ID: 959073384

View in Genome Browser
Species Human (GRCh38)
Location 3:101724896-101724918
Sequence GCTCTCCGGCGTCGCGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959073378_959073384 -10 Left 959073378 3:101724883-101724905 CCTGCCGTTCCCAGCTCTCCGGC 0: 1
1: 0
2: 1
3: 16
4: 218
Right 959073384 3:101724896-101724918 GCTCTCCGGCGTCGCGGTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
959073376_959073384 10 Left 959073376 3:101724863-101724885 CCTCTGGGAGTTGTAGTTCACCT 0: 1
1: 0
2: 2
3: 15
4: 117
Right 959073384 3:101724896-101724918 GCTCTCCGGCGTCGCGGTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
959073375_959073384 11 Left 959073375 3:101724862-101724884 CCCTCTGGGAGTTGTAGTTCACC 0: 1
1: 1
2: 4
3: 25
4: 132
Right 959073384 3:101724896-101724918 GCTCTCCGGCGTCGCGGTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959073384 Original CRISPR GCTCTCCGGCGTCGCGGTGA GGG Intronic
901014077 1:6217783-6217805 GCTGTCCAGCCCCGCGGTGATGG - Intronic
902304167 1:15524451-15524473 GTTCTGGGGCGGCGCGGTGATGG - Intronic
903375774 1:22864944-22864966 GGCCTCCGGAGTCGCGGGGAGGG - Exonic
1063593469 10:7412433-7412455 GCTCTCCAGGGTCGCGGCGAAGG - Intergenic
1064119991 10:12610228-12610250 GATCTCCGGAGTCATGGTGATGG + Intronic
1064179089 10:13099887-13099909 GCTCTAAGGCGTCACTGTGACGG - Intronic
1074182882 10:111078754-111078776 GCCCCCCGGCGGCGCGGCGACGG - Exonic
1075521842 10:123148088-123148110 GGTCTCCGGCGGCGCGGAGGCGG - Intergenic
1079128925 11:17736332-17736354 CCTCCTCGGCGTCGCGGTGCTGG - Exonic
1081716246 11:45252495-45252517 GCTCCCCGGCCACGCTGTGACGG + Exonic
1120834442 14:89027387-89027409 GCTCTCCGGCTCCGCGGCGCGGG + Intergenic
1122780200 14:104140235-104140257 GCTCTCTGGAGTCTCGGCGAGGG + Intronic
1129676066 15:77632884-77632906 GCTCTGCAGCGGCGCGGGGAGGG + Intronic
1132056122 15:98650691-98650713 GGTCTGCGGCGGCGCGGGGAGGG + Intronic
1149296372 17:55265583-55265605 GCTCACCGTCTTCGTGGTGAAGG - Exonic
1156239711 18:35241094-35241116 GCTCCTGGGCTTCGCGGTGAGGG + Exonic
1166398853 19:42462955-42462977 GCTCTCCTGCGTCGAGCTCATGG + Intergenic
940354006 2:152718655-152718677 GCTCTGCGGCGCCGCGGTCCCGG + Exonic
1169417637 20:5431630-5431652 GCTCTCTGGGGTGGAGGTGAAGG - Intergenic
1181264727 22:21624267-21624289 GCTCTTGGGCGTCTCGTTGAGGG + Intergenic
1182451433 22:30424094-30424116 GGTCTCCGCCGTCACTGTGAAGG - Exonic
1182576481 22:31276585-31276607 GCTCGCCGGCTCCGCGGCGAGGG - Intronic
953656936 3:44861776-44861798 GCTCTCCGGCGCCTCGGAGGGGG - Intronic
959073384 3:101724896-101724918 GCTCTCCGGCGTCGCGGTGAGGG + Intronic
968452562 4:682165-682187 GCACTCCGGAGTCGCCGTGCTGG + Exonic
969443689 4:7232394-7232416 GCTCTCCGGCGTCCAGGCGCCGG - Intronic
1002317435 5:178352134-178352156 GCTCTCGGGCGGCCCTGTGAGGG + Intronic
1002526073 5:179816865-179816887 GGTCTCCGGCCACCCGGTGACGG + Intronic
1003325010 6:5084832-5084854 GCTCTCCGGCGGCGCGGAATGGG + Exonic
1007665211 6:43509728-43509750 GCTGTCCGGCGCCGAGGTGCGGG - Exonic
1032705558 7:134418685-134418707 GCTCTCTGGCATCGCCCTGACGG - Intergenic
1033438030 7:141351966-141351988 GCTCTCTGGCATCGTGGTGGTGG - Intronic
1044852812 8:96445684-96445706 GCTGTACGGCCTAGCGGTGAGGG + Intergenic
1049071276 8:140357752-140357774 GCACTCCGGCGTTTCGGTGACGG - Intronic
1049707234 8:144048586-144048608 GCTCTGCGGCCCCGCGGTGTCGG - Intergenic
1051192952 9:14534159-14534181 GCTCTCTGGCCTGGCGGCGAGGG + Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1190055709 X:47180025-47180047 GCTCTCCACCATCGTGGTGAGGG + Exonic
1191598123 X:62970199-62970221 GCTCTCTGCCATCGGGGTGATGG - Intergenic