ID: 959072145

View in Genome Browser
Species Human (GRCh38)
Location 3:101712537-101712559
Sequence CAATTCTTTCAGACTTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959072145_959072149 -4 Left 959072145 3:101712537-101712559 CCAAGGAAAGTCTGAAAGAATTG No data
Right 959072149 3:101712556-101712578 ATTGGAAGAGGAGGCAGAAGAGG No data
959072145_959072150 23 Left 959072145 3:101712537-101712559 CCAAGGAAAGTCTGAAAGAATTG No data
Right 959072150 3:101712583-101712605 GCGCATCCTCCAGCAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959072145 Original CRISPR CAATTCTTTCAGACTTTCCT TGG (reversed) Intergenic
No off target data available for this crispr