ID: 959044493

View in Genome Browser
Species Human (GRCh38)
Location 3:101457636-101457658
Sequence AACTGCTCGTAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959044493_959044499 14 Left 959044493 3:101457636-101457658 CCTTCTTCCTTCTACGAGCAGTT 0: 1
1: 0
2: 2
3: 13
4: 145
Right 959044499 3:101457673-101457695 GCACACTTGTGCCTGCAGTTTGG 0: 2
1: 3
2: 0
3: 16
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959044493 Original CRISPR AACTGCTCGTAGAAGGAAGA AGG (reversed) Intronic
900100536 1:960344-960366 GGCTTCTCGGAGAAGGAAGATGG + Intergenic
901648037 1:10727139-10727161 AACAGCCTGGAGAAGGAAGAGGG + Intronic
902754638 1:18541005-18541027 CAGAGCTCGAAGAAGGAAGAAGG + Intergenic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
907102781 1:51851962-51851984 AGCTGCCCATAGAAGGAAAAAGG - Intronic
907127574 1:52064827-52064849 TACAGCTCGCAGAAAGAAGAAGG + Exonic
907842375 1:58170320-58170342 AGCTGCTCGAGGAAGGCAGAAGG - Intronic
908143092 1:61208292-61208314 AGCTGCTCTCAGAAGGAATATGG - Intronic
912360706 1:109092678-109092700 AATTGCTTGTAGGAGGAAGGGGG - Intronic
912955091 1:114149845-114149867 CAGTGCTCCTAGAAGAAAGAAGG + Intronic
920350389 1:205334268-205334290 AACTGCACTTTGAAAGAAGAGGG - Intergenic
921234530 1:213112201-213112223 AACTGTTGGTAGAAGGTAGAGGG + Intronic
923694540 1:236234596-236234618 AACTGCCTGGAGAAGGAAGTTGG - Intronic
1063135353 10:3211818-3211840 ATCAGCTCTGAGAAGGAAGATGG + Intergenic
1064271599 10:13870828-13870850 AACTGAACGTTGAATGAAGATGG - Intronic
1064826220 10:19405210-19405232 AACTACTGGTAGAATGTAGAAGG + Intronic
1067167869 10:43879722-43879744 AGCTGCTCCTACGAGGAAGATGG - Intergenic
1069764289 10:70841626-70841648 AGCTGATGGTAGGAGGAAGAGGG - Intronic
1069909465 10:71750688-71750710 AACTGCTGGTAGGAGGCAGCTGG + Exonic
1073445468 10:103577728-103577750 CAGTGCTGGTACAAGGAAGAGGG + Intronic
1074016011 10:109534726-109534748 AATTGCTAGCAGAAAGAAGATGG + Intergenic
1075945831 10:126432363-126432385 AACTGCTCGTTAAATGTAGAAGG - Intronic
1077735552 11:4786848-4786870 AACTGTGCTCAGAAGGAAGAAGG - Intronic
1080985406 11:37457940-37457962 ACCTGAGAGTAGAAGGAAGATGG - Intergenic
1081033469 11:38114163-38114185 AACTGCTCGAGGAAGGCAGAAGG - Intergenic
1081937068 11:46912470-46912492 AACTGCCCGTGGAAGGAGGGTGG + Intronic
1085646961 11:78230590-78230612 ATGTGCTCCTAGAAGGCAGAGGG + Intronic
1092757195 12:11774776-11774798 AACTGCTCCTTGAAGGAACTTGG + Intronic
1093580541 12:20780624-20780646 AGCTGCTCGAGGAAGGCAGAAGG + Intergenic
1093896202 12:24577194-24577216 TATTGGTGGTAGAAGGAAGATGG - Intergenic
1096915464 12:55027223-55027245 AACTTCTCCTTGAAGCAAGATGG + Exonic
1101819445 12:108172666-108172688 AACTGCTAGAAGCTGGAAGAGGG + Intronic
1104767149 12:131337525-131337547 AACTGCTCAAGGAAGGCAGAAGG - Intergenic
1106162742 13:27215388-27215410 AGCTGCTCGAGGAAGGCAGAAGG - Intergenic
1109503754 13:63271960-63271982 TACTGCTCTCAGAAGTAAGAAGG + Intergenic
1110309474 13:74031630-74031652 CACTGCTTGTAGATGGAAGAAGG - Intronic
1110421243 13:75311655-75311677 AACTACTCTTAGAAGCTAGAAGG - Intronic
1111032344 13:82619817-82619839 CCCTTCTCGTAGGAGGAAGATGG - Intergenic
1115020412 14:28673634-28673656 AACTGCTCGCAGAAAGAAGAAGG - Intergenic
1116558361 14:46343152-46343174 AAATGCTCATAAAAGGATGAGGG - Intergenic
1118276383 14:64389201-64389223 AAATGAGAGTAGAAGGAAGAGGG + Intronic
1119527385 14:75333560-75333582 AACTGCTTTTATAAGGAAGGAGG + Intergenic
1130696039 15:86132376-86132398 AGCTGCTGGTTGAAGGAAGAAGG + Intergenic
1131226454 15:90628355-90628377 ACCTGCTGGTACAAGAAAGATGG + Intronic
1132437933 15:101826484-101826506 AACTGTAGGTAGAATGAAGAAGG + Intergenic
1133162406 16:3920714-3920736 AACTGCCTGCAGAAGGAAGAGGG - Intergenic
1138931220 16:61659397-61659419 AACTGCTCGCTGCAGGGAGAGGG - Intronic
1141447638 16:84072301-84072323 AAGGGCTGGTGGAAGGAAGAAGG + Intronic
1142045646 16:87923521-87923543 TACTACTCCTAGAAGGAGGAAGG - Intronic
1143315756 17:6032214-6032236 AGCTGGTCATGGAAGGAAGAAGG - Intronic
1143355260 17:6323135-6323157 AATTGGTTGTAGAAAGAAGAAGG - Intergenic
1144371453 17:14595463-14595485 AAGTGCTTGTAGAGGGAACAGGG + Intergenic
1146908585 17:36633452-36633474 ATCTGTTCTTCGAAGGAAGAGGG - Intergenic
1147616383 17:41831013-41831035 AGCTGCCCTTAAAAGGAAGAGGG + Intronic
1150339149 17:64352151-64352173 AACTCCCCGTAGAAGAAATATGG - Intronic
1158341150 18:56468036-56468058 AACAGCATGTGGAAGGAAGAAGG + Intergenic
1160355044 18:78220469-78220491 ACCTCCTAGGAGAAGGAAGATGG + Intergenic
1160557474 18:79735566-79735588 AACTGCACGGAGATGGGAGAAGG - Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1164517372 19:28947911-28947933 ATCTGCGCCTAAAAGGAAGAGGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165847120 19:38825382-38825404 AGCTGCTCGAGGAAGGCAGAAGG - Intronic
925667027 2:6268635-6268657 AACTGCTGGTTAAAGGAATATGG + Intergenic
928197247 2:29224802-29224824 ATCTGCCGGTAGAAGGGAGATGG - Intronic
928271098 2:29855436-29855458 ATCTCTTGGTAGAAGGAAGAAGG - Intronic
928872109 2:35992204-35992226 AACTGCTAGGAGCAGCAAGAAGG - Intergenic
929219801 2:39451452-39451474 AAATGTTGGAAGAAGGAAGAAGG + Intergenic
930038564 2:47103256-47103278 AGCTGCTCGAGGAAGGCAGAAGG - Intronic
930063227 2:47308205-47308227 AACTGCTACTAGAAGGAAGCTGG - Intergenic
930800157 2:55435539-55435561 AACTGCTTGCAGAAAGAAGGTGG - Intergenic
931590131 2:63873984-63874006 AACAGCAGGAAGAAGGAAGATGG + Intronic
931853787 2:66280601-66280623 AAGTGATGGTAAAAGGAAGATGG - Intergenic
934867155 2:97823760-97823782 AGCTGCTCGAGGAAGGCAGAAGG - Intronic
937302890 2:120854000-120854022 AAATGCTGGTAGAATGAAGGAGG - Intronic
939386768 2:141510494-141510516 ACCTGCTGGTAAAAGGAAAAAGG - Intronic
940887702 2:159003901-159003923 TACAGCTCGCAGAAAGAAGAAGG + Intronic
943499837 2:188673892-188673914 AACTGCTACTAGAAGTTAGAAGG - Intergenic
947309552 2:228785915-228785937 TAATGCTCTCAGAAGGAAGATGG + Intergenic
1168954420 20:1824851-1824873 AAATGTTTCTAGAAGGAAGAAGG + Intergenic
1173338621 20:42134481-42134503 AACTGGTGGCAGAAGGTAGAAGG + Intronic
1175284661 20:57830093-57830115 AAGTGCTTGTTAAAGGAAGAGGG - Intergenic
1177286552 21:19058798-19058820 AACTGCTCTGAGAAGCAAAATGG - Intergenic
1178085428 21:29106974-29106996 GACTGCTAAGAGAAGGAAGATGG + Intronic
1181967256 22:26665908-26665930 AACTGCTATTAGAAGGAGGCTGG + Intergenic
1182752974 22:32656783-32656805 GAATGCCCGTAGGAGGAAGACGG + Intronic
950235807 3:11319383-11319405 AAGTGCTGGTAGGAGGAGGAGGG - Intronic
953612743 3:44461148-44461170 AGCTGCTGGGAGAAGGAAGGAGG - Intronic
954988421 3:54816494-54816516 AACTGCTGGTCAAAGGAAGAAGG + Intronic
956512935 3:70014345-70014367 AACTGACCGAAGGAGGAAGAGGG + Intergenic
957179239 3:76855615-76855637 ACCTGCTGTTAGAAGGAAAAAGG - Intronic
958921737 3:100114297-100114319 CACTGCCCGGAGAGGGAAGAGGG - Exonic
959044493 3:101457636-101457658 AACTGCTCGTAGAAGGAAGAAGG - Intronic
959540108 3:107526410-107526432 AACTGTTCGTACAGGGAAGCAGG + Intronic
962261187 3:133908522-133908544 AATTGGTCGCAGAAGAAAGATGG - Intergenic
964972257 3:162577186-162577208 AGCTGCTCGAGGAAGGCAGAAGG - Intergenic
969323349 4:6426290-6426312 AGCTGATCGTAGAAGGGAGCTGG - Intronic
969970303 4:11040103-11040125 ACCTGCTCGTTGAATGAAGTTGG - Intergenic
971606089 4:28660174-28660196 AAATGCTAGTAGAGGCAAGATGG + Intergenic
971702612 4:29998049-29998071 GACTGGTAGTAGAAGGGAGAAGG + Intergenic
973244999 4:48002159-48002181 AACTCCAAGTAGAAGGAAGGAGG + Intronic
973654246 4:53029335-53029357 AACTGCTCCAAGAGGCAAGAGGG + Intronic
977582487 4:98740815-98740837 AACTGCTCACAGAAAGAAGAAGG + Intergenic
977834905 4:101635604-101635626 AGCTGCTCGAGGAAGGCAGAAGG + Intronic
979671631 4:123365885-123365907 AGCTGTTAGTAGGAGGAAGAAGG + Intergenic
980204744 4:129702816-129702838 AACAGCCCGGAGAAGAAAGATGG - Intergenic
985084566 4:186299062-186299084 AACTGTTTATTGAAGGAAGAGGG + Intergenic
985613110 5:901493-901515 AACTCCTTGCAGAAGGACGAAGG - Intronic
986406310 5:7428148-7428170 AACTGCTGGTAGCAGGTTGATGG + Intronic
986761424 5:10883208-10883230 AACTGCCCGTGCAAGGAAGGAGG + Intergenic
988357817 5:30200276-30200298 AGCTGCTCGAGGAAGGCAGAAGG - Intergenic
990938781 5:61178966-61178988 AACTGCTGGAACGAGGAAGAAGG - Intergenic
991114347 5:62936867-62936889 ACCTGATAGTAAAAGGAAGAAGG - Intergenic
991391283 5:66145679-66145701 AAATGCTCGTAAAAGGAACATGG - Intronic
992028600 5:72697219-72697241 AACTGCCCATAGGTGGAAGAGGG - Intergenic
992111918 5:73502490-73502512 AACTGCTCGCAGAAAGAAGAAGG + Exonic
994213115 5:97108207-97108229 AACTGTTACTAGAAGGAAGGTGG - Intronic
996253052 5:121361534-121361556 AACTGATCATAGAAAAAAGATGG - Intergenic
1000001399 5:157142415-157142437 AACTGCTCCCAGAAGAAGGAAGG + Intronic
1002088052 5:176788073-176788095 AACTGCTCGAAGTGGGAGGACGG + Intergenic
1002828532 6:796287-796309 ATCTGCTGTTAGAAGCAAGAAGG - Intergenic
1004812248 6:19273890-19273912 AGCTGCTCGAGGAAGGCAGAAGG - Intergenic
1006688745 6:35861479-35861501 CACTGCTCTGAGGAGGAAGAGGG + Intronic
1008586981 6:52959372-52959394 AGCTGCTCGAGGAAGGCAGAAGG + Intergenic
1016570415 6:145506228-145506250 AACTCCACGTAGTATGAAGAAGG + Intronic
1016998513 6:149977996-149978018 ACCTGCTTGCAGAAAGAAGAAGG + Intergenic
1017829187 6:158109870-158109892 ACATGCTAATAGAAGGAAGAAGG + Exonic
1019054825 6:169215407-169215429 AACAGCTCGTATTAGGGAGAGGG + Intergenic
1020797050 7:12688148-12688170 GACTGCTGGGAGACGGAAGAAGG - Exonic
1029261167 7:99303850-99303872 AAGGGCTAGTAAAAGGAAGATGG + Intergenic
1036713233 8:11096587-11096609 AAATGCTTGGAAAAGGAAGATGG + Intronic
1038062898 8:23931801-23931823 AATTGCTCCTAAAAAGAAGAGGG - Intergenic
1038638794 8:29307654-29307676 AGCTGCTCGAGGAAGGCAGAAGG - Intergenic
1038955031 8:32458677-32458699 AACTGCTGGGAGAAGGGAGAGGG - Intronic
1039635761 8:39162912-39162934 AACTGCTTGAACAAGGAAGGTGG + Intronic
1039693171 8:39882820-39882842 AGCTGCTCGAGGAAGGCAGAAGG + Intergenic
1040834945 8:51722071-51722093 AACTGCTTGCGGAAGGAAGAAGG - Intronic
1042580557 8:70273439-70273461 AACTGCTCACAGAAAGAAGGTGG + Intronic
1044651978 8:94505372-94505394 ATTTGCTGGGAGAAGGAAGAGGG - Intronic
1046104646 8:109650907-109650929 AACTGCTAACAGAAGGAATAGGG - Intronic
1050990241 9:12141546-12141568 AACTGATTGTTTAAGGAAGAAGG + Intergenic
1054734253 9:68734515-68734537 GACTGCTGGTAGCAGGCAGATGG + Intronic
1055064793 9:72108219-72108241 AACTGCTCACAGAAAGAAGGTGG - Intergenic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1060419466 9:123457461-123457483 AACAGCTCGTACAAAGAAAAGGG + Intronic
1061458863 9:130720074-130720096 AAATGTTTGTTGAAGGAAGAAGG - Intronic
1061810139 9:133157640-133157662 AACTGGTTGGAGAAGAAAGAAGG + Intronic
1185938060 X:4281510-4281532 ATCTGTTCTTAAAAGGAAGATGG + Intergenic
1186095250 X:6094300-6094322 AACAGAAAGTAGAAGGAAGAAGG + Intronic
1191673075 X:63766925-63766947 AACTGCTCACAGAAAGAAGGAGG + Intronic
1192438972 X:71160846-71160868 AACTGCTCGTCAACAGAAGATGG - Intronic
1195068879 X:101260969-101260991 AATTCCACGGAGAAGGAAGAGGG - Exonic
1197744880 X:129925423-129925445 AACTGCTCTCAGAGGTAAGAGGG + Intronic
1198147516 X:133872311-133872333 AACTTCTTGTAGAAGAAAGCTGG + Intronic
1199772012 X:150981137-150981159 AACTGCTTGTAGAAGGAGCAGGG + Intronic
1199840281 X:151639588-151639610 AACTTCTCAGAGAGGGAAGATGG - Intronic
1201312056 Y:12606046-12606068 AGCTGCTCGAGGAAGGCAGAAGG + Intergenic
1202102502 Y:21325082-21325104 AACCCCTCTTGGAAGGAAGAAGG + Intergenic
1202272058 Y:23082254-23082276 AGCTGCTCGAGGAAGGCAGAAGG + Intergenic
1202293968 Y:23338428-23338450 AGCTGCTCGAGGAAGGCAGAAGG - Intergenic
1202425055 Y:24715998-24716020 AGCTGCTCGAGGAAGGCAGAAGG + Intergenic
1202445734 Y:24954087-24954109 AGCTGCTCGAGGAAGGCAGAAGG - Intergenic