ID: 959101615

View in Genome Browser
Species Human (GRCh38)
Location 3:102016796-102016818
Sequence CATAACATTCTCCCAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959101612_959101615 13 Left 959101612 3:102016760-102016782 CCTCAACATATGAGTTTTGGGAG No data
Right 959101615 3:102016796-102016818 CATAACATTCTCCCAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959101615 Original CRISPR CATAACATTCTCCCAAGGAG AGG Intergenic
No off target data available for this crispr