ID: 959041968

View in Genome Browser
Species Human (GRCh38)
Location 3:101432149-101432171
Sequence GGCCATACTCCTTGTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 3, 2: 14, 3: 50, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959041960_959041968 22 Left 959041960 3:101432104-101432126 CCATCTTAAGAGATTTCGGGCCT 0: 1
1: 0
2: 1
3: 3
4: 63
Right 959041968 3:101432149-101432171 GGCCATACTCCTTGTGGCCTGGG 0: 1
1: 3
2: 14
3: 50
4: 175
959041964_959041968 2 Left 959041964 3:101432124-101432146 CCTTAAGGGAAATTGTAGGTAGT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 959041968 3:101432149-101432171 GGCCATACTCCTTGTGGCCTGGG 0: 1
1: 3
2: 14
3: 50
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959041968 Original CRISPR GGCCATACTCCTTGTGGCCT GGG Intronic
900438033 1:2640743-2640765 GGCCAGACTCCTGGGGCCCTTGG - Intronic
903123676 1:21233371-21233393 GGCCATACTTCTTTTGCCCTTGG + Intronic
904699288 1:32348726-32348748 AGCCATGCTCCCTGTGCCCTGGG - Intergenic
904788198 1:32998283-32998305 GGCTCTGCTCCTTGTAGCCTTGG + Intergenic
905282911 1:36860475-36860497 GGCCATACTTTTTGAGTCCTAGG - Intronic
905655229 1:39682493-39682515 GGCCATGCCCCTTCTGGCCAGGG + Exonic
906073664 1:43036025-43036047 GGCCCTACTCCAAGTGGCGTGGG + Intergenic
906129490 1:43447657-43447679 GGGCATACTCGTTGTGTTCTGGG - Exonic
907118878 1:51991409-51991431 TGCCATACTCCTGGTGACTTCGG + Intergenic
907222752 1:52919441-52919463 GGCTATACACCATGTAGCCTTGG + Intronic
907454937 1:54569418-54569440 GGCCAGGCTGCGTGTGGCCTGGG - Intronic
908444010 1:64184280-64184302 TGCCATACTCTATGTAGCCTAGG - Intergenic
908908034 1:69038555-69038577 GGCAGTACTCCTTGTGGCCTAGG + Intergenic
909435534 1:75636857-75636879 GGTCATACTTCTTTTTGCCTGGG - Intergenic
911062096 1:93757471-93757493 GATCTTACTCCTTGTTGCCTAGG - Intronic
911496536 1:98638065-98638087 GGCAATACTCTTTATGGCCTGGG + Intergenic
911887816 1:103326457-103326479 GGCAGTACTCTTCGTGGCCTGGG - Intergenic
911967846 1:104390124-104390146 GGCTGTACTCCTCCTGGCCTGGG + Intergenic
912034954 1:105301192-105301214 GGCAGTACTCCTTGTAGCCGGGG - Intergenic
916369417 1:164073670-164073692 GACAGTTCTCCTTGTGGCCTGGG - Intergenic
916679873 1:167094357-167094379 GGCCCTACCTCCTGTGGCCTTGG + Intronic
917184072 1:172332646-172332668 GGCAATAATCCTACTGGCCTGGG - Intronic
917373049 1:174316929-174316951 GGCAGTACTCCTCGTAGCCTGGG - Intronic
917583927 1:176405762-176405784 TGACATACTCCTCATGGCCTGGG - Intergenic
918416192 1:184310915-184310937 GGCAACACTCCTGGTGGTCTAGG - Intergenic
918666186 1:187154273-187154295 GGCAGTACTCCTTGTAGCCAAGG - Intergenic
919287636 1:195585061-195585083 GGCAGTACTCCTCATGGCCTGGG + Intergenic
920744955 1:208617513-208617535 AGCAGTACTCCTTGTGGCCTGGG + Intergenic
921994037 1:221397477-221397499 GGCAGAACTCCTCGTGGCCTGGG + Intergenic
922045866 1:221945870-221945892 GGTAGTACTCCTTGTGGCCTGGG - Intergenic
922420870 1:225460450-225460472 GGCCATCCTCCCTGCAGCCTAGG + Intergenic
924648946 1:245905439-245905461 GGCAATACTCCATGTGGCCAGGG + Intronic
1067145658 10:43691941-43691963 GGCCGCACTGCATGTGGCCTGGG - Intergenic
1068701556 10:60025188-60025210 GGCCATCCTTCCTGTGGCCACGG - Intergenic
1069147880 10:64918050-64918072 GGCAGTACTCCTCATGGCCTGGG + Intergenic
1069677733 10:70260494-70260516 GGCCCTTCTCCTTGTGGCTCAGG + Intronic
1070954092 10:80453645-80453667 GGACACGCTCCTTCTGGCCTTGG - Intergenic
1071869696 10:89780771-89780793 GGCAGTACTCCTTGTGGCAGGGG - Intergenic
1072862737 10:99023207-99023229 GGCAGTATTCCTTGTGGCCTGGG + Intronic
1075100030 10:119499683-119499705 GGCCATACCCCCAGTAGCCTGGG + Intergenic
1076809690 10:132880026-132880048 GGCCACCCTCCCTGTGGCCGCGG - Intronic
1077061042 11:617986-618008 GGCCATAGTGCTTGTGGACAAGG + Exonic
1077970308 11:7182090-7182112 GGCAGTACTCCTTGTGGCCTGGG + Intergenic
1085765262 11:79276738-79276760 TGCCATACTCCTTGCTGCTTTGG + Intronic
1087201364 11:95347445-95347467 GGCAGTACTCCTCATGGCCTGGG + Intergenic
1089598446 11:119597906-119597928 GCCCATCCTGCTTGTGGCCAGGG - Intergenic
1095099477 12:38165712-38165734 GGCAGTATTCCTTGTGTCCTGGG - Intergenic
1097150856 12:56978903-56978925 GGCAGTACTCCCTGTGGCCTGGG - Intergenic
1097563591 12:61239537-61239559 GGCAGTACTCCTTGTGGCCAGGG - Intergenic
1097605593 12:61749334-61749356 TGGCATACTCCTTGTGGGCTTGG + Intronic
1101999259 12:109546428-109546450 TCCCATTCTGCTTGTGGCCTGGG - Intergenic
1105244753 13:18639382-18639404 GCCCAGATTCCCTGTGGCCTGGG + Intergenic
1105635656 13:22212934-22212956 GGCCACAGTCCGTGTGGCCTGGG + Intergenic
1106490696 13:30218740-30218762 GGCCATGTTACCTGTGGCCTTGG - Intronic
1108004401 13:45932788-45932810 GTCCATACTCATTGTGACTTTGG + Intergenic
1108613366 13:52106149-52106171 GGCCAAACTCCTTGGTGCCAGGG + Intronic
1109500911 13:63235368-63235390 TACCATCCTCCTTGTGGTCTAGG + Intergenic
1112001459 13:95213514-95213536 GGCCAGACTCCATGAGGCCTAGG + Intronic
1112901450 13:104362836-104362858 GGCAGTACTCCTTGTGGCCTGGG - Intergenic
1116504796 14:45665169-45665191 GGCAGTACTCCTTTTGGCCTGGG - Intergenic
1117483076 14:56168457-56168479 GGCAGTACTCCTCATGGCCTAGG - Intronic
1117628523 14:57665263-57665285 GCCCATCCTCCCTGAGGCCTGGG + Intronic
1121759722 14:96434871-96434893 GTCAGTACTCCTTGTGGCCTGGG - Intronic
1125574887 15:40748493-40748515 TGGCCTGCTCCTTGTGGCCTTGG + Intronic
1127945226 15:63744631-63744653 GGCAATACTCCTTGTGGCCTGGG - Intronic
1129150174 15:73683755-73683777 GGCCTGACACCTAGTGGCCTTGG - Intergenic
1129869409 15:78931162-78931184 GGCCACACTCCCAGAGGCCTTGG + Intronic
1130615829 15:85406943-85406965 AGACATACTCTTTGTGGCCTAGG - Intronic
1131270972 15:90947518-90947540 AGCCATTCTCAGTGTGGCCTGGG + Intronic
1142169048 16:88610847-88610869 GGCCTTCCGCCGTGTGGCCTGGG - Intronic
1143901325 17:10176823-10176845 GGCTATACTCCTTCTAACCTTGG + Intronic
1144753408 17:17665621-17665643 GGCCAGACTCATCATGGCCTTGG + Intergenic
1145866039 17:28242262-28242284 GGCCATCCTCCTTGTGCCAGAGG + Intergenic
1148329278 17:46803763-46803785 GGCCACACTGCCTGTGGCCAAGG - Intronic
1149108559 17:52997936-52997958 GGCAGTACTCCTTGCAGCCTGGG + Intergenic
1152929939 17:83104280-83104302 GACCATCCTCCTGGTGCCCTCGG - Intergenic
1154348053 18:13560285-13560307 GGACAGACTCCTTGTGACATGGG - Intronic
1156355243 18:36335007-36335029 GTCCCTACCCCTTGTGGCCTTGG + Intronic
1157608884 18:48943675-48943697 GGACATTGTCCTGGTGGCCTGGG - Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159822575 18:73164720-73164742 AACCTTCCTCCTTGTGGCCTTGG - Intronic
1160377793 18:78426904-78426926 TGCCATTTTCCTTGTTGCCTTGG - Intergenic
1160927228 19:1552520-1552542 GGCCACACACCCTGTGACCTGGG - Intergenic
1163148858 19:15399591-15399613 GCCCCCACTCCTTGGGGCCTAGG - Intronic
1164491123 19:28715035-28715057 GGCAGTAGTCCTTGTGGCCTGGG + Intergenic
1165983511 19:39747023-39747045 GGCAGTACTCCTCATGGCCTGGG + Intergenic
1166365354 19:42275464-42275486 GGCTGTGCTCCTTCTGGCCTTGG - Intronic
1168700764 19:58438088-58438110 GGCCATCCTTCTTGTGGTCAGGG - Intronic
925446124 2:3928495-3928517 GCCCAGACTCCTTGAGGCCTAGG - Intergenic
925542006 2:4976607-4976629 GGCCATCCCCATGGTGGCCTGGG + Intergenic
926981262 2:18572357-18572379 GGAGATAATCCTTGTGGCCTTGG + Intronic
927091773 2:19717853-19717875 GCCCCTTCTCCTTGGGGCCTGGG - Intergenic
928828886 2:35455162-35455184 GGCAGTACTCCTCATGGCCTGGG - Intergenic
929388611 2:41442144-41442166 GACAGTACTCCTTGTGGCCAGGG - Intergenic
931343646 2:61426455-61426477 GGCAGTACCCCTTGTGGCCTGGG + Intronic
932715940 2:74100871-74100893 GCAGATACTCCTTGGGGCCTGGG - Exonic
935171578 2:100614597-100614619 GCTCATGCTCCTTTTGGCCTTGG + Intergenic
935570493 2:104655076-104655098 GGCCAATCTCCTTATGGCCGCGG - Intergenic
943179462 2:184524711-184524733 GGACCTACTCCTTTTTGCCTGGG + Intergenic
943400301 2:187400869-187400891 TGCCACACTCCTTGAGTCCTAGG - Intronic
943496774 2:188630190-188630212 AGCCAAACTCCTGGAGGCCTTGG + Intergenic
1172707047 20:36889509-36889531 GGCCAGCCTCCTTGTGGCCTGGG + Intronic
1175010564 20:55730351-55730373 GGCCAGGCTGTTTGTGGCCTTGG + Intergenic
1176277337 20:64279811-64279833 TCCCATGCTCCCTGTGGCCTGGG + Intronic
1177456360 21:21344487-21344509 AGCAGTACTCCTTGTGGTCTGGG + Intronic
1178035828 21:28581314-28581336 GTCCAGACTCCTTCTGCCCTGGG - Intergenic
1178035837 21:28581370-28581392 GTCCAGACTCCTTCTGCCCTGGG - Intergenic
1178035846 21:28581426-28581448 GTCCAGACTCCTTCTGCCCTGGG - Intergenic
1180305069 22:11067186-11067208 GGCTATACTGCTTGTGGTCCGGG + Intergenic
1182697109 22:32205261-32205283 GGCCGTACTGCCTGTGGCGTGGG + Intergenic
1184243238 22:43222504-43222526 GGCCCTGCTCCGTGTGGCCTGGG - Intronic
1184249959 22:43254364-43254386 GGCCATATCCCCTGTGGCCCTGG + Intronic
1184681505 22:46074700-46074722 CACCATAGTCCTTGTGGCCCTGG - Intronic
1184735776 22:46396996-46397018 GGCCATTCCCCATGTGTCCTGGG - Intronic
1185127840 22:49021707-49021729 GGTCATACTCCTGGTTGCCCTGG - Intergenic
1185333827 22:50262843-50262865 GCCCATACCCTTTGTGCCCTGGG + Intergenic
950889070 3:16387213-16387235 AGCCCTCCTCCTTGTGGCCCTGG - Intronic
953211308 3:40877704-40877726 GGCCATTCTCCCTCTGGCATGGG - Intergenic
954615248 3:51966210-51966232 AGCCAGCCTCCTCGTGGCCTGGG + Intronic
959041968 3:101432149-101432171 GGCCATACTCCTTGTGGCCTGGG + Intronic
959303951 3:104636064-104636086 GGCAGTACTCCCTGTGGCCAAGG + Intergenic
960541150 3:118864172-118864194 AGCAGTACTCCTTGTGGCCTGGG - Intergenic
963692306 3:148519597-148519619 GGCAGTACTCCTCATGGCCTGGG + Intergenic
964209260 3:154210031-154210053 GGCAGTACTCCTTGTGGCCTGGG - Intronic
964239537 3:154574985-154575007 GGCAGTACTCCTAGTGGCCTGGG + Intergenic
965016716 3:163167813-163167835 GGCAGTATTCCTTTTGGCCTGGG - Intergenic
965936932 3:174125814-174125836 TTCCTCACTCCTTGTGGCCTGGG - Intronic
966312999 3:178615557-178615579 GGCAGTTCTCCTTGTGGCCTGGG - Intronic
966491125 3:180529715-180529737 GGCCATCCTCCTTGTGGCCTGGG + Intergenic
967632994 3:191768620-191768642 GGCAGTACTCCTAGTGGCCAGGG + Intergenic
970266370 4:14292033-14292055 GGGCATACACCTGGTGGTCTGGG - Intergenic
974021045 4:56692773-56692795 GGCCATGGTCCTTGTGTGCTTGG - Intergenic
974630299 4:64479928-64479950 GGCAGTATTCCTAGTGGCCTGGG - Intergenic
975035141 4:69670157-69670179 GGCAGTACTCCATGTGGGCTGGG + Intergenic
976254156 4:83083273-83083295 GGCAGTACTCCTCGTGGCCTGGG - Intergenic
977044442 4:92051428-92051450 GGCAGTACTCCTCATGGCCTGGG + Intergenic
977399186 4:96510122-96510144 GACAGTACTCCTTGTGGTCTGGG + Intergenic
977399329 4:96511347-96511369 GGCAGTACTCCTTGTGGTCTGGG + Intergenic
978624718 4:110671806-110671828 GGCGACACTCCCCGTGGCCTGGG + Intergenic
978904321 4:113987746-113987768 TGGCATTCTCCTTGTGGCATGGG + Intergenic
979413509 4:120407138-120407160 GGCAATACTCCTTGTGGCCTGGG + Intergenic
980980877 4:139653731-139653753 AGCCATACTCCTGGTGTCCCTGG + Intergenic
981009712 4:139912990-139913012 GGAAATACTCATTTTGGCCTTGG - Intronic
983323434 4:166224747-166224769 GGCAATACTCCCTAAGGCCTTGG - Intergenic
985188710 4:187346940-187346962 GGGTACACTCCTTGGGGCCTTGG + Intergenic
985744191 5:1637222-1637244 GGCCAGGCTCCTCCTGGCCTGGG - Intergenic
986657535 5:10030369-10030391 GGCAGTACTCCTTGTTGCCAGGG - Intergenic
987537447 5:19206978-19207000 GGCAGTACTCGTTGTGGGCTTGG + Intergenic
988939387 5:36127627-36127649 GGATATACTCATTGTGGCCCTGG + Intronic
989434209 5:41391911-41391933 GGCAGTACTCCTCGTGGCCTGGG + Intronic
989629011 5:43461647-43461669 GGCAGTACTCTTTGTGACCTGGG + Intronic
989681288 5:44032412-44032434 GGGGTTACTTCTTGTGGCCTGGG + Intergenic
990651648 5:57906820-57906842 GGACATCTTCATTGTGGCCTTGG - Intergenic
992587202 5:78252580-78252602 GGCAGTACTCTTTGTGGCCTGGG + Intronic
993580466 5:89653935-89653957 GGCAGTATTCCTGGTGGCCTGGG + Intergenic
993582344 5:89677949-89677971 GGCAGTACTCCTCATGGCCTGGG + Intergenic
994428698 5:99628043-99628065 GACAGTATTCCTTGTGGCCTGGG - Intergenic
994530004 5:100957057-100957079 GGCAATAATCCTCGTGGACTGGG + Intergenic
994627814 5:102243062-102243084 GGCAGTACTCCTCGTGGCCTGGG + Intronic
994845746 5:104986793-104986815 GGCAGTACTCCTTGTGGCCTGGG - Intergenic
996594362 5:125184554-125184576 GGCAGTACTCCTCGTGGCCTGGG + Intergenic
996594523 5:125185577-125185599 GGCAGTACTCCTCGTGGCCTGGG + Intergenic
997192057 5:131946323-131946345 GGCTCTCCTCCTTGTGCCCTGGG + Intronic
997472861 5:134126343-134126365 GGCCATCGACCCTGTGGCCTTGG - Intronic
1000651284 5:163821919-163821941 GGCAGTACTCCTTGTGGGCAGGG - Intergenic
1004225892 6:13784081-13784103 GGCCACCCTCCTTGGGTCCTTGG + Intergenic
1005686261 6:28255764-28255786 GGCCCTACTCCTGGTGGTCCTGG + Intergenic
1006682336 6:35805958-35805980 TGCCATGTTCTTTGTGGCCTTGG + Exonic
1007171358 6:39865600-39865622 GGCCCCACACGTTGTGGCCTGGG - Intronic
1008261683 6:49373708-49373730 GGCCCTACTCTTTGTGCCCTTGG + Intergenic
1008312210 6:49990074-49990096 GGCAGTACTCCTTATGGCCTGGG + Intergenic
1009353113 6:62707356-62707378 AGCAGTACTCCTTGTGGCCAGGG - Intergenic
1010483531 6:76382364-76382386 GGCAGTACTCCTCATGGCCTGGG - Intergenic
1010625359 6:78131707-78131729 GGCAGTACTCCTTGTGGCCTGGG + Intergenic
1015030352 6:128586990-128587012 GGCAGTACTCCTTGTGGCCTGGG + Intergenic
1016135257 6:140532770-140532792 GGCAGTACTGTTTGTGGCCTAGG + Intergenic
1016185684 6:141195673-141195695 GGCAATACTCCTCATGGCCTGGG - Intergenic
1016567521 6:145472624-145472646 GGCAGTACTCCTCATGGCCTAGG + Intergenic
1016643773 6:146380427-146380449 GCCAGTACTCCTTATGGCCTGGG - Intronic
1017379692 6:153813940-153813962 GGCAGTATTCCTTGTGGCCAGGG + Intergenic
1021130965 7:16912933-16912955 GGCAGTACTCCTCATGGCCTAGG - Intergenic
1029797267 7:102909182-102909204 GGCAATACTACTCATGGCCTGGG - Intronic
1030370446 7:108693937-108693959 GGCAATACTCCGCATGGCCTGGG - Intergenic
1032557986 7:132857766-132857788 GGCCTGACTGCTTGTGACCTTGG + Intronic
1033581619 7:142742270-142742292 GGCAATTCTCCAGGTGGCCTTGG - Intergenic
1033691368 7:143740638-143740660 GGCAGTACTCCTTGTGGCCTGGG + Intergenic
1033882434 7:145902313-145902335 TGCAGTACTCCTCGTGGCCTAGG - Intergenic
1035446211 7:158944885-158944907 GCCCAGTCTCCTTGTGGCCCTGG - Intronic
1038452965 8:27651587-27651609 GGCCCTGCTCCTGGTGGCCGTGG + Exonic
1038487651 8:27948326-27948348 GCCCATATATCTTGTGGCCTTGG - Intronic
1039474544 8:37832909-37832931 GGCCGGACTCCTTGGGGCCTTGG - Intronic
1040663524 8:49603553-49603575 GGTCATACTCATTGTGCCATTGG - Intergenic
1041255012 8:55972440-55972462 GGCCCTACTCCTTGTTGCCAAGG - Intronic
1043627031 8:82274044-82274066 GGCAGTACTCCTCATGGCCTGGG + Intergenic
1044395177 8:91702892-91702914 GGCAGTACTCCTTATGGCCAGGG - Intergenic
1045589992 8:103582647-103582669 GGCAATACTCCTTGTGGCTGGGG + Intronic
1050913989 9:11108282-11108304 GGCAGTACTCCTCATGGCCTGGG + Intergenic
1051991040 9:23153257-23153279 GGCAGTACTCTTTGTGGCCTGGG - Intergenic
1052346458 9:27414594-27414616 GGTTATACTCCCTATGGCCTTGG + Intronic
1052823181 9:33155616-33155638 CGGCCTTCTCCTTGTGGCCTGGG + Intronic
1052900330 9:33788232-33788254 GGCAATTCTCCAGGTGGCCTTGG - Intronic
1055982755 9:82021507-82021529 CACCATACACCTTGAGGCCTAGG + Intergenic
1056557066 9:87698426-87698448 AGCAATTTTCCTTGTGGCCTAGG + Intronic
1057918073 9:99072710-99072732 GCCCATTCTCCTTGTTCCCTGGG - Intergenic
1058241641 9:102569612-102569634 GGCAGTACTCCTTGTGGCCAAGG + Intergenic
1059515428 9:114889844-114889866 GGCAGTACTCCTCGTGGCCTGGG + Intergenic
1062282344 9:135757668-135757690 GGCCCTGGTCCTCGTGGCCTGGG - Intronic
1062285373 9:135770433-135770455 GGCCTTACTTCTTGTGGGCGTGG - Exonic
1185676249 X:1851678-1851700 GTCCATGCTCCCTGTGGCCTCGG + Intergenic
1187610545 X:20938828-20938850 GGCAGTACTCCTCATGGCCTGGG - Intergenic
1191221982 X:57998927-57998949 GGCAGTACTCCTCATGGCCTGGG + Intergenic
1192393447 X:70754304-70754326 GGCAGTACTCCTTGTGGCCTGGG + Intronic
1192812601 X:74560325-74560347 GGCAGTACTCCTCATGGCCTGGG + Intergenic
1192908510 X:75578610-75578632 GGCAGTACTCTTTGTGGGCTGGG - Intergenic
1193147451 X:78092381-78092403 GACAATACTCCTCATGGCCTAGG - Intronic
1193665456 X:84310339-84310361 GGCAGTACTCCTCATGGCCTGGG + Intergenic
1193755859 X:85408200-85408222 GGCTGTATGCCTTGTGGCCTAGG - Intergenic
1193815775 X:86102868-86102890 GGCAGTACTCCTTGTGGCATGGG + Intergenic
1193821457 X:86170629-86170651 GGCAGTCCTCCTTGTGGCCTAGG - Intronic
1194274768 X:91865784-91865806 GGCAGGACTCCTTGTGGCCTGGG - Intronic
1194372467 X:93091009-93091031 AGCAGTACTCCTTGTAGCCTGGG - Intergenic
1194438056 X:93894053-93894075 GGCAGTACTCCTTATGGCCTTGG - Intergenic
1194495543 X:94613077-94613099 GGCAGTACTCCTTATGGCCTGGG - Intergenic
1194561610 X:95428313-95428335 GGCAGTACTCCTAATGGCCTGGG + Intergenic
1194788761 X:98119261-98119283 GGTAGTACTCCTCGTGGCCTTGG + Intergenic
1195559379 X:106266085-106266107 GACGGTACTCCTTGTGGCCTGGG - Intergenic
1196609609 X:117696089-117696111 GGCAGCACTCCTTGTGGCCTGGG + Intergenic
1196859524 X:120014613-120014635 GGCCTTGGGCCTTGTGGCCTTGG + Intergenic
1196922172 X:120595420-120595442 GGCAGTACTCCTTGTGGCCTGGG + Intronic
1196984499 X:121253586-121253608 GGCAGTACTCCTCATGGCCTAGG - Intergenic
1197307710 X:124863478-124863500 GGCAGTACTCCCTGTGGCCTGGG + Intronic
1197987105 X:132278419-132278441 GGCAGTACTCCTCATGGCCTGGG - Intergenic
1198925557 X:141788096-141788118 GGCAGTACTCCTTCTGGACTCGG - Intergenic
1199081210 X:143578869-143578891 GGCAGTACTCCTTGTGGCCAGGG - Intergenic
1199175960 X:144787327-144787349 GGCAGTACTCCTTGTGGCCTAGG + Intergenic
1199239182 X:145526599-145526621 GGCGGTACTCCTTGTGGCATGGG + Intergenic
1199308645 X:146297273-146297295 TGTCATACTCCTCATGGCCTGGG - Intergenic
1199374199 X:147088139-147088161 GGCAGTACTCCTTGTGGCTGGGG - Intergenic
1199439605 X:147853891-147853913 GGCAGTACTCCTCATGGCCTGGG - Intergenic
1200592010 Y:5087185-5087207 GGCAGGACTCCCTGTGGCCTGGG - Intronic
1200680509 Y:6205052-6205074 AGCAGTACTCCTTGTAGCCTGGG - Intergenic
1201762462 Y:17555157-17555179 GGCAGTACTCCTTGTGGCCTGGG + Intergenic
1201839090 Y:18350831-18350853 GGCAGTACTCCTTGTGGCCTGGG - Intergenic