ID: 959111008

View in Genome Browser
Species Human (GRCh38)
Location 3:102123279-102123301
Sequence TGGGTCCATAGGGGTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 1, 2: 9, 3: 59, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959110998_959111008 -1 Left 959110998 3:102123257-102123279 CCACAGAGTGTAGCCTTGTGCCT 0: 1
1: 0
2: 1
3: 25
4: 238
Right 959111008 3:102123279-102123301 TGGGTCCATAGGGGTGGGCCTGG 0: 1
1: 1
2: 9
3: 59
4: 387
959110997_959111008 6 Left 959110997 3:102123250-102123272 CCTGTGTCCACAGAGTGTAGCCT 0: 1
1: 0
2: 0
3: 12
4: 171
Right 959111008 3:102123279-102123301 TGGGTCCATAGGGGTGGGCCTGG 0: 1
1: 1
2: 9
3: 59
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959111008 Original CRISPR TGGGTCCATAGGGGTGGGCC TGG Intronic