ID: 959050710

View in Genome Browser
Species Human (GRCh38)
Location 3:101522494-101522516
Sequence GGGGTGTTGCTGCATCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959050710_959050716 2 Left 959050710 3:101522494-101522516 CCAAAAAGATGCAGCAACACCCC 0: 1
1: 0
2: 0
3: 21
4: 127
Right 959050716 3:101522519-101522541 AAGAACACACGGCTTACATATGG 0: 1
1: 0
2: 1
3: 2
4: 104
959050710_959050718 28 Left 959050710 3:101522494-101522516 CCAAAAAGATGCAGCAACACCCC 0: 1
1: 0
2: 0
3: 21
4: 127
Right 959050718 3:101522545-101522567 TACTTCATTTCAAAGACTGAAGG 0: 1
1: 0
2: 2
3: 26
4: 257
959050710_959050711 -9 Left 959050710 3:101522494-101522516 CCAAAAAGATGCAGCAACACCCC 0: 1
1: 0
2: 0
3: 21
4: 127
Right 959050711 3:101522508-101522530 CAACACCCCCGAAGAACACACGG 0: 1
1: 0
2: 0
3: 8
4: 95
959050710_959050717 3 Left 959050710 3:101522494-101522516 CCAAAAAGATGCAGCAACACCCC 0: 1
1: 0
2: 0
3: 21
4: 127
Right 959050717 3:101522520-101522542 AGAACACACGGCTTACATATGGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959050710 Original CRISPR GGGGTGTTGCTGCATCTTTT TGG (reversed) Intergenic