330-141803352 CATGTGAGGATGCAGCTGGACGG - Intergenic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049631598 8:143661548-143661570 CAAGTGAAGAAGGAGCAGGAAGG - Intergenic
1049631701 8:143662019-143662041 CAAGTGAAGAAGGAGCAGGAAGG - Intergenic
1049631738 8:143662178-143662200 CAAGTGAAGAAGGAGCAGGAAGG - Intergenic
1049631773 8:143662337-143662359 CAAGTGAAGAAGGAGCAGGAAGG - Intergenic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051229587 9:14941903-14941925 CAGGAGAATCTGCACCTGGAAGG + Intergenic
1051478932 9:17538915-17538937 CATGTGAAGAAGCAGCAAGAGGG - Intergenic
1051567386 9:18516058-18516080 GAGGTGAGGGAGGAGCTGGAGGG - Intronic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052438432 9:28461612-28461634 CAGCTGATGCATCAGCTGTAGGG - Intronic
1053281445 9:36822544-36822566 AAGGAGAAGCAGCTGCTGGCTGG + Intergenic
1054728423 9:68676292-68676314 CAGGAGAGGAAGCAGGTGGATGG - Intergenic
1055078010 9:72237106-72237128 CAGGTGGAGCAGGAGCATGAGGG - Intronic
1057250690 9:93499118-93499140 CAGATGAGGCAGCAGGTCGAGGG + Intronic
1057411730 9:94822255-94822277 AAGCTGAAACAGCAGCAGGAGGG + Intronic
1057653960 9:96937999-96938021 CAGGTAGAGCAGCAGAGGGAGGG + Exonic
1057881574 9:98796444-98796466 CGCGCGCAGCAGCAGCTGGAAGG + Exonic
1057995961 9:99821927-99821949 GAGGAGGAGCAGGAGCTGGAGGG - Exonic
1058285315 9:103169755-103169777 CCAGTGAGGCACCAGCTGGATGG - Intergenic
1058686871 9:107487939-107487961 TAGGTGAAGCTGCAGGTGGAGGG + Exonic
1059760034 9:117329054-117329076 CAGGTTAACCTGCAGCTGGAGGG + Intronic
1060411634 9:123404168-123404190 CAGCTGCTGCAGCAGCGGGATGG + Intronic
1061357825 9:130119672-130119694 CAGCTGAAGCAGCAGAGGCAGGG - Intronic
1061375168 9:130219824-130219846 CCTGTGTGGCAGCAGCTGGAGGG + Intronic
1061768340 9:132897183-132897205 CAGCTGAAGCAGCAGAAGAAAGG - Exonic
1062271911 9:135713727-135713749 CAGGAGAAGCAGGAGCTGAGGGG - Intronic
1062282986 9:135760204-135760226 CAGGTGCAGCAGCAGCTGCCAGG + Intronic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1203429999 Un_GL000195v1:81725-81747 CAGGTGCAGCAGCTGCTGTCTGG - Intergenic
1203436529 Un_GL000195v1:142932-142954 CAGGTGCAGCAGCTGCTGTCTGG + Intergenic
1203604867 Un_KI270748v1:49854-49876 CAGGTGAAGCAGCAACCATAAGG - Intergenic
1185508253 X:644394-644416 CAGGCTCAGCTGCAGCTGGAAGG + Exonic
1187981779 X:24765065-24765087 CAGGTGAGGGAGCAGCAGGTAGG - Intronic
1188984776 X:36759404-36759426 GAGGTAAAGCAGGAGTTGGATGG - Intergenic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189374759 X:40458386-40458408 CACGTGAAGACACAGCTGGAAGG - Intergenic
1190305226 X:49078156-49078178 CAGGTGAGGCAGAACTTGGAGGG - Intronic
1192315754 X:70050112-70050134 CAGGTGAGTGGGCAGCTGGAAGG - Intergenic
1197547837 X:127848775-127848797 AACGTGAAGCACAAGCTGGAGGG + Intergenic
1197941596 X:131795789-131795811 CAGGTGCGGCAGCAGCTGGATGG - Intergenic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1199211376 X:145215417-145215439 AAGGTGGAGCAGCAGATGAAAGG - Intergenic
1199684591 X:150254967-150254989 CATGTGACGAAGCAACTGGAAGG - Intergenic
1199814697 X:151387098-151387120 ATGGTGAAGCACCAGCTGCAGGG - Intergenic
1200111603 X:153743589-153743611 CGGCTGGAGCAGCAGCTGGCGGG + Exonic
1201500039 Y:14631801-14631823 CAGGTTAAGTTGTAGCTGGAAGG - Intronic