ID: 959086990

View in Genome Browser
Species Human (GRCh38)
Location 3:101862038-101862060
Sequence TGATTTGGATGTTCATATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959086990 Original CRISPR TGATTTGGATGTTCATATAA AGG Intergenic
903370643 1:22833083-22833105 TGACTTGGTTTTTCATTTAAGGG + Intronic
908257413 1:62314444-62314466 CGATTTGGATGTTCCTAGCAGGG - Intronic
910019778 1:82572653-82572675 CGATTTGGGTGTACATATGAAGG - Intergenic
910515053 1:88051585-88051607 TGACCTGCATGTTAATATAATGG - Intergenic
910729590 1:90379763-90379785 TACTTTGGATTTTCATATTATGG - Intergenic
910870917 1:91832378-91832400 TTATTTTGAGGGTCATATAATGG - Intronic
910946833 1:92602077-92602099 TGATTTGTATGTTTATAAAAAGG - Intronic
911375621 1:97047169-97047191 AGTTATGGATGTTCATAGAAGGG + Intergenic
911993608 1:104734928-104734950 TGATTTAGATGTTTAGATACAGG - Intergenic
912197526 1:107416225-107416247 TGATCCGGATTTTCATATGATGG + Intronic
912239231 1:107887562-107887584 TAATTTGGATATTCAAATATGGG - Intronic
913670191 1:121090492-121090514 TGTTTTTGAACTTCATATAAAGG + Intronic
918443914 1:184597176-184597198 TTATTTGAATGATCAGATAAAGG + Intronic
918737862 1:188089187-188089209 TGGTTTAGATGTTGATATGATGG - Intergenic
919200692 1:194351891-194351913 TGGTTTGCATGTTCCTATAAAGG - Intergenic
921028944 1:211319631-211319653 TCAATTGTATTTTCATATAATGG + Intergenic
924057600 1:240139168-240139190 GGATTTGGTTGCTCATGTAAAGG + Intronic
1063505799 10:6598406-6598428 TGAATTGGATGTGCAAAAAAAGG - Intergenic
1064773298 10:18747705-18747727 TGTCTTGGATCTTCATACAAGGG - Intergenic
1064861011 10:19825611-19825633 TTTATTGGATGTTCATATAATGG - Intronic
1064914990 10:20447088-20447110 AGATTTGGAACTTTATATAATGG - Intergenic
1066809112 10:39302224-39302246 TGATTTGTGTGTTCAACTAACGG - Intergenic
1068338231 10:55666299-55666321 TGATTTTTATATTCATATAAAGG - Intergenic
1071595876 10:86924033-86924055 TGAATTGCCTGTTCATAAAACGG + Exonic
1080017145 11:27519479-27519501 TAATTTGGATGCTTCTATAATGG + Intergenic
1080514824 11:33010468-33010490 AGATTTGGATGTCCTTATGATGG - Intergenic
1080935826 11:36862400-36862422 TGATTTGGATGTGAATAAAAAGG - Intergenic
1081184283 11:40022832-40022854 TGCTTAGGATGTACATACAAAGG + Intergenic
1082318986 11:50773203-50773225 TGATGTGTGTGTTCATATCACGG - Intergenic
1083464690 11:62837534-62837556 TGATTTGGAAGTTGATAACAAGG - Intronic
1083977407 11:66134513-66134535 TGATTTGGATGTACAAATATAGG + Intronic
1088694008 11:112350736-112350758 TGATTTGGATGTTGACATTGTGG + Intergenic
1089834866 11:121361514-121361536 TGAATTGCCTGTTCATAAAACGG - Intergenic
1090542102 11:127718117-127718139 TGTTTTGCATGTTCATATTAAGG - Intergenic
1090792438 11:130103100-130103122 TGATTTATATGTTGATGTAATGG + Intronic
1091453515 12:588105-588127 TGATTTGGCTTTTCACATAGTGG - Intronic
1092960549 12:13592887-13592909 TGTTTTTGTTGTTTATATAAAGG + Intronic
1093473230 12:19527579-19527601 GGATTTGGATTTTCATTTGAAGG + Intronic
1094816471 12:34191194-34191216 TGCCTTGGAGTTTCATATAATGG + Intergenic
1095471023 12:42536869-42536891 TAAGTTTCATGTTCATATAATGG + Intronic
1096745919 12:53726929-53726951 TGATTCAGATGTTCACATGATGG + Intronic
1097560207 12:61195012-61195034 TGATTTTAATGTTCACAAAAAGG - Intergenic
1097756165 12:63408787-63408809 TGATTTGGATGTGCATTTAAAGG - Intergenic
1098404610 12:70110507-70110529 AGATTTAAACGTTCATATAAAGG + Intergenic
1099575553 12:84375774-84375796 TAAGTTGAATGTGCATATAAAGG - Intergenic
1099622580 12:85023446-85023468 TGTTTTGTATGCTCAAATAATGG + Intronic
1102824767 12:115939680-115939702 TGATATAGCTGTTCATATATTGG - Intergenic
1104517170 12:129438398-129438420 TGTGTTGTATATTCATATAATGG + Intronic
1105287498 13:19017521-19017543 TCATTTGGAGGTTGATATTAGGG + Intergenic
1105954460 13:25267425-25267447 TGACTTGGAAGTTGATATTACGG - Intronic
1108052918 13:46463786-46463808 CGATGTGGATGGTCATATACAGG - Intergenic
1108474828 13:50804210-50804232 TGATTCTAAAGTTCATATAAAGG - Intronic
1109661095 13:65461774-65461796 TGACTTGGAGTTTCATATGACGG + Intergenic
1110072988 13:71202466-71202488 TGATCTAGATGTTCCTATGAAGG + Intergenic
1111338969 13:86858714-86858736 AGATTTGGAAGTTCAATTAAAGG - Intergenic
1112723743 13:102277873-102277895 TGACTTGGATGGTGATATTAAGG - Intronic
1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG + Intergenic
1114381657 14:22211905-22211927 AGCTTTGGATGTTCTTAAAAGGG + Intergenic
1115724374 14:36196759-36196781 TGATGTGAATGTTTATATCATGG + Intergenic
1116219794 14:42068916-42068938 TTATTTGCATGTTCATTTCATGG - Intergenic
1116530709 14:45969434-45969456 TCATATGCATGTTAATATAAAGG + Intergenic
1116586996 14:46718462-46718484 TTATTTGCATGTGAATATAAAGG - Intergenic
1118711847 14:68525941-68525963 TGACTTGGATGTTCATGTGATGG - Intronic
1118944787 14:70374564-70374586 TAATTTGGATGATGATGTAAAGG - Intronic
1122106177 14:99457476-99457498 TGATTTGGTTGTTCCTTAAATGG - Intronic
1123678675 15:22739656-22739678 TACTTTGGATGTTCCTATCAAGG + Intergenic
1124024777 15:25955261-25955283 TGATTTGGAGGTGGAGATAATGG + Intergenic
1126385991 15:48093964-48093986 TGATCTGGATGTTCCTGTGAGGG + Intergenic
1127406236 15:58650220-58650242 TGTTTTGTTTGTTCATATACTGG + Intronic
1129573364 15:76714581-76714603 TGATTTGGAGGGACATAAAAGGG + Intronic
1131423656 15:92327886-92327908 TGACTTGGCTGATCAGATAAGGG - Intergenic
1133922996 16:10171075-10171097 AGATTTTGATGTTCATATTTTGG - Intronic
1134651691 16:15914399-15914421 TAATTTAGATGTTAATATTATGG + Intergenic
1135769889 16:25209595-25209617 TAATTTGGATGTAGATAAAAAGG + Intergenic
1136464931 16:30436140-30436162 GGATTTGGATGTGCACAGAACGG - Intergenic
1137682007 16:50356883-50356905 TGATTTTGATGAGCATAAAATGG - Intronic
1138015353 16:53423242-53423264 TTATTTGGATGTTCAGTTTATGG + Intergenic
1139074017 16:63420926-63420948 TAATTTGGAAGTAAATATAATGG - Intergenic
1141276960 16:82597044-82597066 TGGTGTGTATGTTCATATATGGG + Intergenic
1141295689 16:82766694-82766716 TTATTTGGATAATGATATAAAGG - Intronic
1141591259 16:85070349-85070371 ATATTTGGATTATCATATAACGG - Intronic
1143619047 17:8070758-8070780 TGCTGTGGATGTTCATATAGGGG - Intergenic
1146109054 17:30070618-30070640 GAAATTGGATGTTCATATGAAGG + Intronic
1146232450 17:31125170-31125192 TTATTTTGATTTTCATGTAATGG + Intronic
1146482098 17:33213057-33213079 TGTTTTGGATGCTCTTTTAATGG - Intronic
1146899080 17:36569840-36569862 TGTTTTGGAGTTTCTTATAATGG + Intronic
1149107056 17:52982332-52982354 AGATTTGGATGTGAACATAAAGG + Intergenic
1149564500 17:57631359-57631381 TGAGATGGATGTTCATAGAAAGG - Intronic
1151547665 17:74803044-74803066 ACCTTTGGATTTTCATATAATGG - Intronic
1155257688 18:24013391-24013413 GGATTTAGATATTCTTATAAGGG + Intronic
1155729839 18:29141700-29141722 GGATTTGGATGTTAATATCAGGG + Intergenic
1156693056 18:39731937-39731959 TGAACTGGATGATCAAATAATGG + Intergenic
1156845429 18:41660379-41660401 TGATTTGAATTTTGATAGAAAGG - Intergenic
1157411881 18:47469799-47469821 TGATTTGGATGTGCATATGCAGG - Intergenic
1157603439 18:48909911-48909933 TGATTTTGAACTTTATATAAAGG + Intergenic
1164127091 19:22328369-22328391 TCAGCTGGATGTTCATATGAGGG - Intergenic
1164664430 19:30017020-30017042 TGATTTGGATAATTATATTACGG - Intergenic
1166904199 19:46093992-46094014 TGCTTTGAATGTACATATCAAGG - Intergenic
1167781717 19:51602650-51602672 TAACTTGGTTGTTCATATTAAGG + Intergenic
1168498403 19:56873336-56873358 TGATGTGGATGTTCCTACAAGGG - Intergenic
928755550 2:34521409-34521431 TCCTTTTGATGTTTATATAAAGG - Intergenic
928780734 2:34815634-34815656 TGATTTGTGTGTCCAGATAAAGG + Intergenic
929387637 2:41429210-41429232 TGATTCTGATGGTCAAATAAAGG - Intergenic
930180845 2:48355246-48355268 TGTTTTGAATGTTCAGAGAAAGG + Intronic
932950840 2:76291150-76291172 TGATGTTGATGGTCATATCACGG - Intergenic
933536352 2:83579840-83579862 TGATTTGGCTGGACATTTAATGG + Intergenic
936468093 2:112771923-112771945 TGATTTGGAACTTGATATATAGG + Intergenic
936752095 2:115656181-115656203 TGATTTTGGTGATGATATAATGG + Intronic
938667828 2:133557579-133557601 TGTTTTGTATGATCTTATAAGGG - Intronic
939536008 2:143429574-143429596 TGATTTGCATGTACATTTATTGG - Intronic
939579678 2:143933017-143933039 TGATTTGGCTGTCAAGATAACGG + Intergenic
939798240 2:146674910-146674932 TAATTTGGATCATCATATTATGG + Intergenic
939916924 2:148057527-148057549 TGATTTCTATGTACATTTAATGG + Intronic
940220332 2:151344941-151344963 TGATTTTGCTCTTCATTTAATGG + Intergenic
940584574 2:155629497-155629519 TGATTTTAATGTGCATATGAAGG + Intergenic
943053579 2:182946847-182946869 TGATTAGCAAGTTCTTATAATGG + Intronic
943201248 2:184827637-184827659 TGTTCTAGATGTTCAGATAATGG + Intronic
943227909 2:185205150-185205172 TGATTTTACTGTACATATAACGG - Intergenic
943301458 2:186207605-186207627 TTATGTTGATGTTCATAAAAGGG - Intergenic
943540448 2:189207217-189207239 TGAATTGGAGTTTCATATTATGG + Intergenic
945294281 2:208155440-208155462 TGATGTTGATGTTCAGAGAAGGG - Intergenic
948153419 2:235763157-235763179 AGATTTGGATTTTCAGATTAGGG - Intronic
948397815 2:237660606-237660628 TGACTTGGAATTTCATATCATGG - Intronic
1168850798 20:975561-975583 AGATTTGGATGTCCATTTTATGG + Intronic
1169891354 20:10455947-10455969 TATTTTGGATTTTCATATTAGGG - Intronic
1171214733 20:23344148-23344170 TGATTTGCATGTCCAGAGAAGGG + Intergenic
1175103073 20:56593990-56594012 TTCTTTGGAACTTCATATAAAGG - Intergenic
1175229792 20:57466460-57466482 CGATTTGAATTTTCATATAAAGG + Intergenic
1176739446 21:10587239-10587261 AGATTTGGAAGTGCATATACAGG + Intronic
1177085531 21:16698131-16698153 TGATTTGGATGAGCATATAAGGG + Intergenic
1177646968 21:23911322-23911344 TGATGTTGATGTTCATAGGAGGG - Intergenic
1177782784 21:25638977-25638999 AGAGTTGGAAGTTCATCTAATGG - Intergenic
1177908732 21:27003329-27003351 TGATTTGGACGGTTATATCATGG - Intergenic
1178024875 21:28454882-28454904 ATAAATGGATGTTCATATAATGG + Intergenic
1178960892 21:37063933-37063955 TGATTTTGAACTTCAAATAAAGG + Exonic
1179562156 21:42222436-42222458 TGGTGTGGATTTTCCTATAATGG + Intronic
949660867 3:6276798-6276820 TAATTTTGATGTACATAAAATGG - Intergenic
950689008 3:14641013-14641035 TGACTTAGAAGTTCAAATAAAGG - Intergenic
953178393 3:40573529-40573551 TGTTTTAGACCTTCATATAAAGG + Intronic
955268804 3:57476170-57476192 TGATTTTGGTCTTTATATAAAGG - Intronic
955583382 3:60449352-60449374 TGATGATGATGTTCTTATAAAGG + Intronic
956247291 3:67198060-67198082 TGATTTGGAAGGTGGTATAAAGG + Intergenic
957231301 3:77519374-77519396 AGATTTGGAGGTACATGTAAAGG + Intronic
958121894 3:89301306-89301328 TAATTTGGATTTATATATAATGG + Intronic
958473931 3:94556457-94556479 TATTTTTGATATTCATATAATGG + Intergenic
958971182 3:100611673-100611695 TCAATTGGCTGTTTATATAAGGG + Intronic
959086990 3:101862038-101862060 TGATTTGGATGTTCATATAAAGG + Intergenic
961268256 3:125665818-125665840 ATATTTGTATGTTCCTATAAGGG + Intergenic
961352503 3:126312941-126312963 TGATGAGGATCTTCATAAAAGGG - Intergenic
963611925 3:147480086-147480108 TGACTTGGATGTTCAGCTTAAGG + Intronic
963705812 3:148687089-148687111 TGATATGGATTTTAATATAAAGG - Intergenic
965051389 3:163654242-163654264 TGATTTATATGATCATATAGTGG - Intergenic
966268650 3:178078430-178078452 TTATTTGGGTTTTCATATTATGG + Intergenic
966448595 3:180032135-180032157 TGATTTGCATGTGAATATACAGG + Intronic
970663676 4:18313266-18313288 TGATTCAGATGTTCATGTAATGG - Intergenic
972944085 4:44231945-44231967 AGTTTTGGATGTTTGTATAATGG + Intronic
974728604 4:65831487-65831509 TGAAGAGAATGTTCATATAAAGG - Intergenic
975546297 4:75563638-75563660 TGTTTTTGAACTTCATATAAAGG + Intronic
975549014 4:75590984-75591006 TGATATGGCTGTTGATATAAAGG + Intronic
977184425 4:93918825-93918847 TGATTTTGATGGTTATATTATGG + Intergenic
977774281 4:100899202-100899224 AGATTTGGATGTACATGTGAAGG - Intergenic
978046742 4:104138801-104138823 TTAATAGGATGTTCTTATAATGG - Intergenic
978269342 4:106870300-106870322 TGATTTGCTTGTTCATTCAAGGG + Intergenic
978847189 4:113287682-113287704 TGATCAGGATGCTCATACAAAGG + Exonic
978891768 4:113837401-113837423 TCTTTTGTATGTTCATATAATGG - Intergenic
979295121 4:119023216-119023238 TGAATTAAATGTTCATATTATGG + Intronic
979375205 4:119938350-119938372 TGATTTGGATACTCCTATAGAGG - Intergenic
979653479 4:123163697-123163719 GGGTTTGGATGTTCAAAAAAGGG - Intronic
979832012 4:125315543-125315565 CGATTTGGATGTACAAATAATGG + Intergenic
980189029 4:129499311-129499333 TGTTATGGGTGATCATATAAAGG - Intergenic
980246254 4:130246601-130246623 TGCTGTGGATGATGATATAAAGG + Intergenic
980305047 4:131050017-131050039 TGGTTTGGATTTTCATAAAGTGG + Intergenic
980411487 4:132425352-132425374 TAATTTGGTTGTTAATATTAGGG + Intergenic
981276521 4:142904593-142904615 TGATATGGATGGTTTTATAAGGG - Intergenic
981614258 4:146630260-146630282 TGATCTGTATATGCATATAAAGG + Intergenic
983542632 4:168929501-168929523 TGTTATGCATGTTCATAAAAGGG - Intronic
984014247 4:174407156-174407178 TAATTTGGAAATTCTTATAATGG + Intergenic
984074304 4:175155278-175155300 TCATTTGGCTGTAAATATAAGGG + Intergenic
984485032 4:180357377-180357399 TGCTATGGATGTTTATATAAGGG - Intergenic
984985279 4:185322821-185322843 TGATTTGGATGTTAACATTCTGG + Intronic
986831122 5:11579756-11579778 TAATTTGGTTGTTCCTAAAAAGG - Intronic
987392918 5:17393058-17393080 TGATTTGCATCTTTATATGATGG + Intergenic
987425701 5:17770373-17770395 TGATTTGGAAGTTCATTTTTGGG + Intergenic
988229488 5:28456239-28456261 ATAATTGGATGTTCATACAATGG + Intergenic
988310525 5:29550752-29550774 GAATTTGGAGGTTCATATAGTGG - Intergenic
988453699 5:31368766-31368788 TCATATGGATTTTCATAGAAGGG + Intergenic
991390059 5:66133173-66133195 TGTTTTAGCTATTCATATAAAGG - Intergenic
991473817 5:66998817-66998839 TGATTTGGATTTTGATACAGTGG + Intronic
991679960 5:69129233-69129255 GGATTTGGATTTTCAGATTAGGG - Intronic
992866645 5:80962852-80962874 TCATTTGCATGGTCATAAAAAGG - Intronic
994441528 5:99812048-99812070 TGCTTTAAATTTTCATATAATGG - Intergenic
994777414 5:104051564-104051586 TGATTTAAATGGTCATTTAATGG - Intergenic
995022653 5:107383441-107383463 TGATTTGGATTTTAATTTCAGGG - Intronic
995303636 5:110616812-110616834 TGATGAGGATGTTCAGAAAAGGG + Intronic
995414379 5:111892481-111892503 TTGTTTAGATGATCATATAATGG - Intronic
997035224 5:130182696-130182718 TCAGTAGGATATTCATATAAGGG - Intronic
999130632 5:149280503-149280525 TGATTCTGATGTTCACACAAGGG + Intronic
999676459 5:154008415-154008437 AATTTTGGATTTTCATATAAGGG - Intronic
1000583749 5:163068385-163068407 TGATTTGGATGTTCAAGTACAGG + Intergenic
1000912756 5:167042133-167042155 TGATTTGTATCTTCATGTAATGG - Intergenic
1002331606 5:178445313-178445335 TGATTTGTTTGTTCCTATACTGG + Intronic
1005052107 6:21694518-21694540 TGATTTGAATGATCATCCAAGGG + Intergenic
1005496253 6:26390578-26390600 TGATGTTGGTGTTCATAGAAAGG + Intronic
1006250989 6:32784634-32784656 TGAATTTGATGTCCACATAAAGG + Intergenic
1007787789 6:44291154-44291176 TGGTATGGATGTTCCTATAAAGG - Intronic
1009625025 6:66127716-66127738 TGTTTTGGATAATCATAAAAAGG - Intergenic
1009786443 6:68346241-68346263 TGATTTTGATGGTCATATTGTGG - Intergenic
1009966598 6:70584852-70584874 TAATGTGGATGTTGATATTAGGG + Intronic
1010502020 6:76612486-76612508 TGATTTGGATGAGCCAATAAAGG - Intergenic
1011985120 6:93433794-93433816 TGCTATGAATGTTCATATACAGG + Intergenic
1012724433 6:102791446-102791468 TGATTAGGATATTGATATGAGGG + Intergenic
1014248207 6:119090042-119090064 TGATTGTGATATTCATAGAAAGG - Intronic
1014926241 6:127274286-127274308 TTATTTGGGTGTTCAAATATGGG + Intronic
1015075875 6:129157187-129157209 TGAATTGCCTGTTCATAAAACGG - Intronic
1017171861 6:151463609-151463631 TCATTTGGATGTTTAAATACTGG + Intronic
1018313527 6:162534392-162534414 TGCTTTCGATGTTCAAAGAAGGG - Intronic
1020373238 7:7457506-7457528 CCATTTGGATGTTCATTTTAGGG - Intronic
1020531105 7:9336573-9336595 TGATTTCGATTTTCTTAAAATGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020983369 7:15100292-15100314 TGATTTTAATGTTCAAATGATGG + Intergenic
1023066861 7:36386921-36386943 AGTTTTGCATGTGCATATAAAGG + Intronic
1027971506 7:85088744-85088766 TGTTTTAGATTTTTATATAAGGG + Intronic
1029033361 7:97492013-97492035 TGATATGTATGTTAATAGAATGG + Intergenic
1031573544 7:123387967-123387989 TGGCTTCCATGTTCATATAATGG + Intergenic
1031705309 7:124973687-124973709 TGATATGGACGTTCATGTACAGG - Intergenic
1032521904 7:132551887-132551909 TAATTAGTATGTTCATTTAAAGG - Intronic
1032542045 7:132711228-132711250 TTATTTGGAATTTCACATAAGGG - Intronic
1034230875 7:149527524-149527546 CCATTTGCATGTTCATAGAAAGG - Intergenic
1039663519 8:39494745-39494767 TGATTTTTTTGTTCTTATAAAGG - Intergenic
1039663958 8:39499482-39499504 TGAGTTGGATTTCTATATAAAGG + Intergenic
1041159369 8:55022584-55022606 TGATTTTTATGTTTATATGATGG - Intergenic
1042746284 8:72110554-72110576 TTAATTAGATGTTCATATGAAGG - Intronic
1043926065 8:86038520-86038542 TGAAGTGTATGTTCATATAATGG - Intronic
1044891239 8:96838276-96838298 TCTTTTGCATGTTCACATAATGG + Intronic
1044985632 8:97754118-97754140 TGATTTGGATGTTTATCTTTGGG - Intergenic
1045413081 8:101939004-101939026 TGATTGGAATTTCCATATAAAGG + Intronic
1046818550 8:118611841-118611863 TGATTTGGATGCTGACATATTGG - Intronic
1051425991 9:16931891-16931913 TGCTTGGAATGTTCAGATAAAGG + Intergenic
1053252809 9:36589062-36589084 TTATTTGCATGTGCATAAAAAGG - Intronic
1053568919 9:39284085-39284107 TGACTGGGATGATCATATTATGG - Intronic
1054128225 9:61334923-61334945 TGACTGGGATGATCATATTATGG + Intergenic
1055656076 9:78451593-78451615 TGATTTGCATGTAAAAATAAAGG - Intergenic
1058001019 9:99864846-99864868 TGATTTGCATGTTCTTATCTAGG - Exonic
1058980177 9:110161641-110161663 TGATTAGGATCTTCTTTTAATGG + Intronic
1059303976 9:113339703-113339725 AGCTTTAGTTGTTCATATAATGG - Intronic
1060120965 9:120989008-120989030 TGAGTTGCATTTTCATATAGTGG - Intronic
1060712187 9:125878381-125878403 TGCATTGGATGTCCATATAAGGG + Intronic
1186683044 X:11895972-11895994 TGCTTTGGATGACTATATAAGGG + Intergenic
1188631002 X:32360129-32360151 TCATGGGGATGTTCAAATAATGG - Intronic
1189100585 X:38185310-38185332 AGATTTGGATGTTTACAAAAGGG + Intronic
1190952117 X:55156320-55156342 TGTTGTGGAGGTTCACATAAAGG - Intronic
1191591556 X:62890574-62890596 TGAATTGGATGTTCCTGTATTGG - Intergenic
1191960303 X:66693513-66693535 TGATTATGATGATCATATTAAGG + Intergenic
1192489188 X:71559285-71559307 TCTTTTGGATGTTCATATGGTGG - Exonic
1197052688 X:122078409-122078431 TGATTTTTTTGTTCTTATAAAGG + Intergenic
1197235275 X:124055329-124055351 TGATTTGAATTTACATATAATGG + Intronic
1197823205 X:130562606-130562628 TCATGTGAATGTTTATATAATGG + Intergenic
1198224666 X:134634115-134634137 TGGGTTGGATGTTTCTATAAAGG + Intronic
1199536627 X:148909762-148909784 TGATTAGTATGTTCAAATTATGG + Intronic
1200873763 Y:8130053-8130075 TGATTTTGATGGCAATATAAAGG - Intergenic
1201310589 Y:12595434-12595456 GGATTTGGAGGCTCATTTAAAGG + Intergenic
1201402303 Y:13616388-13616410 TGAATTTGTTGTTCATTTAATGG + Intergenic
1202187335 Y:22199856-22199878 TGATTTTGATGGTAATATGAAGG - Intergenic
1202188160 Y:22210838-22210860 TGATTTTGACGGTAATATAAAGG - Intergenic
1202204025 Y:22386540-22386562 TGATTTTGATGGTAATATGAAGG + Intronic
1202240910 Y:22768324-22768346 TGATTTTGATGGTAATACAAAGG + Intergenic
1202393896 Y:24402067-24402089 TGATTTTGATGGTAATACAAAGG + Intergenic
1202476889 Y:25268025-25268047 TGATTTTGATGGTAATACAAAGG - Intergenic