ID: 959056947

View in Genome Browser
Species Human (GRCh38)
Location 3:101576509-101576531
Sequence TGGCCGCCGTGGCCGCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959056947_959056953 1 Left 959056947 3:101576509-101576531 CCACGGTGCGGCCACGGCGGCCA 0: 2
1: 0
2: 1
3: 13
4: 91
Right 959056953 3:101576533-101576555 TGGTCTTGGTGTGCTGGCCTCGG 0: 5
1: 2
2: 5
3: 23
4: 406
959056947_959056951 -5 Left 959056947 3:101576509-101576531 CCACGGTGCGGCCACGGCGGCCA 0: 2
1: 0
2: 1
3: 13
4: 91
Right 959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG 0: 4
1: 1
2: 7
3: 20
4: 168
959056947_959056954 10 Left 959056947 3:101576509-101576531 CCACGGTGCGGCCACGGCGGCCA 0: 2
1: 0
2: 1
3: 13
4: 91
Right 959056954 3:101576542-101576564 TGTGCTGGCCTCGGACACGAAGG 0: 5
1: 0
2: 3
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959056947 Original CRISPR TGGCCGCCGTGGCCGCACCG TGG (reversed) Intronic
900900851 1:5514731-5514753 TGGCCACCGGGGGCGCAGCGAGG + Intergenic
902176950 1:14657556-14657578 TTGCCGCCTTTGCCGCACTGAGG + Intronic
903750621 1:25618148-25618170 GGGCCGCCGTGGCCTCCTCGCGG - Exonic
906662589 1:47593438-47593460 TTGCCGCCCTGGCTGGACCGCGG + Intergenic
912381320 1:109249658-109249680 GGGCCGCCGGGGCCGGGCCGGGG + Intergenic
914192790 1:145425659-145425681 TGGCCGCCTCTGCCGCACAGCGG + Intergenic
914311722 1:146472510-146472532 TGGCCGCCTCTGCCGCACAGCGG - Intergenic
914900540 1:151709030-151709052 TGGCCGCCTGGGCCTCAGCGTGG + Exonic
922701139 1:227761828-227761850 TTGCCGACCTGGCTGCACCGTGG + Intronic
1063950484 10:11217752-11217774 TGGCAGCCGTGGCTGCCCAGTGG - Intronic
1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG + Intergenic
1073297632 10:102450747-102450769 TGGGCGCCGTGGCCGGAGGGCGG - Exonic
1081699944 11:45146696-45146718 TCGCCGCCGCCGCCGCGCCGAGG + Intronic
1082162390 11:48900200-48900222 TGGGCACCATGGCCGCTCCGGGG - Intergenic
1083463704 11:62831906-62831928 TGGCCGCCGTGTCAGCTCTGGGG - Intronic
1084270548 11:68027060-68027082 TGGTGGCCGTGGCCCCACCCCGG + Intronic
1085295804 11:75431016-75431038 AGGGCGCCTTGGCCGCCCCGGGG + Intergenic
1089104290 11:115989385-115989407 TGGCCACCCTGGCCACACTGTGG + Intergenic
1091616094 12:2052607-2052629 TGGCCGCGGTGGCCGCGGCGCGG - Intronic
1103822843 12:123712390-123712412 CGGCCGCGGTGGCAGAACCGGGG + Exonic
1104847895 12:131855944-131855966 AGGGCGCCGTGGCTGCAGCGGGG + Intergenic
1106498783 13:30307470-30307492 TGGCAGCCGCGGCCGCGCGGTGG + Exonic
1117842120 14:59870642-59870664 AAGCCGCCGTCGCCGCGCCGGGG - Exonic
1121043168 14:90766947-90766969 TGGCCGCCATGGCCGCACTGTGG + Intronic
1121721103 14:96109232-96109254 TGGGTGCCGTGGGCGCACCCAGG - Intergenic
1122230886 14:100305941-100305963 GGGGCGCCGGGGCAGCACCGTGG - Intronic
1122969397 14:105146384-105146406 TGGCCGCCGTGACTGCAGCAAGG - Exonic
1123464569 15:20506000-20506022 TGGGCGCGGCGGCCGCACCGGGG - Intergenic
1123653545 15:22495041-22495063 TGGGCGCGGCGGCCGCACCGGGG + Intergenic
1124275298 15:28321967-28321989 TGGGCGCGGCGGCCGCACCGGGG - Intronic
1124307406 15:28589634-28589656 TGGGCGCGGCGGCCGCACCGGGG + Intergenic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1125589132 15:40843902-40843924 TGGCTGCCGGGGAGGCACCGGGG + Intergenic
1128161092 15:65423101-65423123 TGGCCACCCTGGCCCCGCCGGGG + Intergenic
1132709271 16:1259255-1259277 AGCCTGCCGTGGCCGCACTGAGG + Intergenic
1132759683 16:1502580-1502602 TGCCCGCCGAGGCCTCACCGAGG - Intronic
1132853675 16:2035585-2035607 TGGCCACCGCCGCCGCACCCTGG + Intronic
1134648318 16:15888593-15888615 CGGCCGCCAGGGCCGCACCGCGG + Exonic
1138598441 16:58041656-58041678 TGGCCGCCGTGGCGTCACAGTGG - Exonic
1139974783 16:70800938-70800960 CGGCTGCCGGGGCCGCGCCGGGG + Exonic
1141608761 16:85169902-85169924 CGGCCGCCGTGGCGGCGCCGGGG + Intergenic
1141701201 16:85642902-85642924 AGGCGGGCGTGGCCTCACCGTGG - Intronic
1141727400 16:85799147-85799169 TGGGCGCCGGGGCCGCCCAGGGG + Exonic
1142957468 17:3531531-3531553 TGCCCGCTGTGGCCGGCCCGGGG - Intronic
1143904692 17:10198919-10198941 TGGCCGCCCTGGCCCCGCCCCGG - Intergenic
1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG + Exonic
1155474689 18:26226460-26226482 TGGCTGGCGTGGCCGCGCGGCGG + Exonic
1160499105 18:79393826-79393848 TGGCCGCAGAGGCCGGGCCGGGG + Intergenic
1161410787 19:4116075-4116097 TGGGCACCGTGGTCTCACCGAGG - Intronic
1164157880 19:22607495-22607517 TGGCCTACCTGGCCCCACCGAGG - Intergenic
1165013500 19:32864849-32864871 GGGCCGCCCTGGCCGTACCGAGG - Intronic
1166350655 19:42196539-42196561 AGGCCGGCGTGGCCCCACGGAGG - Intronic
1167145649 19:47679833-47679855 TGGCCGCCGTGGCACCCCCAGGG - Exonic
925236314 2:2280919-2280941 TGTCCCCTATGGCCGCACCGAGG - Intronic
925327953 2:3037342-3037364 GGGACCCCGTGGACGCACCGGGG - Intergenic
927210454 2:20635990-20636012 TCCCCGCCGTGGCCGCGGCGAGG - Intronic
928540277 2:32278080-32278102 TCGCCGCCGCGGCCGCCTCGGGG + Exonic
937045131 2:118847101-118847123 TCGCCGCCGCCGCCGCGCCGAGG + Exonic
937345928 2:121125245-121125267 TGGCTGCCGTGGGAGCACCCAGG - Intergenic
1169430679 20:5533293-5533315 TGGCCGCTGTGGCCATACCATGG + Intergenic
1170881286 20:20298588-20298610 TGGCCCCCATGGCCACACCAGGG + Intronic
1174402382 20:50282974-50282996 TGGTGGCCGTGGCCGAAGCGGGG - Intergenic
1175946880 20:62563055-62563077 AGGCCGCAGTGGCCTCCCCGTGG + Intronic
1178493691 21:33070293-33070315 GGGCCGCTGTGGCCGCAGCATGG - Exonic
1179457347 21:41508366-41508388 TGGCCGCTGTGGCCGGGCCCGGG - Intronic
1180110314 21:45644259-45644281 CAGCCGCCGCGGCCGCTCCGGGG - Intronic
1181031686 22:20151088-20151110 TGACCGCCCTGGCTGCACCCAGG - Intergenic
1183079873 22:35449532-35449554 TGGCCGCTGTGTCCCAACCGTGG + Intergenic
1183713519 22:39520541-39520563 TGGCTGCCGTGGCCGCCCGCCGG - Intronic
956178917 3:66500294-66500316 TGACCGCCGCGGCCGGCCCGCGG - Exonic
959056947 3:101576509-101576531 TGGCCGCCGTGGCCGCACCGTGG - Intronic
968540783 4:1167336-1167358 TGGTCGGCGCGGCCTCACCGCGG + Exonic
968556194 4:1247675-1247697 TGGCGGCTGGGCCCGCACCGCGG - Intronic
969330800 4:6472539-6472561 TCGCCGCCGTCGCCGCAGCCAGG - Intronic
981010288 4:139918350-139918372 TGGCCGCGCTGGCCTCTCCGAGG + Intronic
985579345 5:688849-688871 TGGCCACCGTGGCTGCATCTGGG - Intronic
987193191 5:15500223-15500245 TGGCCGCCGCGCCCTCCCCGGGG + Exonic
994710590 5:103259428-103259450 TGGCCGCTGTTCCCGCACCGCGG + Intronic
996442998 5:123512623-123512645 AGGGCGCCGCGGCCGCGCCGAGG - Intronic
998963155 5:147509644-147509666 TCGCTGCCCTGGCCGCTCCGAGG + Exonic
1000350618 5:160349689-160349711 TGGCCCCCGTGGCCCCAAGGGGG - Exonic
1002926998 6:1610523-1610545 CGGCCGCCGCGGCCGCCGCGCGG - Exonic
1006313280 6:33276424-33276446 TGGCCGCCGTGGCCGCACCGTGG + Exonic
1007363366 6:41373706-41373728 TGGCCACCGTGGGCCCACAGAGG + Intergenic
1012624919 6:101393546-101393568 TGGCCGCCGCGGCCACTCGGGGG - Intergenic
1016597025 6:145814603-145814625 CGGCCGGCGCGGCCGAACCGCGG + Exonic
1016952581 6:149594501-149594523 AGGCTGCCGTGGCCGCATCGTGG + Intergenic
1018224549 6:161615777-161615799 TGGCTGCAGTGGCTGCAACGTGG + Intronic
1019562532 7:1665763-1665785 TGGCGGCCGCGGCAGCGCCGAGG - Intergenic
1019578168 7:1747528-1747550 TGGCCGGCGTGGCCACCTCGGGG + Exonic
1019712102 7:2522467-2522489 TGGCCGCTGTGGTGGCAGCGCGG - Intronic
1023038550 7:36153393-36153415 CCGCCGCCGAGGCTGCACCGGGG - Exonic
1024637628 7:51303314-51303336 TGGCCGCCTTGGCCTCCCAGAGG - Intronic
1027365954 7:77458232-77458254 TGGCCTCCTTGACCGCACCAGGG - Intergenic
1029462832 7:100706141-100706163 TGGGCGCCCTGCCCGCGCCGGGG - Exonic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1037879538 8:22566091-22566113 CGGCCGCCGGGGGCGCAGCGCGG + Intronic
1047745328 8:127840612-127840634 TGGCAGCCCTGGCCACACCTTGG + Intergenic
1048636773 8:136305026-136305048 TGTCCACCGTGGCCCCACTGTGG + Intergenic
1057533385 9:95875265-95875287 TGGCCCCCGTGGCTGTCCCGGGG + Intergenic
1057684723 9:97221863-97221885 TGCCCGCGGCGGCTGCACCGGGG - Intergenic
1060296530 9:122347149-122347171 CGGCCGCCCGGGCCGCTCCGCGG - Intergenic
1060555351 9:124504915-124504937 CCGCCGCCGGGGCCGCTCCGAGG + Intronic
1062651281 9:137578964-137578986 TGGCCTCCGTGGACGCCCCTGGG + Intergenic
1187181486 X:16947053-16947075 CGGCCGCAGTGGCCGTGCCGGGG - Exonic
1198451158 X:136767898-136767920 TGGCCGCCGCGGGTACACCGCGG - Intronic
1198934932 X:141895510-141895532 TGGCCGCCGAGGGCTGACCGAGG + Exonic