ID: 959107168

View in Genome Browser
Species Human (GRCh38)
Location 3:102077656-102077678
Sequence ACAGCAAGTCATTTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959107168_959107170 24 Left 959107168 3:102077656-102077678 CCTGCTTTAAAATGACTTGCTGT No data
Right 959107170 3:102077703-102077725 TTTGCTTTCCTCTAAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959107168 Original CRISPR ACAGCAAGTCATTTTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr