ID: 959070970

View in Genome Browser
Species Human (GRCh38)
Location 3:101701845-101701867
Sequence GGTGGAACTCAACAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959070970_959070983 19 Left 959070970 3:101701845-101701867 CCCACCAGCTGTTGAGTTCCACC No data
Right 959070983 3:101701887-101701909 AACATGCAGTGCCCTGGCTGGGG No data
959070970_959070973 -7 Left 959070970 3:101701845-101701867 CCCACCAGCTGTTGAGTTCCACC No data
Right 959070973 3:101701861-101701883 TTCCACCTCCAGCCAGCCACTGG No data
959070970_959070981 17 Left 959070970 3:101701845-101701867 CCCACCAGCTGTTGAGTTCCACC No data
Right 959070981 3:101701885-101701907 CCAACATGCAGTGCCCTGGCTGG No data
959070970_959070979 13 Left 959070970 3:101701845-101701867 CCCACCAGCTGTTGAGTTCCACC No data
Right 959070979 3:101701881-101701903 TGGACCAACATGCAGTGCCCTGG No data
959070970_959070982 18 Left 959070970 3:101701845-101701867 CCCACCAGCTGTTGAGTTCCACC No data
Right 959070982 3:101701886-101701908 CAACATGCAGTGCCCTGGCTGGG No data
959070970_959070984 20 Left 959070970 3:101701845-101701867 CCCACCAGCTGTTGAGTTCCACC No data
Right 959070984 3:101701888-101701910 ACATGCAGTGCCCTGGCTGGGGG No data
959070970_959070985 24 Left 959070970 3:101701845-101701867 CCCACCAGCTGTTGAGTTCCACC No data
Right 959070985 3:101701892-101701914 GCAGTGCCCTGGCTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959070970 Original CRISPR GGTGGAACTCAACAGCTGGT GGG (reversed) Intergenic