ID: 959110359

View in Genome Browser
Species Human (GRCh38)
Location 3:102115643-102115665
Sequence CAGGATAAATGGATGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959110359_959110365 6 Left 959110359 3:102115643-102115665 CCCTGCCTCATCCATTTATCCTG 0: 1
1: 0
2: 1
3: 34
4: 335
Right 959110365 3:102115672-102115694 GAAAGCTGCCTAACTAATTCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
959110359_959110367 27 Left 959110359 3:102115643-102115665 CCCTGCCTCATCCATTTATCCTG 0: 1
1: 0
2: 1
3: 34
4: 335
Right 959110367 3:102115693-102115715 GGAAAGTCTATAAACTGAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959110359 Original CRISPR CAGGATAAATGGATGAGGCA GGG (reversed) Intronic
900498209 1:2986324-2986346 AAAGATAAGTGGATGAGGGATGG - Intergenic
900750898 1:4396758-4396780 CAGAACAAAGGGCTGAGGCATGG + Intergenic
900788261 1:4663285-4663307 CATGTTTGATGGATGAGGCAGGG + Intronic
900922015 1:5678845-5678867 ATGGATGAATGGATGAGGGATGG + Intergenic
901001214 1:6149651-6149673 ATGGATAAATGGATGATGGATGG + Intronic
901469797 1:9448422-9448444 CAGGAGAAATGGCTGAGCCAGGG + Intergenic
901946004 1:12704217-12704239 CGGGAAAAATGAATGAGTCAGGG + Intergenic
903087238 1:20872809-20872831 CAGGAGAATTGCTTGAGGCAGGG - Intronic
903638583 1:24839225-24839247 CTGGAAAAATGGATGAGAAAAGG - Intronic
904912831 1:33948166-33948188 GAAAATTAATGGATGAGGCAGGG - Intronic
905424230 1:37870336-37870358 CAGGATAAATGTTTTAGGCCAGG - Intronic
909292767 1:73904709-73904731 AAGGATAAATGCTTGAGGGATGG + Intergenic
912395796 1:109342700-109342722 CAGGATGAAGGGAACAGGCATGG + Intronic
913303710 1:117400512-117400534 CAGGAGTTATGGATGAGGGATGG - Intronic
914447601 1:147763134-147763156 CAAGATAAATGGGTGAGAAATGG - Intronic
915244244 1:154544920-154544942 CAGCATGAATGGCTGAGTCAGGG - Exonic
915721349 1:157988115-157988137 CAGGCTCCATGGATGGGGCATGG - Intergenic
915964428 1:160294103-160294125 CAGGATAGATGGAAGTGACAAGG + Intronic
917058414 1:171009785-171009807 CAAGAAAAATAGATGAGTCAGGG + Intronic
917226657 1:172790791-172790813 GGGGATAAATGGAGGAGGGAAGG + Intergenic
917284757 1:173412173-173412195 CAGGCCAAGTGGATGAGACATGG - Intergenic
919844103 1:201630098-201630120 CTGAATAAATGAATGATGCATGG + Intronic
920099000 1:203505100-203505122 CATGAGAGAGGGATGAGGCAGGG + Intronic
922273143 1:224052983-224053005 CATGACAAATAGATGAGGAATGG - Intergenic
922529290 1:226331100-226331122 AAGAATAAATGGACCAGGCAAGG - Intergenic
923436155 1:233969892-233969914 CAGGAGAAATGGCTGGGGAACGG + Intronic
923523241 1:234752390-234752412 CAGGAGAATTGGATGTGGCCTGG + Intergenic
924112102 1:240710427-240710449 AAGGATAAATGCTTGAGGGATGG - Intergenic
1063375579 10:5552420-5552442 CAGGAAAGAGGGGTGAGGCATGG - Intergenic
1063535298 10:6876965-6876987 CCGGATAAAAGGATGAGGGTGGG + Intergenic
1063896115 10:10684113-10684135 CGGGATGAAGGGATGAAGCACGG + Intergenic
1064063365 10:12158819-12158841 CATGAAAAATGGAGGAGGCCTGG - Intronic
1064272591 10:13878909-13878931 CAGGACAGACAGATGAGGCAGGG + Intronic
1064604836 10:17028183-17028205 CAGGATAATTGGCAGAGGGAAGG - Intronic
1065528496 10:26645946-26645968 CAGGATATGGGGGTGAGGCAGGG + Intergenic
1065850425 10:29783112-29783134 CAGGATAAATGAAACAGGCTTGG - Intergenic
1068464797 10:57375927-57375949 CTGGATATCTGGATTAGGCAAGG - Intergenic
1069219903 10:65870058-65870080 CAGGATAAATAGCTAATGCATGG + Intergenic
1069416702 10:68206965-68206987 AAAGATAAATGGGTCAGGCAAGG + Intronic
1070317537 10:75329702-75329724 CAGGAGGATTGCATGAGGCAAGG - Intergenic
1071199570 10:83204059-83204081 GAGGAGAAATGTATGTGGCAGGG - Intergenic
1071575554 10:86723323-86723345 ATGGATAAATGGAGGAGGGAAGG + Intronic
1072979803 10:100090562-100090584 CAGTATAAGTGGCTGATGCAGGG - Intergenic
1073297818 10:102451470-102451492 CAGGAGGAGTGGCTGAGGCAGGG - Exonic
1074898188 10:117794878-117794900 CAGGATGGATGAATGAGACAGGG + Intergenic
1076046282 10:127296703-127296725 CAGGACAATGGGATGAGGGAAGG + Intronic
1076408100 10:130226727-130226749 CAGGCTGAATGGCTGGGGCAGGG + Intergenic
1076485384 10:130812344-130812366 CTGGATAAATGGATAAGGCAGGG - Intergenic
1079164913 11:18031342-18031364 ACTGATAAATGGATGAAGCATGG - Intronic
1079238990 11:18709288-18709310 CAGGAAAATTGGATGATGCTAGG - Intronic
1079630524 11:22668339-22668361 AGGGACAGATGGATGAGGCATGG + Intronic
1082007073 11:47425339-47425361 CTGGATGAATGGATGCGGGAGGG - Intronic
1082092207 11:48099186-48099208 CAGGGTAAATGGATGATTCAGGG + Intronic
1083028035 11:59566952-59566974 CAGGATATATAGAAGAGGTAAGG + Intergenic
1083300223 11:61736165-61736187 AGGGAAAAATGGATGGGGCAGGG + Intronic
1083478560 11:62929066-62929088 CAGGATAAAAAGGTGAGGGAAGG + Intergenic
1085185113 11:74569473-74569495 TAGGATATATGGAAGAAGCAGGG + Intronic
1085651286 11:78271016-78271038 CTGAATAAATGGAGGAGGGATGG + Intronic
1086196486 11:84146366-84146388 AAGGATAAATGCTTGAGGGATGG + Intronic
1086551935 11:88062806-88062828 CAGGAGAAATAGATTATGCATGG - Intergenic
1087151110 11:94860693-94860715 CAGGATAAATTTATGTGGAAAGG + Intronic
1089871875 11:121682204-121682226 TTGGATAAATGGATGAGGGAAGG + Intergenic
1090033551 11:123228647-123228669 CATTAAAAATGGATGAGGCCGGG + Intergenic
1090827868 11:130400570-130400592 CAGGAAAGATGGATGGGGGAAGG + Intergenic
1091028838 11:132165401-132165423 TGGGATAAATGGCTGAAGCAAGG - Intronic
1091280281 11:134377891-134377913 GAGGATAAATGGAGAGGGCAAGG - Intronic
1093091008 12:14920272-14920294 CAGGAGAGAAGGCTGAGGCATGG + Intronic
1093294224 12:17367860-17367882 TAGGATGAATGGGTGAGGCTTGG - Intergenic
1093806577 12:23440283-23440305 TAGGACAAATGGCTGATGCATGG + Intergenic
1094012208 12:25821226-25821248 CAGGAGGACTGAATGAGGCAAGG - Intergenic
1094275031 12:28664747-28664769 CAGGATGAAGAGATGAAGCACGG + Intergenic
1094359297 12:29612708-29612730 CAAGATGAGTGGATGAGGCCAGG - Intronic
1094606835 12:31956567-31956589 CAGGAAAAATGGTTAAGGCGGGG + Intergenic
1099316031 12:81083448-81083470 CAGGAGAAATGGTTGAAGCGGGG - Intronic
1099685741 12:85886160-85886182 CAGGATAAATGGAAAAGGAAAGG + Intergenic
1099871922 12:88360265-88360287 CAGAATAAATGGAGGAGGACAGG - Intergenic
1099994633 12:89764831-89764853 CAGGATAAATAGCTAATGCATGG + Intergenic
1100231319 12:92611143-92611165 CATGAGGAATGGATGAGGCATGG - Intergenic
1100687578 12:97003713-97003735 CAGGTTAACTGGAGGAGGCAAGG + Intergenic
1101813065 12:108124206-108124228 CAGTACAAATGAATGAAGCATGG - Intergenic
1102637300 12:114335665-114335687 CAGGAGAGATGGATGGGCCAGGG - Intergenic
1103269098 12:119657391-119657413 CAGGAGGAATGGGCGAGGCAAGG - Intergenic
1104034672 12:125090051-125090073 ATGGATAGATGGATGAGGGATGG - Intronic
1104500427 12:129280347-129280369 CAGGGTAAATGCATGTGTCATGG - Intronic
1105969528 13:25415442-25415464 GAGAATAAATGGTTGAGGAAGGG - Intronic
1106052543 13:26205096-26205118 CAGGACAAAATGATGAGCCATGG - Intronic
1106947262 13:34842457-34842479 CAGGCTAAATTGATGAGTAAAGG + Intergenic
1108758450 13:53532600-53532622 CAGGATCTAGGGATCAGGCATGG - Intergenic
1108898838 13:55371831-55371853 CAGGAGAAATGGAACAGGCCGGG + Intergenic
1109698889 13:65998890-65998912 CAGGAAAAATTGATGTGGCAGGG - Intergenic
1111799854 13:92968243-92968265 CAGGTCAAATGGCAGAGGCATGG - Intergenic
1112829576 13:103432346-103432368 CAGGATAAAGGGAAAATGCAAGG - Intergenic
1112925525 13:104670294-104670316 GAGGATAAATGAAGGAGGAAAGG + Intergenic
1114495681 14:23130215-23130237 CAGGAGAAAAGGATGAGGGCAGG - Intronic
1114805638 14:25833285-25833307 CAGGAGAAATGTATGGGGAAAGG + Intergenic
1116276527 14:42840426-42840448 AAGGATAAATGCTTGAGGCATGG - Intergenic
1117538437 14:56723786-56723808 GGGGATAAAGGGATGGGGCAGGG + Intronic
1117776085 14:59186106-59186128 CACGATTATGGGATGAGGCAGGG + Intergenic
1118378383 14:65197163-65197185 AAGGATAAATGCTTGAGGGATGG - Intergenic
1119419645 14:74500911-74500933 CGGGATATGTGGCTGAGGCAGGG - Exonic
1120745967 14:88152176-88152198 CAGCAGGAATGGAGGAGGCAGGG + Intergenic
1121159830 14:91727241-91727263 CAGGAGAAATGGATCAGGGAGGG - Intronic
1121815729 14:96926660-96926682 GAGGAGGAATGGCTGAGGCACGG - Intronic
1122363843 14:101183009-101183031 CAGGATGAATGGAAGAGTCAGGG + Intergenic
1124085328 15:26544537-26544559 CAGGGGAAATGGATGTCGCATGG + Exonic
1127253402 15:57266410-57266432 ATGGATAAATGAATGTGGCATGG - Intronic
1127968927 15:63944149-63944171 CTGGATAAAAGGATGAAGCCTGG + Intronic
1128689844 15:69715279-69715301 GAGGAGAAATGGAGCAGGCAAGG + Intergenic
1128887976 15:71305722-71305744 CAGGAGAAATGGATGAGTAGAGG + Intronic
1129072251 15:72961250-72961272 CAGGTTCCAGGGATGAGGCAAGG + Intergenic
1129889650 15:79063459-79063481 CAGGATACATGGATGATACATGG - Intronic
1131360646 15:91787786-91787808 TTGGATGAATGGATGAGGAATGG + Intergenic
1132937570 16:2489134-2489156 CAAAATGAATGAATGAGGCATGG + Intronic
1132984151 16:2755294-2755316 CAGGAGAGAAGGAAGAGGCAGGG + Intronic
1133037842 16:3044594-3044616 CAGGAGAAATGGTTGAGCCTAGG + Intergenic
1133924879 16:10183986-10184008 TAGGTTAAGTGGAGGAGGCAGGG - Intergenic
1134067928 16:11241164-11241186 AAGGACAAATGGATGAGCCAGGG - Intergenic
1134383904 16:13753987-13754009 AATGATAAATGCTTGAGGCAAGG + Intergenic
1135891787 16:26363860-26363882 AAGGAAAAATGGATGTGGGAAGG - Intergenic
1136506057 16:30704102-30704124 CTGGGGAACTGGATGAGGCAGGG - Exonic
1138092447 16:54186983-54187005 CAGGTGAAATGAATGAAGCAGGG - Intergenic
1138485231 16:57337456-57337478 CAGGAGAAATGCTTGAGGCCAGG - Intergenic
1138983076 16:62294406-62294428 CAGGATAATTGCTTGAGCCAGGG - Intergenic
1139444242 16:66987084-66987106 CAGGATAAGTGGCAGAGGCAGGG + Intergenic
1139542576 16:67629235-67629257 CAGGGGAAATGGATAAGGCTGGG - Intronic
1141314315 16:82946248-82946270 ATGGATAAATGGATGTGGGAGGG + Intronic
1142993968 17:3750296-3750318 CAGGGCAAATGGGTGAGGCTGGG + Intronic
1143152278 17:4815077-4815099 AAGGATGCATGGATGATGCAGGG + Intronic
1144446751 17:15337987-15338009 AAGGATAAAGGGATCAGTCAAGG + Intronic
1145851075 17:28097475-28097497 CAGGAAAAATTGGTTAGGCATGG + Intronic
1147376308 17:40024148-40024170 AAGGAAAAAAGGAGGAGGCAAGG + Intronic
1150246519 17:63679703-63679725 CAGGAGAAATGCTTGAGGCCAGG - Intronic
1150490611 17:65571918-65571940 CAGGATAAATAGCTAATGCATGG + Intronic
1150512752 17:65774296-65774318 CAGGCTTAATGGAGAAGGCAGGG - Intronic
1151364160 17:73606324-73606346 CCGGAAAGATGGATGGGGCAGGG + Intronic
1153988539 18:10374751-10374773 CAGGATAAAAGGAGCAGGCCAGG - Intergenic
1154014816 18:10606828-10606850 CAAAATACATGTATGAGGCAAGG - Intergenic
1155929330 18:31689442-31689464 CAGGGTAAATAGAAGAGGCTGGG + Intergenic
1156614463 18:38767128-38767150 CAGGAAGAATGGAGGAAGCAGGG - Intergenic
1156647790 18:39187427-39187449 CAGGAAAAGAGGAGGAGGCAAGG - Intergenic
1157139086 18:45087617-45087639 GAGGATGAATGGATGGGGCTGGG + Intergenic
1158115783 18:53993704-53993726 CAGGAAAAAGGGGTGGGGCACGG - Intergenic
1159971558 18:74661931-74661953 CAGAAGAAATGCAAGAGGCAGGG - Intronic
1160429584 18:78802224-78802246 CAGGAGAAAGGGATGGGGGAGGG + Intergenic
1161881488 19:6957185-6957207 CAGGATAAATAGCTGAGAAATGG + Intergenic
1162454483 19:10775064-10775086 AAAGACAAATGGATGAGGCCAGG - Intronic
1162651369 19:12091509-12091531 CAGGAGTAGGGGATGAGGCATGG - Intergenic
1164410020 19:27994381-27994403 CAGCATAACTGAAGGAGGCAGGG + Intergenic
1164932125 19:32184018-32184040 CAGGAGAAATGCATGAACCAGGG - Intergenic
1165190325 19:34057497-34057519 ATGGATAAATGGATGATGGATGG + Intergenic
1165409589 19:35651148-35651170 CAGGATCAATGGAAGAGGGCAGG - Intronic
1165953555 19:39488276-39488298 AAGGATAAATGCATGATTCATGG + Intronic
1165959155 19:39520039-39520061 CAGTATAACTGCCTGAGGCATGG + Intronic
1167005733 19:46775426-46775448 ATGGATAAATGGATGAGCTAGGG - Exonic
1167035061 19:46990286-46990308 CAGGAACAACTGATGAGGCAAGG - Intronic
1167143565 19:47668759-47668781 CAGGATACAGGCATGAGCCACGG + Intronic
927029523 2:19105888-19105910 GTGGAGAAAGGGATGAGGCAAGG + Intergenic
927664978 2:25025124-25025146 CTGGAGAAATTGATGAGGGAAGG + Intergenic
929443058 2:41980691-41980713 AAGGAAAGATGGAGGAGGCAAGG + Intergenic
931402678 2:61945417-61945439 GAGGATAATTGGCTGAGGCCTGG - Intronic
931831329 2:66054585-66054607 CAGGGTCAAAGGAAGAGGCAGGG - Intergenic
932119319 2:69083536-69083558 CAGGAGGAATGGCAGAGGCATGG - Intronic
932165940 2:69507112-69507134 CAGGATAACAGCATCAGGCATGG - Intronic
932456655 2:71853733-71853755 CAGGATGGAGGGATGAGGGAGGG - Intergenic
932919104 2:75889395-75889417 AAGGAGAAATGGAAAAGGCAGGG - Intergenic
935163386 2:100548582-100548604 CAGAAAAAAGGGATGAGGAAGGG - Intergenic
936885512 2:117306473-117306495 AAGGATAAATGCTTGAGGGATGG + Intergenic
937048645 2:118869675-118869697 CAGAATATATGGAGGAGGAAGGG + Intergenic
937074461 2:119090888-119090910 CAGGATGAGTGAATGAGGGAAGG + Intergenic
937314430 2:120921973-120921995 GAGGAGACATGGATGAGGCACGG - Intronic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
938177393 2:129146488-129146510 AAGGATAAATGCTTGAGGAAAGG - Intergenic
939695782 2:145322458-145322480 CAGGATCAATGGACAAGGTACGG - Intergenic
941850910 2:170179094-170179116 CAGGATAAATAGCTAATGCATGG + Intronic
942604327 2:177674421-177674443 AAGGAAAACTGGAAGAGGCAAGG - Intronic
942942500 2:181635436-181635458 CTAGATAAATGGGTGAGGAATGG + Intronic
944785186 2:203063245-203063267 CAGGAGAATTGGTTGAGGCCAGG + Intronic
946423497 2:219578697-219578719 CAGGAGAATTGTATGAGGCCGGG + Intergenic
946787988 2:223268212-223268234 CATGAAAAAGGGAGGAGGCAGGG - Intergenic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
948336343 2:237210370-237210392 CAGGATAATTAGAGGAGGGACGG - Intergenic
1169143764 20:3239654-3239676 CGGGATAAATGCAGGAGGCGGGG - Intergenic
1169200073 20:3704849-3704871 CAGGAGAATTGCTTGAGGCAAGG - Intronic
1170290499 20:14763715-14763737 CAGGTTAAAAGGAAGAGGAAGGG + Intronic
1170577317 20:17674305-17674327 GAGGAGCAATGGCTGAGGCAGGG - Intronic
1171940449 20:31323870-31323892 CTGGATATAGGGATTAGGCAGGG - Intergenic
1171993279 20:31713086-31713108 CAGGGTTAATGGATGACACAGGG + Intronic
1173009700 20:39170583-39170605 AAGGCTAACTGGATGGGGCAGGG + Intergenic
1173307355 20:41863060-41863082 CTGCAAAAATTGATGAGGCATGG - Intergenic
1173471829 20:43329973-43329995 CAAGAAAAATGGATGGAGCAAGG + Intergenic
1173602900 20:44308768-44308790 CAGGATAATTGCTTGAGGCCTGG - Intronic
1174024645 20:47563584-47563606 CAGTTTAAGTGGCTGAGGCATGG + Intronic
1174298366 20:49564863-49564885 CAGGATAAAGAAATGAGACAAGG + Intronic
1175533350 20:59689800-59689822 CAGGATACAGGGATGTGGCAGGG - Intronic
1175817391 20:61890448-61890470 ATGGATAAATGGATGATGGAAGG + Intronic
1178570250 21:33729085-33729107 CAGGATGAAGGGATGAGGCCAGG - Intronic
1180118451 21:45727562-45727584 CAGGAGGAATGGGTGAGGCAGGG + Intronic
1182346129 22:29666586-29666608 CAGGATAACTGTTTGAGGCCAGG + Intronic
1182873710 22:33671849-33671871 CAGCATAAATGGATTAAGAATGG + Intronic
1183482854 22:38074630-38074652 CAGGGTAAATGGATCATGGATGG - Intronic
1183949533 22:41345040-41345062 CAGGAGAATTGCTTGAGGCAAGG - Intronic
1184001173 22:41674712-41674734 GAGGATAAAAGGATGAAGGATGG + Exonic
1184155615 22:42664847-42664869 CAGGAGAAATGGATGAGTTAAGG - Intergenic
1184863874 22:47192000-47192022 AGGGATAGATGGAGGAGGCAGGG + Intergenic
1185165071 22:49256534-49256556 GAGGATAAATGGGCCAGGCATGG + Intergenic
949315389 3:2748759-2748781 TAGGATAAATGGTTAAGGAAAGG - Intronic
949373502 3:3361699-3361721 TATGATAAAAGGATGAGACATGG + Intergenic
949720571 3:6985186-6985208 AAGGATAAATGCTTGAGGGATGG - Intronic
950177762 3:10887285-10887307 GATGATAAATGGATGATGGATGG + Intronic
950230793 3:11274062-11274084 CAAGATAAATGGAAGAGGAAGGG - Intronic
951263689 3:20541984-20542006 TAAGATAAATGGATTAGGCATGG + Intergenic
951263794 3:20543495-20543517 TAAGATAAATGGATTAGGCATGG + Intergenic
951503836 3:23419194-23419216 CAGGATAACTGCTTGAGGCCAGG - Intronic
951601673 3:24383291-24383313 ATGGATGAATGGATGAGGGATGG - Intronic
951771061 3:26258264-26258286 CAGGAAACAGGGTTGAGGCAGGG + Intergenic
952391019 3:32880322-32880344 AAAAATAAATGGATGAGGCTGGG - Intronic
953087830 3:39689403-39689425 AAGAATAAATGGTTGAGGGATGG + Intergenic
953390337 3:42530198-42530220 CAGGATAAATGGGTTAAGTAAGG + Intronic
954602157 3:51878235-51878257 CAGAAGAAATGCCTGAGGCAGGG - Intergenic
954608064 3:51929085-51929107 CAGAAGAAATGCCTGAGGCAGGG - Intergenic
955949820 3:64231834-64231856 GAGGATAAAAGAATGATGCAAGG + Intronic
957957747 3:87210468-87210490 CAGGATAAATGCTTGAGGGATGG - Intergenic
957966637 3:87330083-87330105 AAGGATAAATGCATGAGGTGAGG + Intergenic
958863279 3:99469896-99469918 CAGGAGAGATGGAGCAGGCATGG + Intergenic
959110359 3:102115643-102115665 CAGGATAAATGGATGAGGCAGGG - Intronic
959870060 3:111316298-111316320 CAGGATAAATAGACTATGCAGGG + Intronic
960384616 3:117007136-117007158 CAGGATAAATAGCTAATGCATGG - Intronic
961390051 3:126547107-126547129 CAGGTAGAAAGGATGAGGCACGG - Intronic
962319079 3:134376170-134376192 CAGCATAATTGGTGGAGGCAGGG + Intergenic
963181686 3:142363407-142363429 CAGGATAATTTGATGAAGAAGGG - Intronic
965088231 3:164127291-164127313 CAGTATAAATGCATGAGGCCAGG + Intergenic
966268017 3:178070136-178070158 AAGGATAAATGCTTGAGGGATGG + Intergenic
967087147 3:186106135-186106157 CTGGGTAAATGGATTTGGCACGG - Intronic
967869993 3:194221916-194221938 CAGGATGAATGGATAAGTGAGGG - Intergenic
969367941 4:6710350-6710372 CAGGACAAAAGTATGAGCCAGGG - Intergenic
969910729 4:10443165-10443187 CAGGAAGAGTGGATGAGTCATGG - Exonic
970216491 4:13764153-13764175 AAAGATAAATGTATGAGCCATGG + Intergenic
971960690 4:33483266-33483288 CAGGAGAAATGCTTGAGGCCAGG + Intergenic
972250512 4:37295008-37295030 CAGGAGAAAAGGAGCAGGCAGGG + Intronic
972343057 4:38169370-38169392 CATGGTAAATGCATGAGACAAGG + Intergenic
972869668 4:43281782-43281804 CATGATAACTGGATGTGACAAGG - Intergenic
974743005 4:66031978-66032000 CAGGAGAATTGCTTGAGGCAAGG - Intergenic
974743348 4:66037212-66037234 CAGGATAATTGGTTGAGCCCAGG + Intergenic
974811760 4:66954890-66954912 CATGAAAAATGGTTGAGGGAAGG + Intergenic
975525618 4:75346421-75346443 TAGGATAAAAGGATGGGACAAGG + Intergenic
976163648 4:82230263-82230285 CAGGATAGATGGATGGGGTTGGG + Intergenic
976381808 4:84407974-84407996 CAGATTAAATGGATGAAGGATGG + Intergenic
977136309 4:93309237-93309259 AAGAATTAATGAATGAGGCAGGG + Intronic
978079419 4:104573884-104573906 CAGGATTAATTGCTTAGGCATGG - Intergenic
978735506 4:112079816-112079838 AAGGATCAATGGATGAGTCAAGG - Intergenic
978914814 4:114111453-114111475 TAGGAAGAATGAATGAGGCAGGG + Intergenic
979222486 4:118244589-118244611 TAGAATAAATGAATGAAGCAAGG + Intronic
979352204 4:119657239-119657261 GAGAATAAATGGTTAAGGCAAGG - Intergenic
980249315 4:130293735-130293757 AATGATAAATGGATGAAGAATGG + Intergenic
981689042 4:147486000-147486022 CAGAACAAATGTATGAGGAATGG + Exonic
982741237 4:159059765-159059787 AAGGATTAATTGATGAGACATGG + Intergenic
983051376 4:163051464-163051486 CTTGATGAATGGAAGAGGCAAGG - Intergenic
983176921 4:164600145-164600167 AATGATAAATGCATGAGGCAAGG + Intergenic
983663141 4:170152323-170152345 CAGCATAAAGGGACCAGGCATGG - Intergenic
984874735 4:184357031-184357053 CAGCAAAGATGGATGAGGCTAGG + Intergenic
985476200 5:80634-80656 GAGGAAAGATGGATGAGGAATGG - Intergenic
985709258 5:1419117-1419139 ATGGATGAATGGATGATGCATGG - Intronic
987800080 5:22684273-22684295 AAGGATAAATGCTTGAGGGATGG - Intronic
988176788 5:27737138-27737160 CAATATAAATGGTGGAGGCAAGG - Intergenic
989822221 5:45807489-45807511 CAGGAGAATTGGTTGAGGCCAGG - Intergenic
991536577 5:67675359-67675381 CAGGAGAAATGAGTGAAGCAAGG + Intergenic
992519486 5:77535652-77535674 CAGGATAAATGGCTGAAGCTAGG - Intronic
992545509 5:77810864-77810886 TAGGATAGATGGATGAGTCTCGG - Intronic
992608339 5:78484765-78484787 CAGGAAACATGGATGTGGAATGG + Intergenic
993856504 5:93082795-93082817 CAGAACAAATGGATGAAGAATGG - Intergenic
994630970 5:102287635-102287657 CAGGAGAAATGCTTGAAGCAGGG - Intronic
994969957 5:106723629-106723651 CAAAATAAATGGAACAGGCATGG + Intergenic
995087884 5:108136261-108136283 CAGGATAAATGAGTGATTCAAGG - Intronic
995207604 5:109499776-109499798 AAAGAAAAAAGGATGAGGCAAGG - Intergenic
995891277 5:116954829-116954851 CAGGAGAGAAGGATGAGGGAAGG + Intergenic
995931570 5:117452746-117452768 CAGGGCACATGCATGAGGCATGG - Intergenic
997058238 5:130470221-130470243 TAGGATGAATGGCAGAGGCAAGG + Intergenic
997230085 5:132235964-132235986 CAGAATAAATGAATGAGCAAAGG - Intronic
997776137 5:136607223-136607245 CAGCCTAAATTGATGAGCCATGG - Intergenic
997836686 5:137200061-137200083 CAGACTAAATGGAAGAAGCAGGG - Intronic
998478892 5:142445062-142445084 CAGGATAAATAGGTAATGCATGG - Intergenic
1000543538 5:162570331-162570353 CAGGATAAAAGGAAGAAGCCAGG + Intergenic
1006368522 6:33630448-33630470 CAGGCCAAATATATGAGGCAAGG + Intronic
1007709982 6:43816706-43816728 CAGGATAAATTGGTTAGACAAGG - Intergenic
1008483883 6:52014618-52014640 CTGGATAAATGGATGGATCATGG + Intronic
1010717245 6:79243804-79243826 CAGGATCCCTGGATGACGCATGG - Intergenic
1011080517 6:83485783-83485805 CAGGATAAATAGCTAATGCATGG + Intergenic
1011878559 6:91993310-91993332 CAGGATAAATGCATGTGGGATGG + Intergenic
1013437490 6:110125428-110125450 GAGGATAAAAGGAGGAAGCATGG - Intronic
1013573145 6:111450249-111450271 CAGGAGAAATGCTTGAGGCCAGG + Intronic
1013937145 6:115610777-115610799 CAGGAAAAAGGGATGAGCAAGGG + Intergenic
1014150859 6:118053497-118053519 CAGGATAATAGGATTAGGGAGGG - Intronic
1014709838 6:124793992-124794014 AAGAAGAAATGGATGAGGCAGGG + Intronic
1015862409 6:137694955-137694977 CAGGAGAAAGGGAGGAGGCCAGG - Intergenic
1015926953 6:138320274-138320296 GAGGCTAAATGGAGGAGGCAGGG + Intronic
1016103772 6:140136414-140136436 AAGGATAAATGGATAAAGTATGG + Intergenic
1016328805 6:142934816-142934838 CAAGACAAATGGAGGAGGAAAGG - Intronic
1016642947 6:146371436-146371458 AAGGATAAATGCTTGAGGGAAGG - Intronic
1019567230 7:1690330-1690352 AAGGATATATGGATGATGGATGG + Intronic
1019567305 7:1690690-1690712 AAGGATATATGGATGATGAATGG + Intronic
1019567344 7:1690867-1690889 AAGGATATATGGATGATGAATGG + Intronic
1019861470 7:3662408-3662430 CAGGACTAATGTATCAGGCAAGG - Intronic
1021631540 7:22652230-22652252 CAGGATTCTTGGATGAGGCGAGG - Intergenic
1022339362 7:29453917-29453939 CAGGATGAAAGGATGAGTAAGGG - Intronic
1022604735 7:31799768-31799790 CAGAAAAAATGGAGGAGGCAGGG - Intronic
1022910737 7:34897878-34897900 CAGGATAAAGTGTTGGGGCAAGG + Intergenic
1023172382 7:37402231-37402253 CTTGATAAATGGATGAGGCCAGG + Intronic
1023881217 7:44322758-44322780 CAGCAGAAAAGGATGGGGCAAGG + Intronic
1024924389 7:54598034-54598056 CGGAAAAAATGGATGAGGAAGGG - Intergenic
1024935459 7:54707455-54707477 CAGGAAAAATGGAGGCGGGAAGG + Intergenic
1026478150 7:70754794-70754816 ACGGATGAATGGATGATGCATGG + Intronic
1027936200 7:84606020-84606042 CAGGAGAATTGCATGAGGCCAGG + Intergenic
1028147981 7:87340121-87340143 TCAGATAATTGGATGAGGCACGG - Intergenic
1028182181 7:87737700-87737722 AAGGAAAAATGGAAGAGGAAGGG - Intronic
1029181473 7:98704960-98704982 AAGGATAAATGTTTGAGGGAAGG - Intergenic
1029937810 7:104446041-104446063 CAGGATAATTGTATAAAGCAGGG + Intronic
1030027152 7:105335430-105335452 CAGGAGAACTGGATGAGCCTAGG + Intronic
1031003402 7:116444225-116444247 CATAATAAAAGGATGATGCAAGG - Intronic
1031798870 7:126216022-126216044 CAGGATAATTGCTTGAGGCTAGG + Intergenic
1032463453 7:132128508-132128530 CAGGATGAATGGATGAGCAAGGG + Exonic
1032876831 7:136046903-136046925 CAGCATAAATGGATTAAGCTAGG - Intergenic
1034020780 7:147640210-147640232 AATAATAAATGTATGAGGCAAGG - Intronic
1034063423 7:148113965-148113987 ACGGATAAGTGGAGGAGGCAAGG - Intronic
1034219919 7:149436274-149436296 GAGGTTAAATAGATGGGGCAAGG - Intronic
1037637527 8:20712926-20712948 CAGTAAAAAGGAATGAGGCAAGG + Intergenic
1038496213 8:28004995-28005017 CAGAAAGAATGGATGAGGCAGGG + Intergenic
1041791983 8:61706668-61706690 CTAGAGAAATGGATGAGGAAAGG + Intronic
1042432536 8:68725607-68725629 CAGGATAAAGTGATAAGCCACGG - Intronic
1043123072 8:76355291-76355313 AAGGATAAATGCTTGAGGTATGG + Intergenic
1043325509 8:79045863-79045885 CAGGATAATTGGATGAACCCAGG + Intergenic
1043360570 8:79466975-79466997 CAGGCATAATGGATGATGCAAGG - Intergenic
1044168506 8:89019355-89019377 CAGGAGGATTGCATGAGGCAAGG + Intergenic
1044590276 8:93907618-93907640 CTAGGTAAATGGATGATGCATGG - Intronic
1046326913 8:112660919-112660941 CAGGATTAAGAAATGAGGCACGG + Intronic
1047066823 8:121293261-121293283 CAGAATAAAAGGATGAAGAAAGG + Intergenic
1049067420 8:140328368-140328390 CATGATCAATCGTTGAGGCATGG + Intronic
1049293426 8:141816472-141816494 AGGAATAAGTGGATGAGGCATGG - Intergenic
1049867508 8:144948374-144948396 CAGCAGAAATGGAGGAGACATGG + Intronic
1051990618 9:23147592-23147614 AAGGATAAATGCTTGAGGGATGG - Intergenic
1052711419 9:32061055-32061077 CAAGATAAATGGATTAGCGAAGG - Intergenic
1053299965 9:36941853-36941875 CAGGCTCACTGGATGATGCAGGG + Intronic
1054154165 9:61628658-61628680 CAGGATAAAAAGATGATTCAAGG - Intergenic
1055294456 9:74820127-74820149 CAGGATAAATAGCTAATGCATGG - Intronic
1056268765 9:84925685-84925707 GAGGAAAGATGGATGAGGGATGG + Intronic
1056393063 9:86156418-86156440 CAGGATAGATGGGTGAGCCTCGG + Intergenic
1056751055 9:89351555-89351577 CAGGAGAAAGGAATGAGGCCAGG - Intronic
1059143909 9:111880066-111880088 CAAGAAAAATGGTTGAGGCTGGG + Intergenic
1060269541 9:122131008-122131030 CTGAATGAATGGATGAGGCCTGG - Intergenic
1060864465 9:126984328-126984350 CAGGATAACTGCTTGAGGCCAGG - Intronic
1061417522 9:130455169-130455191 ATGGATGAATGGATGATGCATGG - Intronic
1062257624 9:135635910-135635932 TTAAATAAATGGATGAGGCATGG - Intronic
1185624842 X:1474261-1474283 GAGGATGAATGGATGAGGATGGG + Intronic
1185694252 X:2183474-2183496 CAGCATTCAGGGATGAGGCACGG - Intergenic
1186063036 X:5731284-5731306 ATGAATAAATGGGTGAGGCAAGG - Intergenic
1187058906 X:15767109-15767131 CAGAGTAAATGGATGAGGGTTGG - Intronic
1188470723 X:30536227-30536249 CAGGATTAATAGATGAGTTAGGG - Intergenic
1188633798 X:32402501-32402523 CTAGATGAATGGTTGAGGCATGG - Intronic
1189103376 X:38213329-38213351 CAGTTTAAATGAATGAGGTATGG + Intronic
1190789033 X:53682789-53682811 CAGGGGAAATGGAAGAGGCAGGG + Intronic
1191067055 X:56359572-56359594 AAGGATAAATGCTTGAGGAATGG - Intergenic
1193317859 X:80084713-80084735 GAGAATAAATGCATAAGGCATGG + Intergenic
1194372951 X:93096848-93096870 CTGGATAAATGGTTGATTCAAGG + Intergenic
1195763461 X:108271861-108271883 CAGGGTAGCTGGATGAGGAATGG - Intronic
1196421624 X:115528124-115528146 CAGTATAAATGGGTGGGGGAGGG - Intergenic
1196779720 X:119372945-119372967 CAGGATAAATAGCTAATGCATGG + Intergenic
1197600768 X:128525731-128525753 AAGGATAAATGCTTGAGGGATGG + Intergenic
1197629773 X:128845068-128845090 TAGCATATATGGATGAGGAAAGG + Intergenic
1197803615 X:130377779-130377801 CAAAATAAATGGAAGAGACAAGG - Intergenic
1199474348 X:148229296-148229318 CAGGATGAATGGAAGGGGGAGGG - Intergenic
1200680987 Y:6210885-6210907 CTGGATAAATGGTTGATTCAAGG + Intergenic
1201612616 Y:15860209-15860231 CAAGATAAATGGATTATGAATGG - Intergenic