ID: 959057223

View in Genome Browser
Species Human (GRCh38)
Location 3:101579701-101579723
Sequence CCTTATAACGATGCTTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959057223 Original CRISPR CCTTATAACGATGCTTTTTG AGG Intronic
900252051 1:1676074-1676096 CCTTATGACGATGCTGTTTGTGG - Exonic
900262462 1:1738932-1738954 CCTTATGACGATGCTGTTTGTGG - Exonic
907340173 1:53729500-53729522 TGTTTTAACAATGCTTTTTGGGG - Intronic
911863389 1:102984800-102984822 GCTAATAATGATGGTTTTTGTGG + Intronic
915831538 1:159135585-159135607 ACTTCTAACGGTGCTTTTTAAGG - Intronic
916569333 1:166011400-166011422 CCTTATAACGGTGCTGTAGGTGG + Intergenic
917554956 1:176075448-176075470 CCCTAAAAAGATGTTTTTTGAGG - Intronic
918568399 1:185957538-185957560 CCTTATGAGGAGGATTTTTGAGG + Intronic
919429132 1:197471222-197471244 TCTTATAACTATGCTGATTGGGG - Intronic
920971793 1:210749165-210749187 TCTTATTAGGATTCTTTTTGAGG - Intronic
1064721338 10:18232545-18232567 CTTTAAAAATATGCTTTTTGGGG + Intronic
1065267406 10:23992039-23992061 CCATAAAATGATGCGTTTTGGGG - Intronic
1069416323 10:68204030-68204052 CCTTAGAAAGATGATGTTTGAGG - Intronic
1070013233 10:72497356-72497378 ACTTATAAAGATGCTTATTTGGG - Intronic
1071741346 10:88361840-88361862 CCTGAGAATGCTGCTTTTTGTGG - Intronic
1072150249 10:92676930-92676952 CATTATAACAAAGCTCTTTGAGG + Intergenic
1080367257 11:31589826-31589848 ACTGATAAAGATGTTTTTTGTGG - Intronic
1081896636 11:46592887-46592909 TCTTATAACTATGGTGTTTGTGG - Intronic
1087065840 11:94027198-94027220 ACTTATAAGGATGCTTTTGATGG + Intronic
1087955686 11:104284932-104284954 TCTTCCAACGGTGCTTTTTGTGG + Intergenic
1088333039 11:108672930-108672952 CCTGATAACTATTCATTTTGGGG - Intronic
1090281008 11:125455945-125455967 CTTTATCACGGTGCTTATTGAGG - Exonic
1091403299 12:193878-193900 CCTTCTTACCATGCTTTTTTGGG - Intronic
1097021526 12:56024144-56024166 CTTTGTAAAAATGCTTTTTGAGG - Intronic
1098535117 12:71585252-71585274 CCTTAGAAGGATTCTTTCTGAGG - Exonic
1098650536 12:72961749-72961771 CCCTTTAAAGTTGCTTTTTGAGG + Intergenic
1104058477 12:125248285-125248307 ACTCATAAAGATGCTTTTTCCGG - Intronic
1108625046 13:52219856-52219878 TCTTTTAACGTTGCTTTTTATGG + Intergenic
1108661009 13:52586562-52586584 TCTTTTAACGTTGCTTTTTATGG - Intergenic
1108916653 13:55622250-55622272 TCTTATAAGGATGTGTTTTGCGG - Intergenic
1110072811 13:71199023-71199045 CTTTACAAAGATGCTTTGTGAGG - Intergenic
1110549973 13:76801133-76801155 CCTTATAGTTATGATTTTTGTGG + Intergenic
1111651733 13:91099388-91099410 CTTTCTAATGATGCTTTCTGTGG + Intergenic
1118235467 14:64000073-64000095 CCTTATCTTGATGCTTTTTTTGG - Intronic
1118488990 14:66241008-66241030 CCTTCTAACCCTGATTTTTGAGG + Intergenic
1120321627 14:82969069-82969091 CCTTATAATGCTGTTTTCTGGGG + Intergenic
1121267350 14:92612916-92612938 CCTTGTAAGGATGCTGTTTCAGG + Intronic
1126034741 15:44536229-44536251 CCTCATAATGCTGCTTTTTGTGG + Intergenic
1126301271 15:47198945-47198967 CCTCAGAATGATGCTTTTTAAGG - Intronic
1126303529 15:47227069-47227091 CCTGATCACTTTGCTTTTTGTGG - Intronic
1127071305 15:55290163-55290185 CCTTAGAACATGGCTTTTTGGGG - Intronic
1130129950 15:81132373-81132395 CCTTAATAAGATGCTTTTTCTGG - Intronic
1130631516 15:85573704-85573726 CCTTATCAGAATGCTGTTTGAGG + Intronic
1133552143 16:6866890-6866912 CCTTATCTTGATGCTTTGTGTGG - Intronic
1148976519 17:51534942-51534964 CCTTAAAAATATGCTTTCTGGGG - Intergenic
1155787371 18:29917472-29917494 CCCTGTAAAGCTGCTTTTTGTGG + Intergenic
1159523698 18:69560141-69560163 CCTCATGAAGATGCTCTTTGAGG - Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
927322075 2:21758517-21758539 CCTTAGATAGATGTTTTTTGGGG + Intergenic
928604427 2:32932304-32932326 CATTTTAAAGGTGCTTTTTGGGG + Intergenic
929185947 2:39094834-39094856 CCTTATAAAGAGGCTGTATGTGG - Intronic
929434021 2:41913583-41913605 ACATATAACGATGCTTTTCGTGG - Intergenic
930276867 2:49321376-49321398 ACTTATAACAATGTATTTTGGGG + Intergenic
931097726 2:58960771-58960793 TTTTATAACAATGCTATTTGTGG + Intergenic
939427893 2:142063961-142063983 ACATACAATGATGCTTTTTGAGG + Intronic
939583268 2:143976865-143976887 CCCTTTAACTTTGCTTTTTGAGG + Intronic
940593472 2:155760440-155760462 TATTATAACAATGCTTCTTGAGG + Intergenic
940942312 2:159575723-159575745 ACATATAATCATGCTTTTTGTGG - Intronic
943623533 2:190175931-190175953 CCTTTAAACGAGGCTTCTTGTGG + Intronic
943780621 2:191819571-191819593 CCTTTTAACAAAGCCTTTTGTGG + Intergenic
946816193 2:223580848-223580870 CCTTATAAAAATGCTTATTTGGG - Intergenic
946859287 2:223985067-223985089 CCTTCTAAGGAAGCTATTTGTGG - Intronic
1169471144 20:5886613-5886635 ACTTAGAACAGTGCTTTTTGTGG - Intergenic
1169593588 20:7172570-7172592 CCTAATAACGATGCTGTTCATGG + Intergenic
1171191915 20:23164862-23164884 CTTTAAAAAAATGCTTTTTGAGG - Intergenic
1173912446 20:46680416-46680438 CCTTATATGGATGCTTGTGGTGG + Intronic
1178950754 21:36983535-36983557 CCTTATAAAAATGATTTTTTTGG + Intronic
1178967755 21:37139402-37139424 CATTATAACTTTGCTTTCTGAGG + Intronic
953162161 3:40431113-40431135 TCTTTTAATGATGTTTTTTGAGG - Intergenic
953217107 3:40929969-40929991 TCTTGTGATGATGCTTTTTGTGG - Intergenic
958085425 3:88799246-88799268 TCTTATAAAGGTGCTTTTTTGGG + Intergenic
959057223 3:101579701-101579723 CCTTATAACGATGCTTTTTGAGG + Intronic
961421899 3:126812754-126812776 TTTTATGACAATGCTTTTTGTGG + Intronic
966620480 3:181957969-181957991 CCTTAGAAAAATGTTTTTTGAGG + Intergenic
969843836 4:9904055-9904077 CCTTATATTGATGCTCTGTGAGG + Intronic
974054697 4:56973861-56973883 CGACATAACCATGCTTTTTGAGG + Exonic
976456325 4:85251211-85251233 CCTTATAACCATGTTATTTCAGG - Intergenic
982445901 4:155490472-155490494 CTTGATAACAATACTTTTTGTGG + Intergenic
984048812 4:174838152-174838174 TTATATAAAGATGCTTTTTGTGG - Intronic
985227768 4:187781056-187781078 CCATATTTCCATGCTTTTTGGGG - Intergenic
986964570 5:13254850-13254872 CCTTAGAACAATTCTTTTTGCGG + Intergenic
987959431 5:24786237-24786259 CCTTACAACTATGCTTAATGTGG - Intergenic
992282973 5:75201077-75201099 GCTTATGAGGATGCATTTTGAGG - Intronic
993968783 5:94390743-94390765 CCTTATAACCATACATTTTCAGG - Intronic
998818345 5:146035705-146035727 CCTTATAAAGTAGCTTTTTATGG - Intronic
1000486809 5:161856509-161856531 CCTGGTAACAATGCCTTTTGAGG + Intronic
1006050117 6:31335846-31335868 CCTTATAACCCTGATTCTTGGGG - Intronic
1008689302 6:53959669-53959691 CCTTATAAAGCTACTTTTTCCGG - Intronic
1010434583 6:75814405-75814427 TCTTATGAAGATGCTTTTTTTGG + Intronic
1011119847 6:83940222-83940244 TCTAATTACGATCCTTTTTGAGG + Intronic
1014602744 6:123435220-123435242 CCTTATAAATTTGCTATTTGGGG + Intronic
1015841084 6:137478113-137478135 CCCTATAATGAAGCTTTGTGAGG + Intergenic
1021153959 7:17186524-17186546 CCTTACAAGCATTCTTTTTGTGG + Intergenic
1027209036 7:76129225-76129247 CTTTACAACGGTGCTGTTTGGGG + Intergenic
1031091563 7:117361973-117361995 CCTGATTACAGTGCTTTTTGCGG - Intergenic
1041039290 8:53830199-53830221 ACTTAAAACTATGTTTTTTGGGG - Intronic
1045613500 8:103876765-103876787 CATTATTACGTTCCTTTTTGTGG + Intronic
1047042380 8:121010303-121010325 CCTTTTAACAATACATTTTGTGG + Intergenic
1048958700 8:139557886-139557908 CCTCATGAAGATGCTGTTTGGGG + Intergenic
1049728954 8:144166177-144166199 CCTTATAAAAATGCTTGATGGGG - Intronic
1050446751 9:5731014-5731036 CCCTATAAGGATGCCTTTTGAGG - Intronic
1050918468 9:11167800-11167822 CCTTAGAAAGTTGCATTTTGAGG + Intergenic
1185790025 X:2922280-2922302 TCATATAACGAGGCTTTCTGGGG + Intronic
1188853109 X:35156483-35156505 TCACATAACGAGGCTTTTTGGGG + Intergenic
1190780355 X:53588381-53588403 GCTTTTAACGCTACTTTTTGAGG - Exonic
1192785973 X:74335882-74335904 CTTTATGAAGTTGCTTTTTGAGG + Intergenic
1192958926 X:76105146-76105168 TCTTATGAAGGTGCTTTTTGTGG + Intergenic
1195633378 X:107085050-107085072 TGTTATAATGATGCTTGTTGTGG - Intronic
1196851342 X:119941927-119941949 CCTTAAAACTATGCATTTTTTGG - Intronic
1199081827 X:143585882-143585904 CCTTATAAGAATGATTCTTGGGG + Intergenic