ID: 959085770

View in Genome Browser
Species Human (GRCh38)
Location 3:101849535-101849557
Sequence CTGGCTCAGGGAGCTGTCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 215}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959085770_959085781 10 Left 959085770 3:101849535-101849557 CCGCCGACAGCTCCCTGAGCCAG 0: 1
1: 0
2: 4
3: 37
4: 215
Right 959085781 3:101849568-101849590 AGCCGCGCGCAGCGAGCCGGTGG 0: 1
1: 0
2: 0
3: 8
4: 66
959085770_959085783 16 Left 959085770 3:101849535-101849557 CCGCCGACAGCTCCCTGAGCCAG 0: 1
1: 0
2: 4
3: 37
4: 215
Right 959085783 3:101849574-101849596 GCGCAGCGAGCCGGTGGCGCAGG 0: 1
1: 0
2: 3
3: 13
4: 178
959085770_959085785 23 Left 959085770 3:101849535-101849557 CCGCCGACAGCTCCCTGAGCCAG 0: 1
1: 0
2: 4
3: 37
4: 215
Right 959085785 3:101849581-101849603 GAGCCGGTGGCGCAGGTGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 167
959085770_959085786 24 Left 959085770 3:101849535-101849557 CCGCCGACAGCTCCCTGAGCCAG 0: 1
1: 0
2: 4
3: 37
4: 215
Right 959085786 3:101849582-101849604 AGCCGGTGGCGCAGGTGTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 99
959085770_959085780 7 Left 959085770 3:101849535-101849557 CCGCCGACAGCTCCCTGAGCCAG 0: 1
1: 0
2: 4
3: 37
4: 215
Right 959085780 3:101849565-101849587 GGCAGCCGCGCGCAGCGAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 157
959085770_959085784 22 Left 959085770 3:101849535-101849557 CCGCCGACAGCTCCCTGAGCCAG 0: 1
1: 0
2: 4
3: 37
4: 215
Right 959085784 3:101849580-101849602 CGAGCCGGTGGCGCAGGTGTCGG 0: 1
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959085770 Original CRISPR CTGGCTCAGGGAGCTGTCGG CGG (reversed) Exonic
900341949 1:2193749-2193771 CTGGGGCAGGGACCTGGCGGGGG + Exonic
900503529 1:3018079-3018101 CTGGCTCAGGGCCCTGCCGCTGG - Intergenic
900984450 1:6065427-6065449 CTGGCTCTGCGCGCTGTGGGCGG - Intronic
901167651 1:7231267-7231289 CTGGCTCAGGGGGCCGTTGCAGG + Intronic
902037688 1:13469556-13469578 CTGGCTCAGTGAGCGGTGGCAGG + Intergenic
902608854 1:17585380-17585402 CTGGATCAGGAAGCTGCCTGGGG + Intronic
902656989 1:17875940-17875962 CAGGCTCCAGGAGCTGCCGGAGG + Intergenic
902936739 1:19769940-19769962 CGTGCTTAGGGAGCTGCCGGAGG + Intronic
903768876 1:25751640-25751662 CTGGCTCAGGGAGGTGCTCGGGG - Intronic
907239830 1:53075292-53075314 CTGGGTCTGGGTGCTGTGGGCGG - Intronic
907299540 1:53477912-53477934 CTGGCTCAGGCAGCTGGAGGTGG - Intergenic
913329380 1:117654513-117654535 TGGGCTCAGGGAGCTGCAGGTGG - Intergenic
918779777 1:188684554-188684576 CTGGGGCAGGGAGGGGTCGGGGG + Intergenic
919741472 1:200983779-200983801 TTGGCTCAGGCTGCTGTGGGGGG - Intronic
920805941 1:209233202-209233224 ATGGCTCAGGGAACTGGTGGAGG + Intergenic
1066165879 10:32788157-32788179 CTGGCTCTGGGATCGGTCTGGGG - Intronic
1067661294 10:48237930-48237952 CTTGAGCAGGGAGCTGTGGGTGG - Intronic
1069489525 10:68849532-68849554 CAGTCTCAGGGAGCTGTGGAAGG + Intronic
1069609036 10:69760000-69760022 CGGGCTCAGGTGGCTGTCAGTGG - Intergenic
1070064249 10:73018136-73018158 CTGCCTCAGGGAGTTGGGGGAGG - Intronic
1072638850 10:97196066-97196088 CTGGGTCAGGGAGCTGAGGTAGG + Intronic
1074145598 10:110714627-110714649 CAGCCTCTGGGAGCTGTGGGTGG + Intronic
1076158594 10:128223271-128223293 ATGGCTCAGGGGGCAGTCTGCGG + Intergenic
1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG + Intronic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1077172671 11:1174945-1174967 CTCGCTCAGGGAGCGGCAGGTGG - Intronic
1077915861 11:6611195-6611217 CTTGCTCCGGGAGCTGCCGGAGG + Exonic
1080612438 11:33916129-33916151 CTGGCTCAGGAAGCTCTGGAAGG + Intergenic
1081621661 11:44622427-44622449 CTGCCCCAGGGAGCTGTGGGTGG - Intergenic
1083287819 11:61671783-61671805 CAGCCTCAGGGAGCTGGCAGAGG - Intergenic
1084005611 11:66321931-66321953 CTGGCTCAGGGAGATGCAGTGGG + Intergenic
1084316177 11:68347165-68347187 CTGGCACAGGGAGCTGTGGAAGG + Intronic
1085624765 11:78063619-78063641 CTGGCTCAGCAAGCTGACAGAGG + Intronic
1087939161 11:104074199-104074221 CTGGCTCAGGCAAGTGTCTGTGG - Intronic
1091718550 12:2795936-2795958 CTGGCTCCGGGAGGCGGCGGAGG - Intronic
1091759612 12:3077886-3077908 GTGGCCCAGGGAGCGGTCGCGGG - Intronic
1092047968 12:5446091-5446113 CTGGTTCTGGGAGCTGTCAGGGG - Intronic
1092051545 12:5474414-5474436 CTGGCACAGGGAGTTGTCAGGGG + Intronic
1092746240 12:11675013-11675035 CTGTCTCAGGGAGCTGACGGAGG - Intronic
1092763296 12:11829012-11829034 CTGGATCAGGGAGAGGTTGGAGG - Intronic
1094287208 12:28809062-28809084 CTATCTAAGGGAGATGTCGGGGG + Intergenic
1096661027 12:53124064-53124086 CTGGCTCAGGCAACTTTCTGGGG + Exonic
1099775657 12:87124709-87124731 CCTGCTCAGTGAGCTGTGGGTGG + Intergenic
1102187423 12:110959797-110959819 CTAGCCCAGGCAGCTGTCAGTGG - Intergenic
1103831179 12:123780454-123780476 GTGGCACAGGGAGCTGGCTGCGG - Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1104930400 12:132336530-132336552 CTAGCACAGGGATCTGTCCGTGG + Intergenic
1105271086 13:18875637-18875659 CGGGTTAGGGGAGCTGTCGGGGG - Intergenic
1106614069 13:31310430-31310452 CTGGCTCACTGAGCTGAGGGTGG + Intronic
1108849337 13:54707930-54707952 CTGCCTCACTGAGCTGTGGGTGG - Intergenic
1112589724 13:100751893-100751915 CTGGCACAGGGATGTGTCTGTGG - Intergenic
1113882911 13:113637820-113637842 ATGGCTCAGGGAACTGTTGGAGG + Exonic
1115469453 14:33753895-33753917 CTGGCACTGGGAACTGTGGGAGG - Intronic
1117413097 14:55468341-55468363 CTGGCTCACCAAGCTGTGGGTGG - Intergenic
1119667663 14:76496762-76496784 GTGGCTCAGGGGGCTGACGCTGG + Intronic
1121730306 14:96182152-96182174 CTGGATCAGAGGGTTGTCGGAGG + Intergenic
1122076457 14:99238134-99238156 CTGGCTCAGGGTGCTCCCTGAGG - Intronic
1122345396 14:101055503-101055525 CTGGCTCAGGAAGCCCTCCGAGG - Intergenic
1123017837 14:105384052-105384074 CTGGCTCAGGGCTCTGACGTCGG - Intronic
1124691701 15:31828849-31828871 CTGGCTTAGGGACCTGCCTGGGG - Intronic
1126720106 15:51569344-51569366 CTGTCTCGGGGAGCTGTGGTGGG - Intronic
1128345065 15:66848327-66848349 CTGGATCAGGCAGGGGTCGGAGG - Intergenic
1128375587 15:67072749-67072771 ATGGCTCAGGGACTTGTCAGAGG - Intronic
1128454285 15:67823840-67823862 CTAGCTCCGGGAGCCGACGGGGG + Intronic
1128597724 15:68966536-68966558 CTGCCTCAGTGATCTGTCAGTGG + Intronic
1129410854 15:75349482-75349504 CTGGCTCAGGGAGCTGACCCAGG - Intronic
1129948060 15:79559457-79559479 ATGGCTCAGGGAACTGTGGGAGG - Intergenic
1132404681 15:101535253-101535275 ATGGGACAGGGAGCTGGCGGAGG + Intergenic
1132578189 16:673516-673538 CTGGCTCCGGGGGCTGCTGGGGG + Exonic
1132581576 16:687101-687123 CTGGCACAGCGAGCTGTCCTTGG + Exonic
1132622011 16:872243-872265 CTGGCTGACGGAGCTGTCTGAGG - Intronic
1132663939 16:1073207-1073229 CTGGCTCCTGGAGCTGGAGGAGG + Intergenic
1132854133 16:2037260-2037282 CCTCCTCAGGGAGCTGGCGGTGG + Intronic
1132875589 16:2135617-2135639 GTGGCTCGGGGCGCTGGCGGGGG - Exonic
1133020326 16:2964231-2964253 CTGTCTCAGCGAGCTCTGGGCGG - Exonic
1133362696 16:5186720-5186742 CTAGCTGAGGGAGCCGTCTGCGG + Intergenic
1133913235 16:10085016-10085038 CTAGCTCAGGGAGTTGTTGCAGG - Intronic
1134519397 16:14911736-14911758 GTGGCTCGGGGCGCTGGCGGGGG + Intronic
1134554536 16:15154492-15154514 GTGGCTCGGGGCGCTGGCGGGGG - Intergenic
1134707067 16:16310391-16310413 GTGGCTCGGGGCGCTGGCGGGGG + Intergenic
1134960473 16:18401733-18401755 GTGGCTCGGGGCGCTGGCGGGGG - Intergenic
1136291923 16:29278904-29278926 CTGCCTCTGGGAGATGTTGGTGG - Intergenic
1139655992 16:68387523-68387545 CGGGCTCAGAGAGCTGCCTGGGG - Intronic
1141683313 16:85556436-85556458 CTGGCTCGGGGGTCTGGCGGAGG - Intergenic
1142097814 16:88252864-88252886 CTGCCTCTGGGAGATGTTGGTGG - Intergenic
1142567924 17:852663-852685 CTGACTCAGAGAGCAGACGGGGG - Intronic
1143508637 17:7383478-7383500 CTGGCTCAGGGAGGTGCCGTGGG - Exonic
1143778973 17:9219491-9219513 CTGGCACAGGAAGCGGTGGGAGG + Intronic
1144462024 17:15466118-15466140 CTGGGTCAGGGAGCTGACCTGGG - Intronic
1146385381 17:32367769-32367791 CAGGCTCAGGCAGCTGTCCAAGG + Exonic
1146595472 17:34164733-34164755 GTGGCTCAGTGAGTTGTCTGTGG - Intronic
1146894153 17:36529082-36529104 CTGGCTCAGACGGCTGTCTGAGG + Intronic
1147951717 17:44111304-44111326 CATGCTCAGGGAGCTGCGGGCGG + Intronic
1148438402 17:47699259-47699281 CTGGCTCTGGGAGCTGGAGGAGG + Intronic
1149806214 17:59620118-59620140 CTGGGCCATGGCGCTGTCGGGGG - Exonic
1150812492 17:68367682-68367704 CTAGATCAGGGATCTGTCAGAGG - Intronic
1151207378 17:72517932-72517954 CTGGATCAGGGAGGTGGCAGAGG + Intergenic
1152608811 17:81305805-81305827 CCGGCCCTGGGAGCTGTAGGAGG + Intergenic
1154416492 18:14178389-14178411 CGGGTTAGGGGAGCTGTCGGGGG + Intergenic
1155269619 18:24127385-24127407 CTGGTACAGGGAGCTGTGGATGG - Intronic
1156473194 18:37390285-37390307 AGGGCTCTGGGAGCTGTCGGGGG - Intronic
1157385175 18:47254247-47254269 CAGGCTCAGGGAGGAGTCGACGG + Intergenic
1157474291 18:48011503-48011525 CTGGCTCAGGGAGGAGGTGGTGG + Intergenic
1158891776 18:61879019-61879041 CTGCCTGAGGGAGCTGGAGGAGG + Intronic
1159279228 18:66263269-66263291 CTTGCTCAGGGGGCTGTCTCAGG + Intergenic
1159917373 18:74198986-74199008 CTGGGTAAGGGAGCTGGAGGTGG + Intergenic
1160770192 19:827695-827717 CTGGCCCAGGGAGCAGTTGGCGG + Intronic
1160794476 19:938540-938562 ATGGCCCAGGGAGCTGCTGGTGG + Intronic
1160909451 19:1468043-1468065 CTCGCTGAGGGAGCTGGCGGAGG - Exonic
1161232180 19:3179841-3179863 TGGCCTCAGAGAGCTGTCGGTGG - Exonic
1161612571 19:5251291-5251313 GTGGCGGAGGGAGCTGGCGGTGG - Intronic
1161650255 19:5479993-5480015 CTCGCCCAGGGAGCCGCCGGTGG - Intergenic
1164155751 19:22596050-22596072 CTGACTCCGGGAGCGGGCGGGGG - Intergenic
1168412428 19:56148028-56148050 CTGGCTTAGAGTCCTGTCGGGGG + Intronic
925262602 2:2541602-2541624 CTGGTTCTGGGAGCTTTCTGTGG - Intergenic
925298485 2:2793480-2793502 CTGGAGCTGGGAGCTGTCCGAGG - Intergenic
927245992 2:20957651-20957673 CTGGCTCAGGGAGCTGTGGAGGG + Intergenic
929830606 2:45343789-45343811 CTGGCTCAGGGCTCTGCTGGGGG + Intergenic
932091894 2:68813329-68813351 CGGGCTCTGGGAGGTCTCGGAGG - Exonic
932634556 2:73377112-73377134 TTGGCACAGGAAGCTGTTGGAGG - Intergenic
934774283 2:96927315-96927337 CTGGCTCTGGGAGCAGGCTGGGG - Intronic
934913640 2:98280506-98280528 CTGGTTCGGGGATCTGTCTGTGG + Intronic
935735954 2:106106771-106106793 CAGGCTGAGGGAGCTGGCAGTGG - Intronic
935777656 2:106487318-106487340 CTGGGTCGGGGAGCTGGGGGGGG - Intergenic
937835203 2:126464427-126464449 GTCACTCAGGGAGCTGTCAGAGG - Intergenic
938029723 2:127981721-127981743 CGGGGTGAGGGAGCTGTCGGGGG - Intronic
938460266 2:131492228-131492250 CTGGCTCAGGCGGCGGGCGGCGG - Exonic
939057056 2:137378741-137378763 CTGGCTTAGGGAGTGGTTGGGGG - Intronic
941756915 2:169196559-169196581 CTGGCCCAGAAAGCTGTCAGAGG - Intronic
944842195 2:203635122-203635144 CAGGCTCAGGCAGCTGTCCAAGG - Intergenic
945995320 2:216431592-216431614 CTATCTCATGGAGCTGTGGGAGG - Intronic
947716594 2:232342826-232342848 CTGGCTCACGGAGCTGCCCAGGG - Intronic
948605388 2:239131584-239131606 CTGGCTCTGGGGGCTGGCTGCGG + Intronic
948783633 2:240339966-240339988 CTGGCTCTGGAAGCTGGCTGTGG - Intergenic
1171396278 20:24835817-24835839 CTCGCTCAGGGAGCGGGCAGAGG - Intergenic
1172190829 20:33060977-33060999 CTGGCTCAGAGTGCTGGCAGAGG - Intronic
1172244646 20:33437685-33437707 CAGGCACAGGGAGGTGGCGGGGG - Intronic
1175895055 20:62332468-62332490 CCGGCACAGGGTGCTGTGGGGGG + Exonic
1175928595 20:62482678-62482700 CTGGCCCAGGCAGCTGGGGGAGG + Intergenic
1176122507 20:63460449-63460471 CTGTCTCAGGGGGCTGTGGGGGG - Intronic
1176856839 21:13980873-13980895 CGGGTTAGGGGAGCTGTCGGGGG - Intergenic
1176867746 21:14063345-14063367 CGGGTTAGGGGAGCTGTCGGGGG + Intergenic
1179558790 21:42199114-42199136 CTGGCTCATGGAGCTGTGATGGG + Intergenic
1179786771 21:43734682-43734704 CTGGCTCAGGGGACTGAGGGTGG + Intronic
1180800702 22:18630595-18630617 CTGGCTCAGGGGTCTGTGTGGGG - Intergenic
1180851934 22:19026152-19026174 CTGGCTCAGGGGTCTGTGTGGGG - Intergenic
1181221017 22:21364667-21364689 CTGGCTCAGGGGTCTGTGTGGGG + Intergenic
1184161393 22:42699530-42699552 CTGGCCCGGGGAGCTGACTGAGG + Intronic
1185210017 22:49565411-49565433 GTGGCTCTGTGAGCTGTAGGTGG + Intronic
950052871 3:10005397-10005419 CTGGCCCAGGGAGCGTTCTGGGG - Intronic
950949765 3:16986082-16986104 CAGGCACAAGGAGCTGTAGGGGG + Intronic
952385196 3:32836110-32836132 CTTGCTGGGGGAGCTGTCGGGGG - Intronic
952690205 3:36196568-36196590 CTGGCTCAGGGACCTTCAGGTGG + Intergenic
953843451 3:46408018-46408040 CAGGATAAGGCAGCTGTCGGAGG + Intronic
954288876 3:49638486-49638508 CTGGCTGAGGGAGCTCTCTGAGG - Intronic
954451786 3:50575691-50575713 CTGGCTCAGGGAGCTGGGGATGG - Intronic
955246277 3:57227824-57227846 CCGGCGCGGGGAGCTGTGGGCGG + Exonic
955356245 3:58235587-58235609 CCGGCTCAGGGAGGGGCCGGAGG + Intergenic
958025631 3:88045670-88045692 CTGCCTCAGGAAGCTTTTGGAGG + Intergenic
959085770 3:101849535-101849557 CTGGCTCAGGGAGCTGTCGGCGG - Exonic
961438146 3:126933330-126933352 ATGGCTCAGGAAGCTTTTGGTGG + Intronic
961487370 3:127226588-127226610 CTGGAACAGGAAGCTGTGGGTGG + Intergenic
962677480 3:137767768-137767790 CGGGCTGAGGGAGGTGTAGGGGG + Intergenic
962809818 3:138950397-138950419 CTGGTTCAGGCAGCCGGCGGCGG - Exonic
963803306 3:149698525-149698547 CTGCCTCATGGAGCTGTTGGTGG - Intronic
968981291 4:3851113-3851135 CTGGGTCAGGCAGTTGTGGGAGG - Intergenic
973164409 4:47058638-47058660 CAGGCTGAGGGAGCTGTTGGTGG + Intronic
975662116 4:76698545-76698567 CTGGCTCAGGAAGGTCTCTGAGG - Intronic
976744609 4:88390762-88390784 CTGGCTCAGGTGGCTGCCGGAGG + Exonic
976771038 4:88652979-88653001 CTGGCTCAGGTGGCTGCCGGAGG + Exonic
977162265 4:93649993-93650015 CTGGGTCAGGGAGGTGGTGGTGG - Intronic
982202779 4:152975618-152975640 CAGGGTCAGTGAGCAGTCGGTGG - Exonic
984526688 4:180866523-180866545 CTGGCTCACCAAGCTGTGGGTGG - Intergenic
985169375 4:187132172-187132194 GTGGCTTAGGGAGCTGCAGGTGG - Intergenic
985515664 5:343595-343617 CTGGCTCAGGGCGCCGTGGCGGG - Intronic
985570739 5:643484-643506 CATGCTGAGGGGGCTGTCGGCGG + Intronic
985728356 5:1527281-1527303 CAGCCCCAGGGAGCTGTGGGGGG - Intergenic
985782461 5:1878368-1878390 CTGGCTCAGGGAGGTGGCGGCGG + Exonic
992939743 5:81750762-81750784 CGGCCGCAGGGGGCTGTCGGCGG - Intronic
995183512 5:109249969-109249991 TTGACACAGGGAGCTGTCAGTGG + Intergenic
996056461 5:118988331-118988353 CGGGCTGTGGGAGCTGCCGGTGG - Exonic
996692920 5:126360234-126360256 CTGGCTCAAAGAGCTGTGGTTGG + Exonic
996871810 5:128200777-128200799 CTGGCTCAGGAAGGTGGTGGGGG + Intergenic
997589480 5:135063983-135064005 CTGGCTCAGGGAGGTGCCACAGG + Intronic
997744455 5:136287067-136287089 ATGGCTTAGGGAGCGGTAGGCGG - Intronic
998174803 5:139895183-139895205 CTGGCAGAGGGGGCTGTGGGTGG - Intronic
1000327847 5:160185812-160185834 CTGGGTAAGGGAACTGTCTGGGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006444003 6:34068807-34068829 CTGGCTCAGGGGTCTGGAGGAGG - Intronic
1007025449 6:38567722-38567744 CTAGATCAGGGTGCTGTCTGTGG - Intronic
1007175196 6:39891563-39891585 CTGGCTCCGGGAGCTGGGGCTGG + Intronic
1007631141 6:43274395-43274417 CTTGCTCAGGCAGTGGTCGGGGG + Intronic
1008457371 6:51726565-51726587 CTGGCCCAGGAAGCTGGAGGGGG - Intronic
1010926528 6:81752277-81752299 CGGGGTCAGGGAACTATCGGGGG - Intronic
1015670701 6:135686632-135686654 CTGACTGAGGGAACTGTCAGAGG - Intergenic
1016840552 6:148520240-148520262 CTTGCTCAGGGTCCTGTCTGAGG - Intronic
1020070988 7:5226982-5227004 CTTCCTCTGGGAGGTGTCGGGGG - Intronic
1020276928 7:6630210-6630232 CTGGGGCTGGGGGCTGTCGGGGG + Intergenic
1021846249 7:24765655-24765677 CTGGTTCTGGGAGCTGCCTGAGG + Intergenic
1022324485 7:29318593-29318615 CTGGCTCAGGGAGCTACCTGAGG - Intronic
1027425252 7:78055576-78055598 CAGGGTCTGGGAGGTGTCGGTGG - Intronic
1027888517 7:83939838-83939860 TTGGTTCAGGGTGCTGCCGGAGG - Intergenic
1028401892 7:90433519-90433541 CTGGCTCAATGAGCTGCAGGTGG - Intronic
1029459809 7:100688091-100688113 CAGGCTCAGGGCCCTGTCCGGGG - Exonic
1029737239 7:102471776-102471798 ATGGCCCAGGGGGCTGTTGGGGG - Intronic
1029737260 7:102471837-102471859 ATGGCCCAGGGGGCTGTTGGGGG - Intronic
1030085921 7:105815642-105815664 CTTTCTCAGGAAGCTGTCAGAGG + Intronic
1032669721 7:134072019-134072041 TGGGCTCAGGCAGCTGTGGGTGG - Intergenic
1033557963 7:142505465-142505487 CTAGGTCAGGGAGCTGTGTGAGG + Intergenic
1036203757 8:6790752-6790774 CTGGCTGAGGGAGGGGTCAGCGG + Intergenic
1039790564 8:40872533-40872555 CTGCCTTAGTGAGCTGTTGGGGG + Intronic
1041233814 8:55778601-55778623 CTGACTCAGGAACCTGTTGGGGG - Intronic
1045181842 8:99792592-99792614 CTGGGGCAGGGAGCTGTGGGAGG + Intronic
1045754295 8:105523959-105523981 CTTGCTCAGGGAGCAGTCTGGGG - Intronic
1047215076 8:122869569-122869591 CTCCCTCAGGGAGCTGTCGCCGG + Intronic
1048220101 8:132533216-132533238 CTGTCTCAGGGAGATGGCAGAGG + Intergenic
1049403467 8:142441237-142441259 CCAGCTCTGGGAGCTCTCGGTGG - Intergenic
1049659327 8:143812681-143812703 CAGGCTCTGGGAGCTGTCCCTGG - Intronic
1049720485 8:144113297-144113319 CTAGCTCAGCCAGCTCTCGGAGG + Intronic
1049780785 8:144427936-144427958 CAGGCGCAGGAAGCTCTCGGTGG + Intronic
1049807232 8:144546599-144546621 CTGGCTCCTGGAGCTGATGGAGG - Intronic
1050298054 9:4227048-4227070 CTGGTGCAGGGAGCGGTCTGTGG + Intronic
1050451337 9:5784662-5784684 CTGTCTCAGGAAGCTGTAGAAGG - Exonic
1052798446 9:32945906-32945928 CGGGCTCAGGGAGCGGTGGCAGG - Intergenic
1053119981 9:35539111-35539133 ATGGCTCAGGGAGCTGGGGGAGG + Intronic
1055611804 9:78031680-78031702 CGGGCGCGGGGAGCCGTCGGCGG - Intergenic
1056674842 9:88666415-88666437 CTGGCCCCAGGAGCTGTTGGGGG + Intergenic
1056852699 9:90097619-90097641 TTGGCATAGGGAGCTGGCGGGGG + Intergenic
1057225010 9:93288575-93288597 GTGGCTCAGAGACCTGTGGGAGG + Intronic
1060596408 9:124851803-124851825 TTGGCTCAGGCATCTGTAGGTGG - Intergenic
1060722043 9:125986027-125986049 CAGGCTCGGGGACCTGCCGGTGG - Intergenic
1061545431 9:131301644-131301666 CTGGCCCGGGAAGCTGTGGGAGG - Intronic
1061820798 9:133226323-133226345 CTGGGTCAGGGAGCTCTGGGAGG - Intergenic
1062238478 9:135523743-135523765 CTGGGTCAGGGAGCTCTGGGAGG + Intronic
1062382702 9:136295099-136295121 CTGGCTCAGGGTGGTGTCAAAGG + Intronic
1062394436 9:136347077-136347099 CTGCATCAGGCAGATGTCGGGGG - Intronic
1062537035 9:137025596-137025618 CTGGCTCAGGGAGCGGGTGGAGG - Intronic
1062727344 9:138083085-138083107 CTAGCTGAGGGAGCTGCCTGGGG + Intronic
1185482696 X:459634-459656 CAGGCTCTGGGAGCTCTCCGAGG - Intergenic
1185773113 X:2780896-2780918 CTGCCTCAGGGAGCAGAGGGGGG + Intronic
1185883899 X:3764696-3764718 CTGGCACAGGGAGCTGTAGGAGG + Intergenic
1186441516 X:9591044-9591066 CTGGCTCTGGGATCTGTCCTGGG - Intronic
1188063674 X:25631161-25631183 GTGGCTCAGGGAGCTCTCAGGGG + Intergenic
1188445375 X:30248904-30248926 CTTCCTCAGGGAGTTGTCGGGGG + Intronic
1189002566 X:36962398-36962420 ATGGCTCAGGGAACTGTTGGAGG - Intergenic
1189655853 X:43244423-43244445 CTGGGTCAGGGAGGTGGTGGTGG + Intergenic
1191863527 X:65685406-65685428 CTGGCTGTTGGAGCTGTCTGAGG + Intronic
1192020607 X:67386791-67386813 CTGTCTCAGGGAGCTGAGGTGGG - Intergenic
1192562212 X:72134561-72134583 CAGGCTCAGGGAGGCCTCGGGGG - Exonic
1197407082 X:126065910-126065932 CTGGCTCACAGAGCTGCAGGTGG + Intergenic
1198078553 X:133217244-133217266 ATGGCTCAGGGAACTTTTGGAGG - Exonic
1198927575 X:141815677-141815699 ATGTCTCTGGGAGCTGTGGGAGG - Intergenic
1199350549 X:146795184-146795206 CTGCCTCATGGAGCTGTCAGAGG + Intergenic
1199966474 X:152824723-152824745 CTGGCCCAGGAAGCTGGAGGGGG - Intergenic
1200781518 Y:7220594-7220616 CTGGCACAGGGAGATGTAGGAGG - Intergenic
1201917313 Y:19196097-19196119 CTGGCACAGGGAGCCATAGGAGG - Intergenic
1202057286 Y:20848276-20848298 CTGTCCCAGGGAGCTGTGGTGGG + Intergenic