ID: 959103386

View in Genome Browser
Species Human (GRCh38)
Location 3:102039401-102039423
Sequence CTTTCTATCTGGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959103382_959103386 -1 Left 959103382 3:102039379-102039401 CCACCACACCAGGCAGAATTTGC No data
Right 959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG No data
959103383_959103386 -4 Left 959103383 3:102039382-102039404 CCACACCAGGCAGAATTTGCTTT No data
Right 959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG No data
959103380_959103386 30 Left 959103380 3:102039348-102039370 CCTCTCAAAGTGCTGAGATTATA 0: 104
1: 4174
2: 60928
3: 353667
4: 244405
Right 959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG No data
959103384_959103386 -9 Left 959103384 3:102039387-102039409 CCAGGCAGAATTTGCTTTCTATC No data
Right 959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959103386 Original CRISPR CTTTCTATCTGGAAGAGTGA AGG Intergenic
No off target data available for this crispr