ID: 959050710

View in Genome Browser
Species Human (GRCh38)
Location 3:101522494-101522516
Sequence GGGGTGTTGCTGCATCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959050710_959050716 2 Left 959050710 3:101522494-101522516 CCAAAAAGATGCAGCAACACCCC 0: 1
1: 0
2: 0
3: 21
4: 127
Right 959050716 3:101522519-101522541 AAGAACACACGGCTTACATATGG 0: 1
1: 0
2: 1
3: 2
4: 104
959050710_959050717 3 Left 959050710 3:101522494-101522516 CCAAAAAGATGCAGCAACACCCC 0: 1
1: 0
2: 0
3: 21
4: 127
Right 959050717 3:101522520-101522542 AGAACACACGGCTTACATATGGG 0: 1
1: 0
2: 0
3: 4
4: 62
959050710_959050718 28 Left 959050710 3:101522494-101522516 CCAAAAAGATGCAGCAACACCCC 0: 1
1: 0
2: 0
3: 21
4: 127
Right 959050718 3:101522545-101522567 TACTTCATTTCAAAGACTGAAGG 0: 1
1: 0
2: 2
3: 26
4: 257
959050710_959050711 -9 Left 959050710 3:101522494-101522516 CCAAAAAGATGCAGCAACACCCC 0: 1
1: 0
2: 0
3: 21
4: 127
Right 959050711 3:101522508-101522530 CAACACCCCCGAAGAACACACGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959050710 Original CRISPR GGGGTGTTGCTGCATCTTTT TGG (reversed) Intergenic
902027899 1:13397784-13397806 TGGGGATTGCTGCATCTTTTGGG - Intergenic
906814695 1:48866934-48866956 TGGATGTTGCTGCATATTCTAGG - Intronic
915752274 1:158222843-158222865 GGGGCGTTGCTGAAAGTTTTTGG + Intergenic
1064333545 10:14416856-14416878 GGAGAGTGGCTGCCTCTTTTTGG - Intronic
1064607893 10:17063114-17063136 GGGGTCCTGCAGCATTTTTTAGG - Intronic
1064964423 10:21000692-21000714 GGGGTGTTGCTTTCTCGTTTTGG - Intronic
1068196665 10:53726594-53726616 GGGGTGTGGCTCACTCTTTTGGG + Intergenic
1069058067 10:63865424-63865446 TGGGTGTTGCTGCATCCATTGGG - Intergenic
1075092940 10:119453605-119453627 GGCGTGTTGCTGCATCTGGTGGG - Intronic
1078168301 11:8910076-8910098 GGGGTCTGACTCCATCTTTTAGG - Intronic
1081063116 11:38504424-38504446 GGGGTTTTGCTACATTTCTTAGG - Intergenic
1082700137 11:56418866-56418888 GAGTTTTTGATGCATCTTTTAGG + Intergenic
1083743092 11:64721493-64721515 GAGGTGTGGCTGGATCTTTTGGG - Intronic
1084068152 11:66717461-66717483 GGTGTGTTGCTGTGTCTTATGGG - Intronic
1084640966 11:70425509-70425531 TGGTTGTTGCTGCGTATTTTTGG + Intronic
1084770392 11:71339369-71339391 AGGGTGTTGCTGCTTCATATTGG - Intergenic
1084833790 11:71788320-71788342 TGGGTGTTGCTTAATCATTTGGG + Intronic
1086108823 11:83176179-83176201 GGGGTGGTGCTGCATTGCTTGGG + Intronic
1086976112 11:93135047-93135069 TTGGTGTTGCTGTAACTTTTGGG + Intergenic
1087661212 11:100990620-100990642 GGTGTGTTGCTGGATCTTCTTGG + Exonic
1090034823 11:123239694-123239716 GGTGTGTTGCTGTAACATTTTGG + Intergenic
1090827384 11:130397368-130397390 CGTGTGTTGCTGCATTTTTACGG + Intergenic
1091594844 12:1870574-1870596 GGGTTGTTGCTGCCTGCTTTTGG + Intronic
1091952688 12:4608106-4608128 TGAGATTTGCTGCATCTTTTTGG - Intronic
1092925303 12:13266753-13266775 GGGGTGTAGCTGTATCAGTTTGG + Intergenic
1097874191 12:64628439-64628461 TGAGGGTTGCTGCAGCTTTTTGG + Intronic
1098607264 12:72406504-72406526 TGGGGGTTCCTGGATCTTTTTGG + Intronic
1099355545 12:81630368-81630390 AGGGAGTAGCTGCATCTTTTGGG - Intronic
1099664252 12:85607008-85607030 GGCTTGTTGCTGCAGATTTTTGG + Intergenic
1099870361 12:88340638-88340660 CGGGAGCTGCTGTATCTTTTTGG + Intergenic
1100140926 12:91617921-91617943 AGGATGTTGCTGCAGCTTTTGGG - Intergenic
1100829335 12:98503574-98503596 GGTGTGTAGCTGCACTTTTTTGG + Intronic
1101360689 12:104024039-104024061 GTGGTATTGCTGGGTCTTTTGGG + Intronic
1104159134 12:126161777-126161799 GGTGTGTTGCTGCAGCTTCAGGG - Intergenic
1106372048 13:29144387-29144409 GGGGTGTTGCTCTGTCTCTTAGG + Intronic
1106500844 13:30327450-30327472 GGGGCTTTGCTGCACATTTTGGG - Intergenic
1107698826 13:43026470-43026492 GGGGTTGTTCTGCTTCTTTTGGG + Intronic
1110109529 13:71727393-71727415 GGGCTGTTGGTGTATCTTGTAGG - Intronic
1110480476 13:75968405-75968427 GGTGTGTTTCTACATCTCTTAGG + Intergenic
1111006468 13:82256236-82256258 GGGGGGTGGCTGCACCATTTTGG + Intergenic
1115320331 14:32073777-32073799 GGGGTGTAGCTGCCTCTATAGGG + Intergenic
1119989193 14:79175976-79175998 GAGGTGTTGTTGCTTCCTTTAGG + Intronic
1120527679 14:85596040-85596062 GGGCTGTGGCTGCATCTCTCAGG + Intronic
1122627994 14:103094043-103094065 GGGGTGAGGCTGCCTCTTCTGGG + Intergenic
1123110331 14:105864155-105864177 AGGGTTTTGCTGCATTTTTGGGG - Intergenic
1125091636 15:35799721-35799743 GGGGTTTTGCTGGCACTTTTAGG - Intergenic
1127822118 15:62667405-62667427 TGGGTGTTCCAGCATCCTTTGGG + Intronic
1131249331 15:90820256-90820278 GGGCTGCTGCAGCATCCTTTTGG + Intergenic
1133418694 16:5626558-5626580 GGGGTATTCCAGGATCTTTTTGG - Intergenic
1135379095 16:21978885-21978907 CAGCTGTTGCTGCCTCTTTTAGG - Intronic
1136114017 16:28083176-28083198 GGGATGTGGATGTATCTTTTGGG + Intergenic
1136156565 16:28386831-28386853 GGGGTGTGTGTGTATCTTTTAGG - Intronic
1136206521 16:28728450-28728472 GGGGTGTGTGTGTATCTTTTAGG + Intronic
1139115825 16:63950868-63950890 TGGCTGTTGCTGAATCTTTAGGG - Intergenic
1140808792 16:78557455-78557477 GGGGTTTTCCTGCTTGTTTTTGG - Intronic
1141160200 16:81624577-81624599 GGGGTGATGCTGCCCCTGTTGGG - Intronic
1141663147 16:85452572-85452594 GGGGTGCTGCTGCATCTCAAAGG + Intergenic
1142544973 17:694765-694787 GGGGTTTTGCTGTTGCTTTTGGG + Intronic
1143640096 17:8190984-8191006 GGGGGGTGGCTGCGTCTTTTTGG - Intergenic
1145983144 17:29026127-29026149 GGGGTCTTGCTGCATTGCTTAGG + Intronic
1146668572 17:34721313-34721335 GGGGAGTTGCAGCATCTCTAAGG - Intergenic
1148777702 17:50104917-50104939 GGGGTGTTGTTGCATCCAGTGGG - Intronic
1150949973 17:69792259-69792281 GGGGTGTTACTGAAGATTTTGGG + Intergenic
1151414986 17:73956230-73956252 GGGGAGTTTCTGGATCTTTCTGG - Intergenic
1153313766 18:3702469-3702491 GGTCTGTTGCTGCCTCTCTTGGG - Intronic
1155395120 18:25378751-25378773 GGGATGTTGCTGCTAGTTTTGGG - Intergenic
1157689156 18:49666788-49666810 GTGGTGTTGCTGTTTCATTTTGG - Intergenic
1158708504 18:59816542-59816564 GGAGTCTTGCTGCATCGCTTAGG - Intergenic
1160217602 18:76946486-76946508 GGGGTGTTTCTCAATGTTTTAGG - Intronic
1160905667 19:1450606-1450628 GGGGTGTTGCTGCACCTCTCTGG + Intronic
1162496456 19:11025788-11025810 GGGGTCCTGCTGCGTCTCTTTGG + Intronic
1163109114 19:15147693-15147715 AGGGTGTTGCTGCATCTTGAAGG - Intergenic
926365565 2:12129952-12129974 GGGGTGTCCCTGCCTCTTCTGGG + Intergenic
928776415 2:34769460-34769482 GTGGGGTTGCTGCATCATATTGG + Intergenic
929405018 2:41631581-41631603 GGGATGTTGCTAAATCATTTAGG - Intergenic
931502711 2:62887700-62887722 GGGATCTTGCTGCATCTCTAAGG - Intronic
932304680 2:70693648-70693670 GGAGAGTTGCTGCAGCTTTTAGG - Intronic
932888514 2:75569849-75569871 GTGGGGTTGCTGCCTCTGTTTGG - Intergenic
934664291 2:96158933-96158955 AGGGTGTTGCTGACTGTTTTTGG + Intergenic
935709565 2:105885666-105885688 GTGGTGATGCTGCTGCTTTTGGG + Intronic
935737489 2:106117946-106117968 GGGGTGTGTCTGCATCTGTTTGG + Intronic
936051392 2:109226727-109226749 GGCGTGGTGCTGGATCTTTAGGG + Intronic
936456964 2:112682618-112682640 GGGGTGTTGCTGGATGATTTAGG + Intergenic
936496028 2:113021920-113021942 TTTTTGTTGCTGCATCTTTTGGG + Intergenic
936822332 2:116538668-116538690 GGGTTGTTGATACATTTTTTAGG - Intergenic
937863569 2:126731775-126731797 CTGCTGCTGCTGCATCTTTTTGG - Intergenic
942040386 2:172055880-172055902 TGGGTGTGTCTGCATCTTTTCGG + Intronic
947027272 2:225750479-225750501 GAGGTGTTGTTGCCTTTTTTTGG - Intergenic
948074562 2:235155893-235155915 AGGGTGTTGCTGGAACTATTGGG - Intergenic
1169663181 20:8003684-8003706 GAGGTTTTTCTGCATCTTTCTGG + Intronic
1179658279 21:42859219-42859241 GGGGTGTTGCTACATTTTTCAGG - Intronic
1180217755 21:46336697-46336719 GGGATGTTGCTGCTGCTTCTGGG + Intronic
951560731 3:23963895-23963917 GGTGTGTTTCATCATCTTTTTGG + Intronic
956799592 3:72744933-72744955 GGGTGGTTTCTGCATCTTTAAGG + Intergenic
959050710 3:101522494-101522516 GGGGTGTTGCTGCATCTTTTTGG - Intergenic
959090226 3:101894566-101894588 GGGGTGGTGCTGTGTATTTTGGG + Intergenic
964181932 3:153898673-153898695 AGGGTTTTGCTGCACATTTTAGG - Intergenic
967633227 3:191771583-191771605 AGGGGATTGCTGTATCTTTTGGG - Intergenic
969514133 4:7637180-7637202 GGGATGTTGACGAATCTTTTTGG + Intronic
969688581 4:8690684-8690706 TGGGTGGTGCTGCATGTTCTGGG + Intergenic
971670458 4:29548595-29548617 GGGGTATTGCTACATGTATTTGG + Intergenic
972173088 4:36371081-36371103 GAGGTTTTTCTGTATCTTTTAGG - Intergenic
975713672 4:77185539-77185561 GGAATGTTGCTTCATCTTTTCGG + Intronic
976619551 4:87114544-87114566 GGGGCTTTGCTGGAGCTTTTAGG - Exonic
980681784 4:136172019-136172041 GGGGTCTTGCAGCATATTGTAGG - Intergenic
982465647 4:155727191-155727213 GGGCTGTTGCTGCCTTTTTTGGG + Intronic
983616861 4:169716232-169716254 TGTGTGTTTCTCCATCTTTTAGG + Intronic
983651532 4:170041007-170041029 GGGGTGTTGCTTTTTCTTTGGGG - Intergenic
986169906 5:5306922-5306944 CAAGTGTTGCTGAATCTTTTAGG + Intronic
987595529 5:19992895-19992917 TGGGTGTTGCTACAATTTTTGGG + Intronic
988210271 5:28194868-28194890 TGGGTGTTGCAACATTTTTTTGG - Intergenic
988226635 5:28421200-28421222 GAGGTTTTCCTTCATCTTTTTGG - Intergenic
990947593 5:61265086-61265108 GGGGTGAAGAGGCATCTTTTTGG - Intergenic
993188160 5:84646297-84646319 GGGGTGTGGCTGGCTTTTTTTGG - Intergenic
999102454 5:149037668-149037690 CGGGTATTGCTCCATCTTTTTGG - Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1007036336 6:38677894-38677916 TGGGACTGGCTGCATCTTTTAGG + Intronic
1008541290 6:52548592-52548614 GGCGTGTTGCTTAAGCTTTTTGG - Intronic
1023430867 7:40089617-40089639 TGGGTGTTTCTGGATGTTTTAGG - Intronic
1024569498 7:50712057-50712079 GTGGAGTTTCTGCATGTTTTAGG - Intronic
1024615851 7:51111207-51111229 GTGGGATTGCTGCATCATTTAGG + Intronic
1024800954 7:53077357-53077379 GGGCTGTTGATACATCTTGTTGG + Intergenic
1025816794 7:64920781-64920803 GGGGTGTTGCTGCATAATCCAGG + Intronic
1026262815 7:68770502-68770524 GTGGTGGTGCTGGATATTTTGGG - Intergenic
1027933815 7:84576361-84576383 GGTGTGTTGCTGCAGTTTTCAGG + Intergenic
1031267058 7:119594316-119594338 GTGGTGCTTCAGCATCTTTTTGG + Intergenic
1034668694 7:152840465-152840487 GGGGGTTTGCTGCTTCTTTCAGG + Intronic
1038254153 8:25935196-25935218 GGGGTGTTGCTGCAGCCAGTTGG + Intronic
1045782701 8:105886450-105886472 TGGGTATTGCTGCATCTTCTTGG - Intergenic
1048316084 8:133363298-133363320 GGGGTGTTGCTTCATCCATAGGG + Intergenic
1055582667 9:77723795-77723817 GGGGTGTTGCTGCTTAATTGGGG + Intronic
1055928362 9:81533698-81533720 GAGGTTTTGCTGCATCTGTCAGG - Intergenic
1056939782 9:90945254-90945276 GGGGTGTTGCCAGATTTTTTTGG + Intergenic
1057277715 9:93684841-93684863 GGGGTATTGCTGTATTTTATAGG - Intergenic
1057966768 9:99511966-99511988 GAGTTCTTGCTGCATCCTTTGGG + Intergenic
1058151894 9:101472761-101472783 CAGGTGTTGCTGCATGTTCTTGG + Intergenic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1188681326 X:33011001-33011023 TGCGTTTTGCTGCATCGTTTTGG + Intronic
1192967943 X:76199859-76199881 ATGGTGTTTCTGCATCTATTGGG + Intergenic
1195862997 X:109400930-109400952 GGCATGTGGCTGCTTCTTTTTGG + Intronic
1196061365 X:111411263-111411285 GAGGTGTTGCTGCATCAGTGGGG - Intronic
1196109384 X:111929962-111929984 GGAGTGTTACTGTATCTGTTAGG - Intronic
1199607157 X:149586291-149586313 GGGGTGCTGCTGGATTATTTGGG + Intronic
1199631965 X:149783077-149783099 GGGGTGCTGCTGGATTATTTGGG - Intronic
1199634828 X:149805278-149805300 GGGGTGGTGCTGGATTATTTGGG - Intergenic
1199788883 X:151131062-151131084 GTGGTGTGGCTACATGTTTTAGG + Intergenic
1199947328 X:152679874-152679896 GGGGTGGTGCTGGATTTTTTAGG - Intergenic
1199962352 X:152788580-152788602 GGGGTGGTGCTGGATTTTTTAGG + Intergenic
1200017937 X:153180101-153180123 GGGGTGGTACTGGATCATTTTGG - Intronic