ID: 959069836

View in Genome Browser
Species Human (GRCh38)
Location 3:101692028-101692050
Sequence AACCCCGTGCTCTCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959069830_959069836 11 Left 959069830 3:101691994-101692016 CCTTGAGATTCTGTTAATCTATG 0: 68
1: 113
2: 81
3: 1179
4: 1562
Right 959069836 3:101692028-101692050 AACCCCGTGCTCTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959069836 Original CRISPR AACCCCGTGCTCTCTGAAAC AGG Intergenic
No off target data available for this crispr