ID: 959056951

View in Genome Browser
Species Human (GRCh38)
Location 3:101576527-101576549
Sequence GGCCAGTGGTCTTGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 4, 1: 1, 2: 7, 3: 20, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959056940_959056951 24 Left 959056940 3:101576480-101576502 CCTACAGACTTATTTCTTCTTGG 0: 6
1: 5
2: 3
3: 22
4: 222
Right 959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG 0: 4
1: 1
2: 7
3: 20
4: 168
959056947_959056951 -5 Left 959056947 3:101576509-101576531 CCACGGTGCGGCCACGGCGGCCA 0: 2
1: 0
2: 1
3: 13
4: 91
Right 959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG 0: 4
1: 1
2: 7
3: 20
4: 168
959056946_959056951 -4 Left 959056946 3:101576508-101576530 CCCACGGTGCGGCCACGGCGGCC 0: 2
1: 1
2: 2
3: 9
4: 67
Right 959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG 0: 4
1: 1
2: 7
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959056951 Original CRISPR GGCCAGTGGTCTTGGTGTGC TGG Intronic