ID: 959084354

View in Genome Browser
Species Human (GRCh38)
Location 3:101835256-101835278
Sequence AACCCCATGCTTTTAATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959084351_959084354 -2 Left 959084351 3:101835235-101835257 CCCAGGTTTGTTTAACTTCAGAA 0: 1
1: 0
2: 3
3: 47
4: 375
Right 959084354 3:101835256-101835278 AACCCCATGCTTTTAATCAAGGG 0: 1
1: 0
2: 1
3: 19
4: 135
959084352_959084354 -3 Left 959084352 3:101835236-101835258 CCAGGTTTGTTTAACTTCAGAAC 0: 1
1: 0
2: 3
3: 33
4: 294
Right 959084354 3:101835256-101835278 AACCCCATGCTTTTAATCAAGGG 0: 1
1: 0
2: 1
3: 19
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959084354 Original CRISPR AACCCCATGCTTTTAATCAA GGG Intronic
902149102 1:14428258-14428280 AGGCCCGTGCTTTCAATCAAGGG + Intergenic
905502887 1:38453478-38453500 AACCCCATGCTGTTAGTCCAAGG + Intergenic
909118173 1:71566591-71566613 AAGTCCATGCTTTTAAACATGGG + Intronic
909836642 1:80262966-80262988 AACCCTTTACTTTGAATCAATGG - Intergenic
911129777 1:94376420-94376442 AGCCACATTCTTTTCATCAAAGG + Intergenic
911134780 1:94427860-94427882 AAAGCCATGTTTTTAAGCAAGGG - Intronic
916919169 1:169444598-169444620 AACCACATGCTTTTAAAAATTGG + Intronic
917676272 1:177322010-177322032 AGCCACATTCTTTTCATCAAAGG - Intergenic
918552035 1:185754412-185754434 GACCACATTTTTTTAATCAAAGG - Intronic
918802473 1:188988936-188988958 AAACACATGTTTTTAATGAATGG - Intergenic
923549775 1:234954368-234954390 AATCAGATGCCTTTAATCAACGG - Intergenic
923868246 1:237963262-237963284 AACCCCATGCATTTCACCACAGG + Intergenic
924005165 1:239600976-239600998 CCCCACATACTTTTAATCAAGGG - Intronic
1063256689 10:4335920-4335942 CACCCCATACTATTATTCAAAGG + Intergenic
1068096932 10:52503257-52503279 AAGGCCATGATTATAATCAAGGG - Intergenic
1068106383 10:52622079-52622101 GACCCCTTGCTTTTAAGGAAAGG - Intergenic
1069261343 10:66402261-66402283 AACTCTATGCATCTAATCAATGG - Intronic
1070252817 10:74787868-74787890 AACCCCATGTTTTCAATTTAAGG - Intergenic
1071507889 10:86243744-86243766 AACCCCATGCTGTTAATGGGTGG - Intronic
1077777509 11:5287850-5287872 AAGCTCATGCATTTAATAAACGG + Intronic
1079315633 11:19405834-19405856 GACCCAGTGCTTTTACTCAAAGG - Intronic
1080399268 11:31919160-31919182 AAACCCATGCTTATAATCACTGG + Intronic
1082200744 11:49363807-49363829 TACCCTATACTTTTAATTAATGG + Intergenic
1086654929 11:89342420-89342442 TACCCTATACTTTTAATTAATGG - Intronic
1086756470 11:90569731-90569753 AACACCTTGATTTTAGTCAAAGG + Intergenic
1089095270 11:115915033-115915055 GAGCCCATGCTTTTAATGCAAGG - Intergenic
1090618244 11:128536914-128536936 ATCCCTATTGTTTTAATCAAAGG - Intronic
1092746142 12:11674350-11674372 AAGCTCAGGCTTTTAAACAATGG + Intronic
1093111975 12:15163599-15163621 AAACCGATGCATTTAATCAAGGG + Intronic
1093999674 12:25681366-25681388 ATCACCATACTTTTAAACAAAGG - Intergenic
1095590369 12:43896559-43896581 AACCCCATGTTTTTGAACATTGG + Intronic
1099938771 12:89160099-89160121 AAGCCCTTCATTTTAATCAAAGG - Intergenic
1100054608 12:90493475-90493497 AATCAAATGCATTTAATCAAGGG - Intergenic
1101779673 12:107824106-107824128 AACCACATTCTTTTCATTAAAGG - Intergenic
1104781731 12:131425809-131425831 AACCCCATGCATTTCACCACAGG - Intergenic
1113310895 13:109131675-109131697 AACTGCAGGCTTTTATTCAATGG - Intronic
1113335403 13:109372169-109372191 GCCCGCATGCTTTTAAACAATGG + Intergenic
1117108734 14:52426482-52426504 AACCCCATGCTTGGCTTCAAGGG + Intergenic
1119946034 14:78695466-78695488 AGCCCCAGGCTTTTTTTCAACGG - Intronic
1122333035 14:100939560-100939582 AACCCCATGATATTCATCACTGG - Intergenic
1124580803 15:30953125-30953147 AACCCCTTCCTTTTCATAAAGGG - Intronic
1128143119 15:65316235-65316257 GAGCCCATGCTTTTAACCACTGG + Intergenic
1128630353 15:69259347-69259369 AACCCCATAAGTTTAATAAATGG - Intronic
1131747762 15:95468149-95468171 AACCCCCTGCTATAAATGAATGG + Intergenic
1135822952 16:25700801-25700823 AACCACCTTCTTTTAATTAATGG - Intronic
1135857170 16:26022436-26022458 AATCCCATGCTCTAAATCAAGGG + Intronic
1136168865 16:28475554-28475576 AAGCCCATGCTATTAACCAGTGG + Intergenic
1137960018 16:52873402-52873424 AAACCCATGCATTTAGTGAATGG - Intergenic
1138500680 16:57441713-57441735 AATCCCATGCTTTTAACCTATGG + Intronic
1150810226 17:68350481-68350503 CAGCCCAAGCTTTTAATCAAAGG - Intronic
1155684599 18:28533045-28533067 AATCCCATACATTTAATGAAAGG - Intergenic
1156898063 18:42269508-42269530 AACCCCAAGATTTTAATTCATGG + Intergenic
1157268191 18:46247478-46247500 CACTCAATGCTTTTAAACAATGG - Intronic
1158736309 18:60085689-60085711 AACTGCATGCTTTTTATAAATGG + Intergenic
1159365528 18:67461917-67461939 AACCCTATGCTTTGAACCTATGG + Intergenic
1160431482 18:78816016-78816038 ATTCCCAAGCTTTTATTCAAAGG + Intergenic
1163131057 19:15273268-15273290 CACCCCATGCTTTGACTGAAAGG + Intronic
1167966153 19:53148998-53149020 ATCCCCATGCTTTGATTCAGTGG - Intronic
926818338 2:16823912-16823934 AACCCCATGCATTTTTACAAAGG + Intergenic
927297401 2:21470340-21470362 AACCCCATTCATTTATCCAATGG - Intergenic
930224856 2:48781618-48781640 AAGCAGATGCTTTTAATCACTGG + Intergenic
936144930 2:109974530-109974552 AACCCCATGCTTTATGACAATGG + Intergenic
936181616 2:110272493-110272515 AACCCCATGCTTTATGACAATGG + Intergenic
936199756 2:110396937-110396959 AACCCCATGCTTTATGACAATGG - Intergenic
936230950 2:110699187-110699209 AACCCCATGCTTTATGACAATGG - Intergenic
937487882 2:122334721-122334743 AACCCCATGCTTCTGAGCCAAGG - Intergenic
939011040 2:136846107-136846129 AACCCCAGGGGTTGAATCAAGGG + Intronic
939492090 2:142888550-142888572 AACCTCATGCTTTTGGTCAAGGG - Intronic
940601503 2:155867437-155867459 AACTCCATGGCTTTAATCTATGG + Intergenic
945754709 2:213831928-213831950 AACCCCATGCTGTTGAACACTGG + Intronic
946043614 2:216803412-216803434 AACCCCAAGCTTCTCCTCAAAGG + Intergenic
946687854 2:222290011-222290033 TACCCAATGATTTTAATCTATGG + Intronic
946902976 2:224390187-224390209 AACCCAGTTCTTTTAATTAAGGG - Intronic
948406697 2:237726831-237726853 AAGCCCATGCTTTGACTTAAGGG + Intronic
1172343281 20:34176329-34176351 AACCCCATACTCAGAATCAAAGG - Intergenic
1176672694 21:9749763-9749785 AACTGCATGCTTTTTATAAATGG - Intergenic
1178139981 21:29671683-29671705 AACCCCAGACCTTTAAACAAAGG + Intronic
1178714858 21:34954951-34954973 AATCCCATGCTTCTCATCAAAGG - Intronic
1182388899 22:29973420-29973442 AATCCCAAGCATTTTATCAAGGG + Intronic
1184025286 22:41851288-41851310 AACCACTGGCTTTTATTCAAAGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
951002524 3:17580453-17580475 AACCAAATGCTTTTTAACAATGG + Intronic
951257860 3:20471311-20471333 AAGAAAATGCTTTTAATCAAAGG - Intergenic
951410837 3:22364166-22364188 AAACCCATTATTTTAAACAAAGG + Intronic
951714393 3:25623624-25623646 ATTCCCATGGTTTTAATAAATGG - Exonic
952278127 3:31897228-31897250 AACCCCATATTTTCAATCAGTGG - Intronic
956017823 3:64902379-64902401 AAGTCCATTCCTTTAATCAAAGG + Intergenic
959084354 3:101835256-101835278 AACCCCATGCTTTTAATCAAGGG + Intronic
959412100 3:106037013-106037035 AACCATAAGCTTTTAATCAGAGG + Intergenic
960726784 3:120678240-120678262 AACCCCATGCTCACCATCAACGG + Intronic
962106808 3:132398644-132398666 AACCTCTTGCTTTTCTTCAATGG + Intergenic
962114288 3:132485748-132485770 AACTCAATGCTTTGAATCATTGG - Intronic
963078037 3:141366501-141366523 AGCTACATGCTTTTAATCAAGGG - Intronic
963996748 3:151718298-151718320 ACCCCCATGCTTTAAATCAGAGG - Intergenic
964884916 3:161471063-161471085 AACCTCATACTTTTATCCAAGGG - Intergenic
965547096 3:169927128-169927150 AACCCCATTCTTTTCATCACAGG - Exonic
966025789 3:175279466-175279488 AACCTCATGTTTTTAATTAAAGG - Intronic
966327792 3:178776510-178776532 CATCACATGCTTTTAAGCAAGGG - Intronic
967885864 3:194332986-194333008 AACCACATGGTCTTCATCAAAGG - Intergenic
972849417 4:43030562-43030584 AACCTCATTTTATTAATCAAAGG + Exonic
974334186 4:60518799-60518821 AACTACATGGTCTTAATCAATGG - Intergenic
976009723 4:80472674-80472696 AACTGCATGCTTTTAATAAGTGG - Intronic
978430670 4:108629820-108629842 AAGCCCAAGCTCTTAATCACTGG - Intronic
978506281 4:109461429-109461451 AACCCCAAGATATTCATCAATGG + Intronic
980881880 4:138718776-138718798 AAGCCAGTGCCTTTAATCAAAGG - Intergenic
982429560 4:155306964-155306986 AAACCCCTGCTTTTAATGATAGG + Intergenic
983076340 4:163331802-163331824 CACCCGAAGCTTTTAATCATCGG - Intronic
984431085 4:179650097-179650119 AACCCCAAGTTTTCAATCCAGGG + Intergenic
984494738 4:180482192-180482214 CACCCCATGGATTTAATCCAAGG + Intergenic
985172756 4:187169797-187169819 AACCTCATGCAATCAATCAAAGG - Intergenic
986893584 5:12338785-12338807 ACCCCCATGGATTGAATCAAAGG + Intergenic
988999823 5:36748605-36748627 AAGCCCATGCTTGTAACCAGTGG + Intergenic
992545757 5:77812401-77812423 AACCACATTCTTTTCATTAAAGG - Intronic
994601047 5:101905677-101905699 AACCCCATGCTGTTCTTCAAGGG - Intergenic
994835295 5:104844131-104844153 AACCCCAAGTTTTTAGACAAAGG + Intergenic
996515590 5:124365893-124365915 GACCTCATTCCTTTAATCAAAGG + Intergenic
998394273 5:141808290-141808312 AAGCCCTTGCTTTTAATCTGTGG - Intergenic
998582030 5:143386514-143386536 AATCCCATTCTTTTATTTAAAGG + Intronic
998620293 5:143787052-143787074 AACCCCATGCATTTCACCAAAGG - Intergenic
1002791535 6:441075-441097 AACCTCATGCTTTCTATAAAGGG - Intergenic
1003896475 6:10612572-10612594 ATCCCCATGATTTTATTAAAGGG + Intronic
1004197136 6:13515379-13515401 AGCCCCGTGCTCTTAAACAACGG + Intergenic
1009412230 6:63379130-63379152 AAGCACATGCTTTTAATTGAGGG - Intergenic
1009919093 6:70034536-70034558 TACCTCATGCTGTTAAGCAAGGG - Intronic
1010047520 6:71463656-71463678 AACCTCATGATTGGAATCAAGGG - Intergenic
1010579288 6:77574310-77574332 AACTGCATGCTTTTTATAAATGG + Intergenic
1014500526 6:122183408-122183430 AAGTCCATGCTCTTAATAAATGG + Intergenic
1014948796 6:127529929-127529951 AACTAAATGCTTTTAAACAAGGG + Intronic
1015974575 6:138776208-138776230 AACCCTGTGCTTTTACTCACTGG - Exonic
1019232904 6:170584062-170584084 AACCCCCAGCTTTTAATCAGTGG - Intronic
1021775383 7:24049567-24049589 AACCCTATGCTTGTCATCAGAGG + Intergenic
1022458009 7:30576050-30576072 ATTCCCATGCTTTTTACCAAAGG + Intergenic
1026193341 7:68149714-68149736 AAGCCCAGGCTTTTAACCATTGG - Intergenic
1026576422 7:71575337-71575359 AACCCTATGCTTTCATTCAATGG + Intronic
1034419780 7:150983628-150983650 AATCCCAGTCTTTAAATCAAAGG - Intergenic
1037679253 8:21080492-21080514 AAAATCATGCTTTTATTCAATGG - Intergenic
1039648072 8:39308671-39308693 AACCACATGCTTTTATAGAAAGG - Intergenic
1040796841 8:51296885-51296907 AGCCACATTCTTTTCATCAAAGG + Intergenic
1040953359 8:52957034-52957056 AACCACATTCTTTTCATTAAAGG - Intergenic
1043007138 8:74833824-74833846 AAGCCCATGCTTTAAATCAGGGG + Intronic
1043035240 8:75189275-75189297 AGCTGCATGCTTTGAATCAAAGG - Intergenic
1043555142 8:81421600-81421622 AACCACATGCTTTTTACAAATGG + Intergenic
1045948103 8:107819820-107819842 AACCTGATGCTTTTAATCAAGGG + Intergenic
1047787806 8:128170736-128170758 AAATCCATGCTTTTAATCACTGG + Intergenic
1049309976 8:141928628-141928650 AACAGCATCCTTTGAATCAAGGG + Intergenic
1050436081 9:5612281-5612303 AATCCCTGGCTTTTAATCATGGG + Intergenic
1056756370 9:89384672-89384694 AACCCCATGCTTGTCATCAGGGG + Intronic
1057631413 9:96721830-96721852 AAACCTACGCTTTTCATCAACGG - Intergenic
1058090971 9:100804871-100804893 AACCCCTTGATTTTAGTCCAGGG + Intergenic
1061112305 9:128583055-128583077 AACCCCCTTCTTTTATTCACAGG + Exonic
1186618457 X:11214367-11214389 AACTGCATTCTTTTTATCAATGG - Intronic
1186977966 X:14928528-14928550 AACTCGAAGCTTTTAATCAGGGG - Intergenic
1190889218 X:54554396-54554418 AAACCCATGCTTTTAATTCTTGG + Intronic
1192870051 X:75176362-75176384 AGCCGCATTCTTTTAATTAAAGG + Intergenic
1193373280 X:80725017-80725039 AAGCCCATCCATTTGATCAAAGG - Exonic
1194767746 X:97861998-97862020 AAAACCATGCTTTTAAACTACGG + Intergenic