ID: 959070739

View in Genome Browser
Species Human (GRCh38)
Location 3:101700182-101700204
Sequence AACCCCGTGCTCTCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959070733_959070739 11 Left 959070733 3:101700148-101700170 CCTTGAGATTCTGTTAATCTATG 0: 68
1: 113
2: 81
3: 1179
4: 1562
Right 959070739 3:101700182-101700204 AACCCCGTGCTCTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959070739 Original CRISPR AACCCCGTGCTCTCTGAAAC AGG Intergenic
No off target data available for this crispr