ID: 959116467

View in Genome Browser
Species Human (GRCh38)
Location 3:102184290-102184312
Sequence CACTAGGTGCAGGTTTTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959116460_959116467 18 Left 959116460 3:102184249-102184271 CCCTTAAGGAGGGGTTGTTGTGG 0: 1
1: 1
2: 0
3: 7
4: 114
Right 959116467 3:102184290-102184312 CACTAGGTGCAGGTTTTACATGG 0: 1
1: 0
2: 0
3: 6
4: 127
959116462_959116467 17 Left 959116462 3:102184250-102184272 CCTTAAGGAGGGGTTGTTGTGGC 0: 1
1: 0
2: 1
3: 5
4: 86
Right 959116467 3:102184290-102184312 CACTAGGTGCAGGTTTTACATGG 0: 1
1: 0
2: 0
3: 6
4: 127
959116464_959116467 -8 Left 959116464 3:102184275-102184297 CCACTCTAGCCTGCACACTAGGT 0: 1
1: 0
2: 0
3: 8
4: 95
Right 959116467 3:102184290-102184312 CACTAGGTGCAGGTTTTACATGG 0: 1
1: 0
2: 0
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959116467 Original CRISPR CACTAGGTGCAGGTTTTACA TGG Intronic
900920503 1:5667441-5667463 CACTGTGTGCAGGTTGCACAAGG - Intergenic
904889740 1:33770901-33770923 CCCTTGGTGAAGGTTTTACAGGG + Intronic
1062896215 10:1105236-1105258 CACTCGGTGAATGTTTTCCAGGG + Exonic
1062952953 10:1518507-1518529 CACTACATGCAGATGTTACATGG - Intronic
1066390591 10:34974788-34974810 CAGGCGCTGCAGGTTTTACATGG - Intergenic
1067066259 10:43105766-43105788 CACCACGTGCAGGTTTGGCAGGG + Intronic
1071282406 10:84114510-84114532 CATCAGCTGCAGGTTTCACATGG - Intergenic
1071796713 10:89015448-89015470 CATTTGTAGCAGGTTTTACATGG - Exonic
1075118191 10:119644653-119644675 CACTAGATGCAGGTTGTCCCTGG + Intergenic
1077588854 11:3476221-3476243 CACGCGCTGCAGGTTTTACATGG + Intergenic
1082129779 11:48473975-48473997 CACTAAGTGAATTTTTTACATGG - Intergenic
1082247325 11:49939722-49939744 CACTAAGTGAATTTTTTACATGG + Intergenic
1084202518 11:67570312-67570334 CCCAAGGTGCAGGGATTACAGGG + Intergenic
1084828130 11:71746719-71746741 CAGGCGCTGCAGGTTTTACATGG - Intergenic
1085417800 11:76330807-76330829 TACTAAGCGCAGGTGTTACAGGG - Intergenic
1091609323 12:1990226-1990248 CACTATGTTCAGGTTTTATATGG - Intronic
1092011278 12:5114676-5114698 CATTACGTGCAGGTTAAACACGG + Intergenic
1098748817 12:74270370-74270392 CAGCAGCTGCAGGTTTCACATGG - Intergenic
1101741845 12:107506778-107506800 AACAATGTGCAGGTTCTACAGGG - Intronic
1103838241 12:123841279-123841301 AACTCCGTGCAGGTCTTACAGGG + Intronic
1104655723 12:130572521-130572543 CCCTGTGTGCAGGTTTTACTGGG + Intronic
1106202479 13:27551919-27551941 CCCTATATGCAGGTTTCACACGG - Intronic
1108626780 13:52236671-52236693 CACTACATGCAGGTTTTTCATGG - Intergenic
1108659289 13:52569787-52569809 CACTACATGCAGGTTTTTCATGG + Intergenic
1111255663 13:85664191-85664213 CACTGGGGGCAGGTACTACAGGG - Intergenic
1117138163 14:52758831-52758853 CCCAAGGTGCTGGTATTACAGGG + Intronic
1119521552 14:75289722-75289744 CACCAGGTTCAGGAGTTACATGG + Intergenic
1119791797 14:77357329-77357351 CACTAGGTGCAGGGTTAATGAGG - Intronic
1121990543 14:98552776-98552798 CACCAGGGGCACCTTTTACATGG + Intergenic
1123467756 15:20529044-20529066 CACCAGGAGCATGTTTCACAAGG + Intergenic
1123650357 15:22471998-22472020 CACCAGGAGCATGTTTCACAAGG - Intergenic
1123728069 15:23124253-23124275 CACCAGGAGCATGTTTCACAAGG + Intergenic
1123740765 15:23280840-23280862 CACCAGGAGCATGTTTCACAAGG - Intergenic
1123746233 15:23321718-23321740 CACCAGGAGCATGTTTCACAAGG + Intergenic
1124278500 15:28345035-28345057 CACCAGGAGCATGTTTCACAAGG + Intergenic
1124304200 15:28566573-28566595 CACCAGGAGCATGTTTCACAAGG - Intergenic
1126350111 15:47736918-47736940 CTCTTGGTGCTGGTATTACAGGG - Intronic
1129525512 15:76211352-76211374 CACAAGGTGTAGGTTTGACCTGG - Intronic
1129826408 15:78637779-78637801 CACTAGGAGCATCTTTCACAAGG - Intronic
1131694233 15:94857586-94857608 CACTTGGTGCAGATTGTAAATGG - Intergenic
1133169508 16:3972728-3972750 CCCTAGGGGCAGATTTTAAATGG - Intronic
1133523549 16:6581747-6581769 AACTAGAGGCAGGTTTTACTGGG + Intronic
1133649647 16:7799634-7799656 CAATTGGTGCATGTTTTAAATGG + Intergenic
1134819077 16:17230882-17230904 TACTAGGTGCCGGTAGTACAGGG - Intronic
1138126332 16:54441810-54441832 CACTAGGTGACGGTTTTAGGAGG + Intergenic
1140791513 16:78396230-78396252 CACCAGGGGCAGGTTTTTGAAGG - Intronic
1143882135 17:10037753-10037775 CACTAGGTGAAATGTTTACATGG - Intronic
1145864659 17:28233191-28233213 CAGGTGCTGCAGGTTTTACACGG + Intergenic
1155329110 18:24696676-24696698 CACATGATCCAGGTTTTACATGG + Intergenic
1155655517 18:28187852-28187874 TACTTGGTGCAGTTTTTAAAAGG + Intergenic
1155937369 18:31767719-31767741 CCCTAGGACCAGTTTTTACATGG - Intergenic
1158292268 18:55955326-55955348 CAGCAGTTGCAGGTTTCACACGG - Intergenic
1161769334 19:6222837-6222859 CAGTAGGTGAGAGTTTTACATGG + Intronic
1161957604 19:7505312-7505334 CACTACGTACAGGTATGACAAGG + Exonic
1164481257 19:28612569-28612591 CAGGTGCTGCAGGTTTTACATGG - Intergenic
1168441918 19:56375908-56375930 CAAGAGGGGCTGGTTTTACAGGG - Intronic
925565926 2:5254263-5254285 CACTAGTTGCATGTGTAACATGG + Intergenic
930871894 2:56179316-56179338 GATTAGGTGCAGTTTTTATAAGG + Intergenic
932366487 2:71156515-71156537 CACTAGGAGCATCTTTCACAAGG - Intergenic
933188381 2:79304119-79304141 CACTAGGAGCTGGTTGTATAAGG + Intronic
937108485 2:119342349-119342371 CCCAAAGTGCAGGTATTACAGGG - Intronic
937898139 2:126994252-126994274 CACTTAATGCAAGTTTTACATGG + Intergenic
945800660 2:214425910-214425932 CCCAAAGTGCTGGTTTTACAGGG - Intronic
945834301 2:214820900-214820922 CCCTAGGTGCTGCCTTTACAAGG + Intergenic
946557060 2:220870263-220870285 ATCTTGTTGCAGGTTTTACAGGG - Intergenic
948075355 2:235161491-235161513 CACTTGGTGCAGGAGTCACAGGG + Intergenic
948639370 2:239364936-239364958 CACAGGGTGCAGATTTTAAATGG + Intronic
1169086428 20:2827265-2827287 TACTAGCTGCAGATTTTTCATGG - Intergenic
1169515672 20:6313257-6313279 CACTACATTCAGGTTTTTCATGG - Intergenic
1171408704 20:24931477-24931499 CAGGCGCTGCAGGTTTTACACGG - Intergenic
1171816201 20:29787856-29787878 CACTGTGTGCAGGTTGCACAAGG + Intergenic
1171902163 20:30868184-30868206 CACTGTGTGCAGGTTGCACAAGG - Intergenic
1176123766 20:63466033-63466055 CACTGTGGGCAGGTTTTACCAGG - Intronic
1178447897 21:32662094-32662116 CAGCAGCTGCAGGTTTCACACGG - Intronic
1180335537 22:11574119-11574141 CACTGTGTGCAGGTTGCACAAGG - Intergenic
1182991854 22:34775891-34775913 CACTATGTGCAGGGTTTTTATGG - Intergenic
952667137 3:35921198-35921220 CACTATATTCAGGTTTTTCATGG + Intergenic
959116467 3:102184290-102184312 CACTAGGTGCAGGTTTTACATGG + Intronic
959852419 3:111104711-111104733 TACCAGATGCATGTTTTACAAGG + Intronic
959932753 3:112001003-112001025 CACTGTGAGCAGTTTTTACAAGG - Intronic
961892667 3:130143597-130143619 CAGGCGCTGCAGGTTTTACATGG + Intergenic
963637838 3:147821939-147821961 CACTAACTGCATGTTTTAGAAGG - Intergenic
965896657 3:173585344-173585366 CTCTACATGCAGGTTTTCCAAGG - Intronic
966559568 3:181304908-181304930 CACTATGAGCATCTTTTACAAGG - Intergenic
967674134 3:192275998-192276020 CAGTAGGTGTTGGTTTTATATGG - Intronic
968664962 4:1816014-1816036 CACCAGGTCCAGGGTTTCCACGG + Intronic
969410293 4:7023867-7023889 CTCTAGGTGCAGGTTTTCCCTGG + Intronic
970037303 4:11752573-11752595 CACTTCTTTCAGGTTTTACAAGG + Intergenic
984711077 4:182885687-182885709 CATTTGGTCCAGGTTTTAAATGG - Intergenic
985431684 4:189887528-189887550 CAATACCTGAAGGTTTTACAAGG - Intergenic
985940624 5:3132932-3132954 GAGAAGGTGCAGGGTTTACAGGG + Intergenic
986557195 5:9023313-9023335 CACTACGTTCAGGCTTTTCATGG - Intergenic
987640726 5:20608574-20608596 TACTAGGAGCAGGTTACACAAGG - Intergenic
990558504 5:56960804-56960826 CCCTAGCTGCAGGTTTTGCTTGG + Intronic
990626271 5:57615002-57615024 CCCTAGGTGAAGGTCTAACAGGG + Intergenic
990640282 5:57775876-57775898 CACTAGGAGAGGGTTTTGCATGG + Intergenic
993461579 5:88189431-88189453 CAGGTGCTGCAGGTTTTACATGG + Intergenic
993861660 5:93143935-93143957 TAGTAGGTGCAGGTGTTATAGGG - Intergenic
1000940442 5:167354115-167354137 CACTAGATCCTGGGTTTACATGG + Intronic
1001481021 5:172089311-172089333 CATTAGGTGTAAGTTCTACAAGG + Intronic
1002911410 6:1493834-1493856 CCCAAGGTGCAGGAATTACAGGG + Intergenic
1009942073 6:70301835-70301857 CATTAGGTTCTGGTTTTCCATGG - Intronic
1013596932 6:111668899-111668921 CAACAGGAGCAGGTTTTTCATGG - Intronic
1022931517 7:35120932-35120954 CACTAAGTGCTGGGATTACAGGG + Intergenic
1024624611 7:51194838-51194860 CACAACGTGCAGGTTTTTAATGG + Intronic
1024721802 7:52145168-52145190 CCTTAGGTGCAGGTATGACATGG + Intergenic
1025242392 7:57288138-57288160 CACTAGGGACAATTTTTACATGG + Intergenic
1025269843 7:57500070-57500092 CTCAAGGTGCAAGGTTTACAAGG + Intergenic
1027550465 7:79586764-79586786 AACTATATGCAGGTATTACATGG - Intergenic
1028175011 7:87645341-87645363 CCCAAAGTGCAGGTATTACAGGG + Intronic
1028326714 7:89536287-89536309 CACTGGTTACAGCTTTTACAAGG - Intergenic
1040072131 8:43196815-43196837 TACTAGGTGCTGGGATTACAGGG - Intronic
1041001007 8:53453275-53453297 TAGTTGGTGCAGGTTTTGCAGGG - Intergenic
1044051672 8:87513766-87513788 CACTAGTTGTATGTTGTACATGG + Intronic
1047830553 8:128625056-128625078 CATTAGTTGCAGATTTTATATGG + Intergenic
1048170044 8:132097474-132097496 CACCACGTGGAGGTTATACAAGG + Intronic
1048244583 8:132779182-132779204 CACTAGGTGAAGAATGTACATGG + Intronic
1053469468 9:38335898-38335920 CATTTGGTGCTGGTTTTACTTGG + Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1056545384 9:87608735-87608757 CACTAGGAACAGCTTTTAGATGG + Intronic
1056963703 9:91148604-91148626 CCCTAGGGGCAGCTTTTAAAGGG - Intergenic
1058892961 9:109376529-109376551 CACCAAGTGCAGGTTCTAGAGGG + Exonic
1061205452 9:129160514-129160536 CACTAGACGCAAATTTTACAAGG - Intergenic
1061634641 9:131899583-131899605 CCCTAGGCCCAAGTTTTACATGG - Intronic
1062223891 9:135437916-135437938 CAGGCGCTGCAGGTTTTACACGG + Intergenic
1203367876 Un_KI270442v1:274141-274163 CACTGTGTGCAGGTTGCACAAGG + Intergenic
1189385142 X:40531127-40531149 CACCAGATGCAGGTTTAACCCGG + Intergenic
1190487841 X:50946446-50946468 CATTATGTGCAGTTTTTCCATGG + Intergenic
1194280289 X:91943612-91943634 CGTTAGCTGTAGGTTTTACATGG - Intronic
1195734915 X:108001894-108001916 CACTACATTCAGGTTTTTCATGG - Intergenic
1200393892 X:155971604-155971626 CAGTGGCTGCAGGTTTCACACGG + Intergenic
1200597766 Y:5167106-5167128 CGTTAGCTGTAGGTTTTACATGG - Intronic
1201297227 Y:12474308-12474330 CATTGGCTGCAGGTTTCACACGG + Intergenic
1202015554 Y:20402570-20402592 CACAACGTGCAGGTTTAACTAGG + Intergenic