ID: 959056951

View in Genome Browser
Species Human (GRCh38)
Location 3:101576527-101576549
Sequence GGCCAGTGGTCTTGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 4, 1: 1, 2: 7, 3: 20, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959056940_959056951 24 Left 959056940 3:101576480-101576502 CCTACAGACTTATTTCTTCTTGG 0: 6
1: 5
2: 3
3: 22
4: 222
Right 959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG 0: 4
1: 1
2: 7
3: 20
4: 168
959056947_959056951 -5 Left 959056947 3:101576509-101576531 CCACGGTGCGGCCACGGCGGCCA 0: 2
1: 0
2: 1
3: 13
4: 91
Right 959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG 0: 4
1: 1
2: 7
3: 20
4: 168
959056946_959056951 -4 Left 959056946 3:101576508-101576530 CCCACGGTGCGGCCACGGCGGCC 0: 2
1: 1
2: 2
3: 9
4: 67
Right 959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG 0: 4
1: 1
2: 7
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959056951 Original CRISPR GGCCAGTGGTCTTGGTGTGC TGG Intronic
902378126 1:16039781-16039803 GGCCAGAGGACTTGGTGAGCTGG - Intergenic
902383216 1:16062277-16062299 GGCCAGAGGACCTGGTGAGCTGG - Intronic
903639429 1:24848389-24848411 TGCCAGCGGTCTGGGTGTGACGG + Intergenic
906344098 1:45004492-45004514 GGCCAGAGTTCTTGGAGTACTGG + Intronic
915272158 1:154760895-154760917 GGCCAGTGGCCTTGGTGGACAGG - Intronic
915470931 1:156125380-156125402 GGGCAGAGGTCTAGGTGTCCAGG + Intronic
916734100 1:167591787-167591809 AGCCAGTGGTCTTGGCATGCTGG - Intergenic
919981808 1:202646488-202646510 GGCCAGTAGGCTCGGTGAGCAGG - Intronic
920702155 1:208226016-208226038 GGAGAGGGGTCTGGGTGTGCAGG + Intronic
920787009 1:209051323-209051345 GCCCAGAGGGCTTGGTGTGGGGG + Intergenic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1066659191 10:37723067-37723089 GGCCAGTTGTCCTGGTGCTCAGG + Intergenic
1067256428 10:44647317-44647339 GGCCGGTGGGCGTGGTTTGCTGG - Intergenic
1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG + Intronic
1070361869 10:75698327-75698349 GGCCAGTGTTCTTACTTTGCTGG - Intronic
1070390723 10:75968132-75968154 GGTCTGTGGTCTTGGTGGACAGG + Intronic
1073466301 10:103696391-103696413 GGGAAGTGGTCATGGTGTGAAGG - Intronic
1074783083 10:116816158-116816180 AGCCAGTGGTCTTTGCGTGAGGG - Intergenic
1076457574 10:130611379-130611401 GGACTGTTGTCTTGGTGTGTGGG + Intergenic
1077546355 11:3171976-3171998 TGCCATTGGTTTTGGTGAGCCGG + Intergenic
1083756825 11:64796413-64796435 GGCCTGGGGTGTTGGTGGGCAGG + Intronic
1083779164 11:64909290-64909312 GCCCAGTGCTCTTGGGGTCCAGG + Exonic
1084793673 11:71490546-71490568 GGACAGAGGTCTTGGGGTGTCGG - Intronic
1085279523 11:75320827-75320849 GCCCAGTGGTCTGGGAGTCCAGG - Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1088642763 11:111889360-111889382 AGCAAGTGTACTTGGTGTGCTGG + Intergenic
1088658487 11:112024958-112024980 GGGCGGGGGTCTTGGAGTGCTGG - Exonic
1090404355 11:126468013-126468035 GGCCAGTGGTCCTGGTGGTAGGG + Intronic
1090948021 11:131448784-131448806 GGCCAGTGATGTTGGTGACCCGG + Intronic
1091051151 11:132373859-132373881 GGCAAGTTGTGGTGGTGTGCTGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094708384 12:32936908-32936930 GGCCATGGATCTTGGTGTGGTGG + Intergenic
1098155075 12:67589337-67589359 GGCCAGGTTTCTTGGTGTGTAGG - Intergenic
1101963984 12:109269569-109269591 GGACAGAGGTCTTGTTGGGCAGG + Intergenic
1102653886 12:114463618-114463640 GGCAACTGAGCTTGGTGTGCAGG - Intergenic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1104141809 12:125994594-125994616 TGCCAGTGGTCTTTCTGTTCTGG + Intergenic
1104688948 12:130809999-130810021 GACCTGGGGTCTTGCTGTGCTGG - Intronic
1107243425 13:38264837-38264859 GCCAAGTGGTCTTGGTCTGTGGG + Intergenic
1108959924 13:56214191-56214213 GGGCACTGGTCTTGGTCTCCTGG + Intergenic
1112053892 13:95671803-95671825 GGCAAGTCCTCTTGCTGTGCTGG - Intergenic
1112183395 13:97106483-97106505 GGCCAGTGGCCTTGGCATGGGGG - Intergenic
1112349983 13:98624889-98624911 GTCCAGTGATCTGGGAGTGCTGG - Intergenic
1113572321 13:111367073-111367095 GGACAGTGACCTTGGTGTGGGGG + Intergenic
1113928179 13:113952605-113952627 GGCCAGTGGTCCTGGGGTGGTGG - Intergenic
1114484292 14:23053885-23053907 GGACAGTGGCCTTGGTGGTCAGG + Intronic
1115183524 14:30657100-30657122 TGCCAGTGGTGTTGGTGTTAAGG + Intronic
1120216416 14:81685216-81685238 GGCCAGTGGTCCTGGTTTTCAGG + Intergenic
1121015433 14:90546166-90546188 GGCCAGTCCTCTAGCTGTGCTGG - Intronic
1121019536 14:90570805-90570827 GCCCGGTGGTGTTGCTGTGCGGG - Intronic
1121941826 14:98078170-98078192 GGACAGTGGTGATGATGTGCAGG - Intergenic
1122432655 14:101665544-101665566 GACTAGTGGTCTTGGTGTAAGGG + Intergenic
1122796783 14:104210081-104210103 GGCCAGTGGGCTGTGGGTGCTGG + Intergenic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1125599193 15:40906433-40906455 GGCCACTGGTCCTGGGGAGCAGG + Intergenic
1125693445 15:41615636-41615658 GGCCTGTGGGCTGGGTGTGGTGG + Intergenic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1128606495 15:69040079-69040101 GGCCAGGGGTCCTGCTGGGCTGG - Intronic
1128636460 15:69305558-69305580 GGCCACTGACCTTAGTGTGCGGG - Intronic
1129892715 15:79082138-79082160 GGCCAGTGGACTGGGGGTGGGGG + Intronic
1130316914 15:82803800-82803822 GGGCAGTGATCTTGGGGAGCAGG - Intronic
1132025772 15:98403390-98403412 GGCCACGTGTCTTGGAGTGCAGG - Intergenic
1138976548 16:62214582-62214604 GCCCAGAGGATTTGGTGTGCAGG - Intergenic
1140505590 16:75470104-75470126 GGCCAGGGGGTCTGGTGTGCTGG - Intergenic
1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG + Intronic
1142640268 17:1281355-1281377 GGCCAGAGGACTAGGTGTGGAGG + Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1146641783 17:34547332-34547354 GGGCAGTGGCCTTGTTTTGCAGG + Intergenic
1149008519 17:51830896-51830918 GGCCTGTGGTCTAGCTGTGAAGG - Intronic
1150540186 17:66088827-66088849 GGCCAGGGGCCTGAGTGTGCAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1150709662 17:67519833-67519855 GGCAAGTGGTTTTGGGGTTCTGG - Intronic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1154492588 18:14933242-14933264 GGTTAGTGGTCCTGGTGGGCTGG - Intergenic
1157018612 18:43750678-43750700 GGCCAGTGATCGTGGGGTGGGGG + Intergenic
1158880860 18:61778585-61778607 GGGCAGGGGTTTTGGGGTGCTGG + Intergenic
1159020056 18:63135995-63136017 CCTCAGTGGTCTTGGTGTCCGGG - Intronic
1160806285 19:993601-993623 GGGCAGTGGCCTTGCTGGGCCGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1166326176 19:42052442-42052464 GGCCAGTGATCCTGTTGTGGAGG - Intronic
1166357405 19:42235344-42235366 AGCCAGTGGTTTTGGTGAGGGGG - Intronic
926207101 2:10841579-10841601 TGCCAGTGGGGCTGGTGTGCAGG - Intergenic
927503289 2:23596378-23596400 GAGCAGAGGTCTTGGTGTCCTGG + Intronic
928130101 2:28642985-28643007 GGACAGTGGTCTGGAGGTGCAGG + Exonic
928767896 2:34670285-34670307 AGCCGGTGGACTTGGGGTGCAGG + Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
932793378 2:74674676-74674698 GGTGAGGGGTCTTGGTGTGGAGG + Exonic
935089443 2:99880568-99880590 GGCCAGGGGTCCTAGTGTGAGGG - Intronic
937100124 2:119262100-119262122 GGCCTGTGGTCTGGGTGACCTGG - Intronic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
937960453 2:127454054-127454076 GGCCAAAGGTCTTGGTCAGCTGG + Intronic
938571885 2:132568889-132568911 AGCCAGTGGCCTTGCTGGGCAGG + Intronic
938593308 2:132761373-132761395 GACCAGTGGTCCCAGTGTGCTGG - Intronic
944100369 2:196019910-196019932 GGAGATTGGTCTTGCTGTGCGGG - Intronic
944754245 2:202743147-202743169 TGGCAGTGGGCCTGGTGTGCTGG - Intronic
947484993 2:230539868-230539890 GGACAGAGGTGATGGTGTGCAGG + Intronic
947797511 2:232904265-232904287 GGTCCCTGGTCTTGGTGGGCTGG - Intronic
948031828 2:234824327-234824349 GGCCAGTGCTCCTGCTGTGTGGG - Intergenic
1169094761 20:2887423-2887445 GGCCAGTGATGATGGTGTTCTGG + Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1169831567 20:9831046-9831068 GCCCAGTGGGCTGGGTGTGGGGG + Intronic
1170732689 20:18988348-18988370 GGCCAGTGGTCCTGGAATGAGGG + Intergenic
1172690279 20:36785155-36785177 GGCCAGCCGTGTTGGGGTGCAGG + Exonic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1175243138 20:57564403-57564425 TGCCAGAGGCCTTGGTGTGCCGG + Intronic
1175675772 20:60945601-60945623 GGGCAGTGGCCTGGGTCTGCAGG - Intergenic
1177670929 21:24226066-24226088 TGCCAGTGGCCAAGGTGTGCGGG - Intergenic
1177977768 21:27872414-27872436 GGCCAGAGGTCTTGGTGCAGGGG - Intergenic
1179410715 21:41160900-41160922 GGACAGTGTTCTTGGTGCGCTGG + Intergenic
1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG + Intergenic
1180835738 22:18928639-18928661 GGGCATTGGTCTGGCTGTGCAGG - Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183323915 22:37181109-37181131 GGCCTGTGTTCTGGGTGTTCAGG - Exonic
1203285827 22_KI270734v1_random:153938-153960 GGGCATTGGTCTGGCTGTGCAGG - Intergenic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG + Intronic
958594275 3:96201557-96201579 GGGTAGTGGTTGTGGTGTGCTGG - Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960840970 3:121958198-121958220 AGCCAGTGGACTTGGGGGGCAGG + Intergenic
961426285 3:126851131-126851153 GGCCAGTGGGCTTGGGTGGCTGG - Intronic
961544547 3:127623291-127623313 GTCCAGTGGTCTTGGAGAGCTGG + Intergenic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
961811242 3:129523116-129523138 GGCCAGTGTTCTGGATCTGCAGG - Intergenic
963487719 3:145957213-145957235 GACCAGTGGTCTAAGAGTGCAGG - Intergenic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
964790528 3:160450092-160450114 GGCCAGTGGGCCTCGTGAGCTGG + Intronic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
967870336 3:194224188-194224210 GGTTAGTGGTGTTGGTGTGGAGG - Intergenic
967891852 3:194369449-194369471 GGCTGGTGGTCCTGGTGTCCAGG + Intronic
968326643 3:197823439-197823461 GGCCATTGAAATTGGTGTGCAGG - Intronic
968576086 4:1366804-1366826 GGCCGGTGTGCTGGGTGTGCAGG - Intronic
968655247 4:1775762-1775784 GGCCAATGGGCTTTGTGGGCTGG - Intergenic
968703363 4:2067019-2067041 AGCCACGGGTCTTGCTGTGCTGG + Exonic
969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG + Intronic
971267981 4:25111499-25111521 GGCCAGAGGTCGTGGTCTGTGGG - Intergenic
972918759 4:43911127-43911149 GGCCAGTGATCTAGGTGTGGGGG - Intergenic
974456173 4:62131317-62131339 GGCCAGTGGTGTTCCTGTGCTGG - Intergenic
977797100 4:101179410-101179432 GACCAGTGGTGGTGGTGTCCAGG - Intronic
978186076 4:105858361-105858383 GCCGAGTGGTCTTGCTGAGCGGG - Intronic
982091950 4:151887965-151887987 AGTCAGTGGTGTTGGTGTGTTGG + Intergenic
983728939 4:170969583-170969605 GGGCAGCTGTCTTGGTCTGCAGG - Intergenic
985553470 5:544678-544700 GGCCAATGCTCTTGGGGTGTGGG + Intergenic
991970459 5:72135983-72136005 GGCCAGTGCATTTGGTGAGCTGG + Intronic
996256364 5:121409145-121409167 GTTCAGTGGTGTAGGTGTGCAGG + Intergenic
996292228 5:121865960-121865982 TGCCAGTGGTCTGGGTGTCTGGG - Intergenic
996503072 5:124238199-124238221 GAGCAGTGGTCTGGGTGTGGTGG + Intergenic
997679346 5:135738399-135738421 GCCCAGGGGTCCTGGTGTGGAGG - Intergenic
1006147916 6:31970286-31970308 GACCTGTGGTCTTGGTGTTTGGG + Intronic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007903880 6:45439365-45439387 GGCTAGTGGTTATGGAGTGCAGG + Intronic
1008380026 6:50830990-50831012 GGCAAGTGGTCTAGGTTTGGGGG + Intronic
1009847427 6:69151159-69151181 GGCCAGTCCTAGTGGTGTGCTGG - Intronic
1010243522 6:73640601-73640623 GGCCACTGGGCTTGGTGTAGAGG - Intronic
1011838174 6:91459468-91459490 AGACAGTGGCCTTGGTGTTCAGG + Intergenic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1015992760 6:138964129-138964151 GCAATGTGGTCTTGGTGTGCAGG - Intronic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG + Intronic
1017928287 6:158929601-158929623 TGCCAGTGGACTTGGTGTGTGGG + Intergenic
1018544124 6:164916953-164916975 GAGAAGAGGTCTTGGTGTGCTGG - Intergenic
1019423730 7:963495-963517 GGGCAGTGGGGTTGGTCTGCGGG - Intronic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1024291192 7:47805736-47805758 GGCCTCTGGTCTTGGGGTCCTGG - Intronic
1024537905 7:50453465-50453487 TGCCAGTTCTCTTGGTGTGAGGG + Intronic
1026108212 7:67437655-67437677 GGGCAGTGGTCTTGGTGGTAAGG + Intergenic
1028972501 7:96875072-96875094 AGCCAGTGGACTTGGATTGCAGG + Intergenic
1029338020 7:99919072-99919094 GGCCAGTGTGCCTGGTGTGCAGG - Exonic
1029609003 7:101616678-101616700 GACCAGTGGTCTGGGTGAGGGGG + Intronic
1030096659 7:105906639-105906661 GGCCATTGGTCATGGTGTCCTGG + Intronic
1032778204 7:135137837-135137859 GGGCAGTCATCTTGGTTTGCAGG + Intronic
1035113705 7:156505666-156505688 GGCGAGTGGGCTGGGTGTCCTGG - Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1042505503 8:69555368-69555390 GGCCAGTGGGCTGGGCGTGGTGG + Intronic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1045584217 8:103513150-103513172 GGCAAGTGCTCTGGGTGAGCTGG + Intronic
1048153710 8:131920350-131920372 TGCTTGTGGTCTTGGTATGCAGG + Intronic
1048955807 8:139535001-139535023 AGCCAGGTGTCTTGGAGTGCAGG + Intergenic
1049336490 8:142089435-142089457 GGGCAGTGGCCTTGGTCAGCGGG - Intergenic
1049509543 8:143020581-143020603 TGCCAGTGGTCCTGGGGTGGGGG - Intronic
1053345405 9:37374531-37374553 TGCCATTGGTCTGGGGGTGCAGG - Intergenic
1060810599 9:126609818-126609840 TGTCTGTGGTCTTGCTGTGCCGG - Intergenic
1061206087 9:129164278-129164300 GGCCAGTGGCCTTCTTGTTCTGG + Intergenic
1061411254 9:130422988-130423010 GGTCAGTGTTCTGGGGGTGCGGG + Intronic
1061944789 9:133902526-133902548 GGCCAGGGGTGCTGGGGTGCAGG + Intronic
1188716516 X:33465208-33465230 GCCCAGTTCTCTTGCTGTGCTGG - Intergenic
1188797530 X:34484175-34484197 GGCCTGGGGGCTTGTTGTGCAGG + Intergenic
1189220175 X:39364892-39364914 GGTTAGTGGTCCTGGTTTGCAGG - Intergenic
1189487664 X:41445606-41445628 GGCCAGTGGGCCTGGTGCTCTGG - Intergenic
1189739550 X:44103877-44103899 GGTTAGTGGTCTTGGTCTGGTGG - Intergenic
1190152092 X:47957291-47957313 GGCCTGTGGTGTTGATTTGCTGG + Intronic
1190152367 X:47958803-47958825 GGCCCGTGGTGTTGATTTGCTGG + Intronic
1191799935 X:65067091-65067113 GTCAAGTGGTCTTGCTGAGCAGG - Intergenic
1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG + Intronic
1197035739 X:121871003-121871025 GGCCAGTGGTGTTGGGGTGGGGG - Intergenic
1198327315 X:135586594-135586616 AGCCAGGGGTCCTGGGGTGCCGG - Intergenic