ID: 959047064

View in Genome Browser
Species Human (GRCh38)
Location 3:101485664-101485686
Sequence CATATTATCAGAGTTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959047064 Original CRISPR CATATTATCAGAGTTGTTTC TGG (reversed) Intronic
900939503 1:5789151-5789173 CATATTAGCAATGTTGTTGCAGG + Intergenic
901914608 1:12488575-12488597 AATATTTTCAGATTTATTTCTGG - Intronic
902126096 1:14212736-14212758 AATATAATCAGCTTTGTTTCTGG - Intergenic
903437737 1:23364536-23364558 CATATTAACATAGTTGGTTCTGG - Intronic
904368227 1:30031580-30031602 GAGTTTATCACAGTTGTTTCTGG + Intergenic
907715534 1:56922818-56922840 CATACTGTCTTAGTTGTTTCAGG - Intergenic
908343111 1:63203249-63203271 AATATTATCATATTTGCTTCAGG + Intergenic
909106139 1:71411561-71411583 CATGTGATCAGAGATGTATCTGG + Intronic
909217303 1:72906620-72906642 AATATTTTCAGTGTTGTTTTGGG + Intergenic
910185262 1:84531854-84531876 CATTTTACAAGAGTTGTTGCTGG - Intergenic
910325162 1:85998409-85998431 CATATTAACAGAGTTGTGTATGG - Intronic
910533585 1:88270172-88270194 TATCTTATGAGTGTTGTTTCAGG - Intergenic
911276265 1:95863124-95863146 CATATTATCAAAAATGTTTCTGG - Intergenic
913718317 1:121562754-121562776 CATTCTATCACAGATGTTTCAGG - Intergenic
917178816 1:172269642-172269664 GATATTATCTGTCTTGTTTCAGG + Intronic
922398033 1:225222924-225222946 CATAATATCAGAGATGTTACTGG - Intronic
922977421 1:229797193-229797215 CATTTTCCCAGAGTTGCTTCAGG - Intergenic
923488414 1:234459363-234459385 CAAATTATCAGAATTGTCTTTGG - Intronic
1066136402 10:32450988-32451010 CATTTTTTCAGAGTTGATTTTGG + Intronic
1068039741 10:51808852-51808874 CAAATTATCAGAGTTCTTTTCGG + Intronic
1068619592 10:59166251-59166273 CATATAAATGGAGTTGTTTCTGG - Intergenic
1068857866 10:61815684-61815706 CATATTATCAGTGTTATCTTGGG + Intergenic
1069146642 10:64900668-64900690 CATATTATGTGAGTTCTTTCAGG - Intergenic
1070638959 10:78152451-78152473 CATAGTATCAGAGGTATTTGTGG - Intergenic
1077802147 11:5550580-5550602 CAAAATATCAGAGTTGTTCATGG - Intronic
1079786801 11:24683397-24683419 CAGATTATCAGAGGAGTTTCAGG - Intronic
1079788167 11:24701774-24701796 AATATTATGGGAGTTTTTTCTGG - Intronic
1080478787 11:32624010-32624032 CATATTGTCAGATTGCTTTCCGG - Intronic
1082282497 11:50285243-50285265 CAAAATTTCAAAGTTGTTTCCGG - Intergenic
1085186611 11:74581129-74581151 CAGATTATCAAAATTTTTTCAGG - Intronic
1086523270 11:87696764-87696786 CATATTAGCAGAGTATTTTCTGG + Intergenic
1088173346 11:107020764-107020786 CATAGGTTCAGAGTTCTTTCTGG - Intergenic
1088951262 11:114572275-114572297 CATATTACCAGAATTGGTTTTGG - Intronic
1089720978 11:120421212-120421234 AATATTATCACTGTTGTTTTGGG - Intronic
1089832432 11:121340611-121340633 CATATAATCACACTAGTTTCTGG - Intergenic
1092917222 12:13199813-13199835 GATATTTTCTGAGTTGTTTCAGG - Intronic
1094425121 12:30309279-30309301 CAAAATATCAGTGTTGTCTCTGG + Intergenic
1095597941 12:43980301-43980323 CATAATGTTAGAGTTGTTACTGG + Intronic
1096012041 12:48226277-48226299 CTTAATATAAGAGTTGTTTTTGG - Intergenic
1096915249 12:55024916-55024938 TATATTATTTGATTTGTTTCTGG - Intronic
1099913914 12:88867909-88867931 CAAATTACCAGAGTTCTTTCAGG + Intergenic
1099933831 12:89102769-89102791 AATATTAACAGAGTTATATCTGG + Intergenic
1100017713 12:90031570-90031592 TGTATTATCAGAGTTTTATCAGG - Intergenic
1104061074 12:125269121-125269143 AATATAATCAGAGGTGTATCTGG - Intronic
1104863353 12:131937337-131937359 CATATTATCATAGTTGTGTGTGG + Intronic
1106118828 13:26840525-26840547 CCTATTATCAGCCTTTTTTCAGG + Intergenic
1107937827 13:45360035-45360057 CATATTAAAAGACTAGTTTCTGG + Intergenic
1108078226 13:46704099-46704121 CATATTATAATAGTTATTTCAGG - Intronic
1108475661 13:50814255-50814277 CATTTTATCAGCATTGATTCTGG - Intronic
1109945380 13:69424681-69424703 CTTATTACCAGAATTGTTTCTGG - Intergenic
1110582482 13:77147353-77147375 CATTTTACCATAATTGTTTCAGG - Intronic
1111339517 13:86864991-86865013 CATATTATTAGTTTTATTTCTGG - Intergenic
1111437570 13:88230562-88230584 CACATTTTCATAGTTGTGTCTGG - Intergenic
1112653490 13:101423783-101423805 CTTATTATCAGAGAAGTTTGAGG - Intergenic
1114056342 14:18970582-18970604 AATATAATCAAACTTGTTTCTGG + Intronic
1114106209 14:19431145-19431167 AATATAATCAAACTTGTTTCTGG - Intronic
1114830810 14:26139551-26139573 TATATAATCAAAGTTGTTTAAGG + Intergenic
1117385064 14:55203411-55203433 CATATTTTCAGAGGTGTTTTAGG - Intergenic
1118539739 14:66809116-66809138 GACATTTTCAGATTTGTTTCAGG + Intronic
1119609355 14:76048632-76048654 CACATCATCCGAGTTTTTTCTGG + Intronic
1121374793 14:93398590-93398612 CAGCTTATCAGAGTTGCTTCAGG + Intronic
1124947221 15:34280395-34280417 CATATCACAAAAGTTGTTTCAGG + Intronic
1125258029 15:37789190-37789212 AATATTTGCAGAGCTGTTTCTGG + Intergenic
1125385738 15:39134543-39134565 TATAAAATCAGAATTGTTTCTGG + Intergenic
1127134888 15:55909797-55909819 CCTATTATCCAAGTAGTTTCTGG + Intronic
1127474148 15:59316538-59316560 CTTAATATCAGAATTCTTTCTGG - Intronic
1129010416 15:72411111-72411133 CACATTATCAGACCTGATTCTGG + Intergenic
1129623159 15:77168357-77168379 CATAATATCAGATTTGTCTGTGG - Intronic
1131149351 15:90037176-90037198 AAAATTATCAAAGTTGTTCCAGG + Intronic
1139085894 16:63585069-63585091 CATAATAGCATAGTTGTTTCAGG - Intergenic
1139206796 16:65036870-65036892 CTTATTTTCTGAGTTATTTCAGG - Intronic
1140974343 16:80044766-80044788 CGTATTATAAGGGATGTTTCTGG + Intergenic
1141368092 16:83462812-83462834 AATAGTATTAGAGATGTTTCAGG - Intronic
1142468821 17:151031-151053 CATATTCTCTGTGTTGATTCTGG + Intronic
1144591337 17:16526671-16526693 CATTTTGTCAGATTTGTTTTTGG + Intergenic
1146992226 17:37285274-37285296 CAAGTTACCAGGGTTGTTTCTGG + Intronic
1147686992 17:42292121-42292143 TATATAAACACAGTTGTTTCTGG - Intronic
1148970642 17:51478226-51478248 CATATAATCAATGTTCTTTCTGG + Intergenic
1149176224 17:53874117-53874139 CATATTCTCAGATCTGATTCTGG - Intergenic
1149668987 17:58388309-58388331 CACATTATCAGACCTGTTTCTGG + Intronic
1150600931 17:66650334-66650356 GATATTATCAGAATGGTGTCGGG + Intronic
1155854909 18:30821013-30821035 CATATTATATGAGTTCCTTCAGG + Intergenic
1158104740 18:53872879-53872901 CATATATTCAGAAGTGTTTCAGG + Intergenic
1158518688 18:58152175-58152197 CATATTAACAGAGGTGCTTCAGG - Intronic
1162239075 19:9333700-9333722 CTTATTCTCAGGCTTGTTTCTGG - Intronic
925950741 2:8908170-8908192 CATATAATCAGTTTTGTTACAGG + Intronic
926512992 2:13805638-13805660 AAAATTATCAGAATTGTTACTGG + Intergenic
926544577 2:14223835-14223857 CATATTAGCAGCTTTGCTTCTGG - Intergenic
927065331 2:19465224-19465246 CATTTTATCAGATGTGTTTATGG - Intergenic
929669665 2:43863918-43863940 CAGATTGTGAGAGATGTTTCCGG - Intronic
929927195 2:46223719-46223741 TATATTATCAGTGTTGTATAGGG - Intergenic
930377029 2:50580906-50580928 CATATTCTAAGAGTTCTTTTGGG - Intronic
930907502 2:56589721-56589743 CATATTTTCAGAGTATTTTTAGG + Intergenic
931270823 2:60700927-60700949 CATATAATCAGAGTTCCTTGAGG + Intergenic
931662756 2:64583168-64583190 CATTTTTTCTGACTTGTTTCTGG + Intronic
933164655 2:79062867-79062889 CATATTATCACAGTTTTTATAGG - Intergenic
935243955 2:101202379-101202401 CATTTTTTCAGAGTTTTTTCTGG - Intronic
936589697 2:113791628-113791650 CATGGCATCAGAGGTGTTTCTGG - Intergenic
938285959 2:130117485-130117507 AATATAATCAAACTTGTTTCTGG - Intronic
938336607 2:130506048-130506070 AATATAATCAAACTTGTTTCTGG - Intronic
938353211 2:130614614-130614636 AATATGATCAAACTTGTTTCTGG + Intronic
938429647 2:131221417-131221439 AATATAATCAAACTTGTTTCTGG + Intronic
939684410 2:145181126-145181148 TATATTATCAGATTTGCTTGGGG - Intergenic
940709292 2:157143410-157143432 CATATTACCAGAGTTGGTTTGGG + Intergenic
942323251 2:174754182-174754204 CATATGATAAGGGTGGTTTCAGG - Intronic
943718106 2:191174341-191174363 CAGCTTCTCAGAGTTGTCTCAGG + Intergenic
944633025 2:201646526-201646548 CAAATTAACAAAATTGTTTCTGG - Intronic
945702274 2:213186876-213186898 AATATGATCAGAATTATTTCTGG - Intergenic
946514609 2:220398064-220398086 GAAATTATCTGAGTTGTTTCAGG + Intergenic
947825828 2:233105506-233105528 CATATTTTCTTAGTTGTTTATGG + Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169506932 20:6221156-6221178 CCTTTTATCACAGTTGTTTATGG + Intergenic
1169676585 20:8161106-8161128 TATATTATTAGAATTGTGTCTGG - Intronic
1174761275 20:53209465-53209487 CATTTTATCAGAGCTGTTTGGGG + Intronic
1177793932 21:25752853-25752875 CATATTATTATAGTTGTGACTGG + Intronic
1178564918 21:33674995-33675017 TATGTTATCAGTATTGTTTCTGG - Intronic
1178871014 21:36375765-36375787 CTTATAACCAGAGTTGTATCAGG - Exonic
1180474827 22:15693193-15693215 AATATAATCAAACTTGTTTCTGG + Intronic
1181324835 22:22036811-22036833 CAGATGGTCAGAGTTGGTTCTGG + Intergenic
949164838 3:927230-927252 CATATTATGAAATTTATTTCTGG + Intergenic
949521358 3:4857229-4857251 CATCTTTTTATAGTTGTTTCTGG - Intronic
952654775 3:35772014-35772036 CTTAATATCAGATTTGGTTCAGG + Intronic
955190189 3:56754540-56754562 AATATTATCAGAGTCATTTAGGG + Intronic
956260356 3:67332933-67332955 AATGTTATCATAGTTGCTTCAGG + Intergenic
956924888 3:73974202-73974224 TGTATAATTAGAGTTGTTTCTGG - Intergenic
957517465 3:81274465-81274487 CACACTGTCAGAGTTGTTCCAGG + Intergenic
959047064 3:101485664-101485686 CATATTATCAGAGTTGTTTCTGG - Intronic
959488512 3:106957236-106957258 CATATTTTAAGAGTTGCCTCAGG - Intergenic
960011496 3:112839195-112839217 TAAATTTTCAGAATTGTTTCGGG + Intronic
962599463 3:136980251-136980273 GATAAAATTAGAGTTGTTTCTGG + Intronic
963412880 3:144954116-144954138 CCTATGAGCTGAGTTGTTTCTGG + Intergenic
963463459 3:145647200-145647222 CATATTTTCAGAATTTTTACTGG - Intergenic
964305983 3:155340432-155340454 CATTTTATGAGAGCTGTTTTTGG - Intergenic
964976514 3:162627474-162627496 GATATCATTACAGTTGTTTCTGG - Intergenic
965437152 3:168666441-168666463 CAGAATATCATAGTTGTTTTAGG - Intergenic
967401780 3:189070954-189070976 GAAATTCTCAGATTTGTTTCTGG + Intronic
967720390 3:192809911-192809933 AATATTTTCAGAGTTTGTTCTGG - Intronic
970489224 4:16555067-16555089 CATATTTTCAGAGCAGTTTTAGG - Intronic
971800171 4:31279074-31279096 CTTATTATGAGAGTGTTTTCAGG + Intergenic
972644993 4:40959108-40959130 CATATAATCATAGATCTTTCTGG - Intronic
973314166 4:48742165-48742187 CAACTTTTCAGAGTAGTTTCAGG - Intronic
974637364 4:64582465-64582487 CATAATATCTTAGTTGGTTCTGG + Intergenic
975425760 4:74225373-74225395 GATATTATCATAGTTGCTGCAGG + Exonic
977723590 4:100268227-100268249 CATGTTATCAAAGGTGTTCCTGG - Intergenic
980395827 4:132213976-132213998 CATATTTGCAGTGCTGTTTCAGG - Intergenic
982454862 4:155597057-155597079 CATATTCTCAGTAATGTTTCAGG + Intergenic
983762783 4:171433278-171433300 AATATTATGAGACTTGTTTCTGG - Intergenic
984173575 4:176389484-176389506 CCCATTTTCAGACTTGTTTCAGG - Intergenic
985326338 4:188775515-188775537 CATATTACCAGAATTTTTTCTGG + Intergenic
985954275 5:3251506-3251528 GATATTATCAATTTTGTTTCAGG + Intergenic
986973113 5:13360477-13360499 CAAATTATCACAGTCTTTTCTGG + Intergenic
987828997 5:23071875-23071897 GATATTATCAGAGCAGTTTTGGG - Intergenic
987900395 5:24003467-24003489 CAAAATCTCAGAGTTGTTTCTGG - Intronic
988897020 5:35687271-35687293 CATATAATTAGATCTGTTTCTGG + Intronic
989960276 5:50405304-50405326 CATTCTATCACAGATGTTTCAGG + Intronic
990336302 5:54776048-54776070 TCTATGGTCAGAGTTGTTTCTGG - Intergenic
991045179 5:62214987-62215009 CATCTTAGCAGGGTAGTTTCTGG + Intergenic
992749139 5:79846292-79846314 CATGTGATCAGAGCTGTTGCTGG - Intergenic
993551965 5:89284308-89284330 CATATTGTCAAAATAGTTTCCGG - Intergenic
996191900 5:120554812-120554834 GAAATTATGAGAGGTGTTTCTGG - Intronic
1000175139 5:158744798-158744820 TTTATCATCATAGTTGTTTCCGG - Intronic
1005094289 6:22096289-22096311 CATATAATCAGTATTTTTTCTGG - Intergenic
1005108607 6:22252866-22252888 CATATTTTTAGTGTTGTTTCTGG + Intergenic
1005229879 6:23687389-23687411 CATATTTTCAGAGATGTCTGGGG - Intergenic
1006355244 6:33552508-33552530 CATTTTGTCAGAGTAGTTTGAGG - Intergenic
1007412352 6:41672366-41672388 CATCTAATCAGAGTTGCTTGGGG - Intergenic
1008261453 6:49370547-49370569 TATATTAGCAGAGTTGATCCAGG - Intergenic
1008402995 6:51085725-51085747 CATCTTCTAAGAGTTGTGTCTGG + Intergenic
1008752994 6:54758811-54758833 CATATTTTCTGAATTGTCTCAGG + Intergenic
1010448674 6:75977730-75977752 CATTTTCTCAGAGTGGTTTATGG + Intronic
1010889471 6:81288378-81288400 CAGATTCACAGCGTTGTTTCTGG + Intergenic
1011634560 6:89359237-89359259 CAAATTATAAGAATTGTTTAGGG + Intergenic
1012225486 6:96699001-96699023 CATATTATCAGAATATTATCAGG - Intergenic
1012903523 6:105036757-105036779 ACTATTATTAGAGTTGCTTCTGG - Intronic
1014363784 6:120514629-120514651 CATGTTATCAGAATATTTTCTGG - Intergenic
1015296190 6:131596004-131596026 CAGATTTTTAGAGTTGCTTCCGG - Exonic
1015681806 6:135816647-135816669 TATATGATAAGATTTGTTTCTGG - Intergenic
1015932228 6:138373297-138373319 CATATTATAAGAAATGTGTCAGG - Intergenic
1016136218 6:140546842-140546864 CATTCTATTAGATTTGTTTCTGG + Intergenic
1016490066 6:144590319-144590341 CATATTAAAATAGTTGGTTCTGG + Intronic
1017530098 6:155281368-155281390 TATATTATGAGAGTTGTAACGGG - Intronic
1020719066 7:11718398-11718420 CATATTATCAGATGTGTCACAGG + Intronic
1021568742 7:22042481-22042503 CTTATTCTCAGATTTCTTTCTGG + Intergenic
1023007296 7:35885561-35885583 CAGAATTTCAAAGTTGTTTCTGG + Intronic
1023014136 7:35949706-35949728 CAAAATTTCAAAGTTGTTTCCGG + Intergenic
1023025724 7:36048126-36048148 GATATTGTCAAAGTTGTTTCAGG - Intergenic
1024066861 7:45745297-45745319 CAAAATTTCAAAGTTGTTTCCGG - Intergenic
1026359923 7:69594118-69594140 CATATTATCAGATTTCTTACTGG - Intergenic
1026463429 7:70633951-70633973 CATATCATCAGCATTGATTCTGG + Intronic
1027008670 7:74722424-74722446 AACCTTATCAGACTTGTTTCAGG + Intronic
1028429269 7:90728615-90728637 CATATTCTCTGAATTATTTCTGG + Intronic
1029189292 7:98760493-98760515 AATTTCATCAGTGTTGTTTCTGG + Intergenic
1030023121 7:105294865-105294887 CATATTATTAGAGAAGATTCTGG - Intronic
1030869998 7:114744227-114744249 AATAATACCAAAGTTGTTTCTGG - Intergenic
1033845498 7:145426937-145426959 CAAAATATCAGAGTTTTATCAGG + Intergenic
1034782104 7:153889787-153889809 CATATTTTCAGAGTTATTTGTGG + Intronic
1039249585 8:35647904-35647926 CAAATTATCTGAGTTGTCTTTGG - Intronic
1039898719 8:41735244-41735266 CATATTGTCAGACTTATTTGTGG - Intronic
1040905361 8:52464135-52464157 GACATTTTCAAAGTTGTTTCTGG - Intergenic
1040985310 8:53287386-53287408 GATATTATTACAGTTGTTTCTGG + Intergenic
1041183094 8:55269503-55269525 GGTATTATCAGAGTTGTTGAAGG + Intronic
1041903945 8:63011503-63011525 CATATAATGAGAGATGCTTCTGG - Intergenic
1044837486 8:96310513-96310535 CAAAGTCTCAGAGTTGTTTGTGG - Intronic
1044892968 8:96856733-96856755 CACATGAACTGAGTTGTTTCAGG + Intronic
1045405089 8:101858119-101858141 CATTTTATTAGAGTTGTGGCTGG - Intronic
1046039517 8:108885296-108885318 AATATTACCAGGATTGTTTCAGG + Intergenic
1046926972 8:119802170-119802192 TATTTTATCAGATTTTTTTCAGG - Intronic
1048287374 8:133152248-133152270 CATAATTTCAGATTTTTTTCTGG - Intergenic
1048309732 8:133311977-133311999 TATTTTATCAGACTTGATTCTGG + Intergenic
1048480601 8:134788393-134788415 CATAATTTCAGAGTAGTTGCGGG + Intergenic
1048698354 8:137055028-137055050 CATGTTATGAAAGTTGTTTTAGG + Intergenic
1049939284 9:529203-529225 TATATTAACAGAGTTATCTCTGG - Intronic
1050624814 9:7491917-7491939 CATTTTATGAGATTTGTTTCTGG + Intergenic
1051593689 9:18801978-18802000 CATATATTCAGAGTTGTGGCCGG + Intronic
1051794146 9:20845283-20845305 ATTATTATCAGAGTTATATCTGG - Intronic
1052333936 9:27300611-27300633 CATATTTTCAGAGGTGTTATGGG + Intergenic
1055410956 9:76028791-76028813 GCTATTATCAGTTTTGTTTCAGG + Intronic
1057060486 9:91999600-91999622 CATGTTCTCAGAGCTGTTTTGGG - Intergenic
1186005361 X:5064518-5064540 CATCTTATCAGAGTTGCTCTTGG + Intergenic
1186153162 X:6697904-6697926 AGTATTATCAGAGTAGTTTTAGG + Intergenic
1195085548 X:101410282-101410304 CATATTATCAAATTGCTTTCAGG + Intronic
1196316774 X:114235842-114235864 CATATTTTCAGAGCTATTTTTGG + Intergenic
1196590397 X:117480927-117480949 CATATTACCAGGGTTGGTTTTGG + Intergenic
1196632317 X:117956104-117956126 CACATTAGCAGAGTTGTCTGTGG - Intronic
1196691688 X:118565566-118565588 AAATTTATCAGATTTGTTTCAGG + Intronic
1197278563 X:124508685-124508707 GATATTATGAGATTTTTTTCTGG + Intronic
1197515686 X:127425590-127425612 CATAATATAATAATTGTTTCAGG + Intergenic
1199392180 X:147293249-147293271 TATATTAATAGAATTGTTTCAGG - Intergenic
1199693273 X:150325434-150325456 AATGTTAACAGAGTTCTTTCTGG + Intergenic