ID: 959123358

View in Genome Browser
Species Human (GRCh38)
Location 3:102259715-102259737
Sequence TTATTTAACCAGTTCTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959123356_959123358 29 Left 959123356 3:102259663-102259685 CCAATCTCTTTTCAAATGGTGGC 0: 1
1: 0
2: 2
3: 17
4: 184
Right 959123358 3:102259715-102259737 TTATTTAACCAGTTCTGTATTGG 0: 1
1: 0
2: 7
3: 48
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959123358 Original CRISPR TTATTTAACCAGTTCTGTAT TGG Intronic
903293295 1:22328301-22328323 TTTTTTAACCAGTTAGGCATGGG - Intergenic
904643679 1:31949526-31949548 TTATTTAACAGGTTCCCTATTGG + Intergenic
906531068 1:46524364-46524386 TAATTTAACAAGTTCAGTACTGG - Intergenic
906751169 1:48262548-48262570 TAATTTAACCATTCCTCTATTGG - Intergenic
907133720 1:52119746-52119768 TTAATAAATCAGTTCTGTATAGG + Intergenic
907497850 1:54856658-54856680 TTATTTAATCACTTCTATACTGG + Intronic
909784385 1:79592809-79592831 TTATTTCTCCAGCTCTATATTGG + Intergenic
910054903 1:83021945-83021967 TTATGAAACCAGTTTTCTATGGG + Intergenic
910350042 1:86286195-86286217 GTATTTAACCAGTCCCTTATTGG - Intergenic
911206463 1:95096292-95096314 GTATTGAACCATTTATGTATTGG + Intergenic
911757338 1:101574205-101574227 TTATTTAAAAAATTCTGTTTTGG + Intergenic
912125035 1:106525862-106525884 TTTTTTTACCATTTCAGTATGGG + Intergenic
912339120 1:108893434-108893456 TTTTTTACCCAGTACTCTATTGG + Intronic
913015025 1:114724210-114724232 TTATTTAAACAATTCTATTTAGG - Intronic
916570568 1:166022610-166022632 TTCTTTAATCTGTTCTGTGTTGG + Intergenic
918639925 1:186827519-186827541 TTCTTTCACCAGTTGTGTCTGGG + Intergenic
918747499 1:188223782-188223804 TTCTTTATCCATTTGTGTATTGG + Intergenic
918908525 1:190532032-190532054 TTTTTTAACCACTTATGCATAGG + Intergenic
918948477 1:191102376-191102398 TTATTTAAACGTTTCTATATAGG - Intergenic
920146178 1:203863012-203863034 TCATTTAATAAGTTCTATATTGG - Intronic
920331788 1:205213686-205213708 TTATTTAACAAGTCTTCTATTGG + Intergenic
921871779 1:220148410-220148432 TTTTATAAACAGTTCAGTATTGG + Exonic
922624784 1:227028259-227028281 TTATTTAATCAGGTATGTAAAGG - Intronic
923587795 1:235290648-235290670 TTGTTTTTGCAGTTCTGTATAGG - Intronic
924359356 1:243220537-243220559 TTTTTTAACCAATTCTGAATTGG - Intronic
1063534169 10:6866845-6866867 TTATTCAACCTATACTGTATTGG + Intergenic
1064660335 10:17601410-17601432 TTAATTAACGAGTGCTGAATAGG + Intronic
1064690102 10:17908243-17908265 TTATCTAATCAGTAATGTATTGG - Intronic
1065569179 10:27051273-27051295 TTCTGGAACAAGTTCTGTATTGG + Intronic
1066457869 10:35587321-35587343 TGAATCAACCAGTTCTGTCTGGG + Intergenic
1066674722 10:37876030-37876052 TAATATAAGCAGATCTGTATGGG + Intergenic
1070032354 10:72689557-72689579 GTATTTAACCATTTCCCTATTGG + Intergenic
1070066059 10:73035577-73035599 TTATTTAACCAGTACTTAATTGG - Intronic
1070208942 10:74294810-74294832 TTTTTTACCCAGTTTTCTATTGG + Intronic
1075285315 10:121180291-121180313 TTATTTAACCTGTTCCTTACTGG + Intergenic
1079498973 11:21080566-21080588 TTATTTAAACAGATCACTATTGG + Intronic
1079965355 11:26973488-26973510 TTATCTAAACAGTGCTATATTGG - Intergenic
1080193282 11:29577145-29577167 TAATATAATCAGTTATGTATAGG + Intergenic
1080208609 11:29758579-29758601 ATATTTACCAAGTACTGTATTGG - Intergenic
1080335222 11:31187724-31187746 TTTTTTAACCAGCTCTGTGAAGG - Intronic
1080874074 11:36260789-36260811 TTATTTAGCCAGTTTCCTATTGG - Intergenic
1080889278 11:36395200-36395222 TTATTTAACCAGTCCCCTATGGG - Intronic
1081436018 11:43028136-43028158 TTATTTACACATTTCTGTTTAGG - Intergenic
1081940853 11:46940252-46940274 TTATTTAACCAGTCCCGCACTGG + Intronic
1083761935 11:64823564-64823586 ATCTTCAACCAGTTGTGTATTGG - Exonic
1084131703 11:67140820-67140842 TTAATTCACCAGTTATTTATTGG + Intronic
1084137393 11:67195874-67195896 TTTTATAACCAGTTCTCAATAGG + Intronic
1084891424 11:72238830-72238852 TTATTTAAACTGTTCTGTGTGGG + Exonic
1085021204 11:73210069-73210091 GTATTTAACCAGTCCTCTGTTGG - Intergenic
1087255393 11:95947613-95947635 TTACTTAATGAGTACTGTATTGG + Intergenic
1087585845 11:100120942-100120964 TTATTTTTCCAGTACTGTAGGGG + Intronic
1087759519 11:102090859-102090881 TGATTGAATCAGTTCTGTAGTGG + Intergenic
1087897087 11:103598363-103598385 TTATTCAACTAGTCCTCTATCGG + Intergenic
1088550485 11:111007837-111007859 GTATTTAACCAATTCCTTATTGG - Intergenic
1088672028 11:112151169-112151191 TTATTTAATCAATTCTTAATTGG - Intronic
1089431956 11:118432507-118432529 TACTTTAATCAGTTCTCTATCGG - Intergenic
1093438533 12:19165554-19165576 TTATTTAATCAGTTTTAAATTGG + Intronic
1093441663 12:19204628-19204650 TTATTTAAAAATTTTTGTATAGG + Intronic
1093458812 12:19389750-19389772 TTATTTAACCAGTTCGCTGCAGG - Intergenic
1094241137 12:28226098-28226120 TGATTTAACCAGTTTTATTTTGG + Intronic
1094331035 12:29293843-29293865 ATATTAAACCAGTTCTATGTCGG + Intronic
1095194083 12:39292101-39292123 TTATTTTAACATTTCTGAATGGG + Intergenic
1095607173 12:44083055-44083077 TTATTTATCCATTTTTCTATCGG + Intronic
1095659388 12:44712164-44712186 TTATTTAATTACTTATGTATTGG - Intronic
1095734250 12:45538961-45538983 TTATATAACCATTACTTTATTGG + Intergenic
1095800140 12:46263543-46263565 TTATTGAACCGGTTTTGTTTAGG - Intronic
1095850861 12:46803608-46803630 TTATTTATCCAGTCCTGTGCAGG + Intronic
1096625505 12:52893107-52893129 TTACTTAACCAGTCCTCTATTGG - Intergenic
1097089861 12:56496442-56496464 TTATTTAACAAATTCCCTATTGG + Intergenic
1097238821 12:57559106-57559128 TTATTTAACCAGGCCTCTGTTGG + Intronic
1097807636 12:63983534-63983556 TTATTTATTTAGCTCTGTATTGG - Intronic
1100785594 12:98074595-98074617 TTATGTAGCTATTTCTGTATTGG - Intergenic
1101631465 12:106499124-106499146 TTATTGAACCATTTCTGAAATGG - Intronic
1103707443 12:122885365-122885387 TTATATAACCATTCCTTTATTGG - Intronic
1107060625 13:36155945-36155967 TTATTTAATCAGTTCATCATAGG - Intergenic
1107575603 13:41717377-41717399 TTACTTAACTAATTCTCTATTGG - Intronic
1108051965 13:46454196-46454218 TTATTCAAGCATTTTTGTATTGG + Intergenic
1108444887 13:50498288-50498310 TTATTTAACCATTCCCCTATTGG + Intronic
1108476522 13:50824142-50824164 TTAAATAACAAATTCTGTATTGG - Intronic
1108595729 13:51947062-51947084 TTAATTAACCAATTCCGTATTGG - Intronic
1109539326 13:63751997-63752019 TTATTCAAGCATTTTTGTATTGG - Intergenic
1109544518 13:63827837-63827859 TTATTCAAGCATTTTTGTATTGG + Intergenic
1110121887 13:71892645-71892667 TTTTATAACCAGTTCTGAATTGG - Intergenic
1111656337 13:91158431-91158453 TTTTTTAACCAGTACTGTGTAGG + Intergenic
1112330406 13:98473182-98473204 TCATTTAACCCATTCTGTGTAGG - Intronic
1113070024 13:106411322-106411344 TTGTTTAACCCGTGCAGTATGGG - Intergenic
1113114119 13:106856897-106856919 TTATCAATCCAGCTCTGTATAGG + Intergenic
1113502578 13:110788680-110788702 TGATTTAGTCAGTTCTCTATTGG - Intergenic
1116460805 14:45171027-45171049 TCATTTAAACATTTCTATATAGG + Intronic
1117185904 14:53240678-53240700 TTATTTAACTAGCACTGTAAGGG - Intergenic
1117938254 14:60932465-60932487 TTATTTAACCATGTCTTTAAAGG - Intronic
1118967230 14:70599105-70599127 TTTTTCAACCAGTATTGTATAGG - Intronic
1120656374 14:87194988-87195010 TTATTTAACTAGTTCTTCATTGG - Intergenic
1124562379 15:30786914-30786936 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1125890112 15:43259342-43259364 ATTTTTAACTAGTTCTCTATGGG - Intronic
1125963828 15:43856169-43856191 TTATTTAACCAGATCTCTCTTGG + Intronic
1126698638 15:51347799-51347821 TAATTTAACTAGTACTGGATTGG - Intronic
1127777306 15:62275203-62275225 TTATTGAACCAGTTCCCTGTTGG + Intergenic
1129484591 15:75857691-75857713 TTATTTAACCAACTCTTTATTGG - Intronic
1130267936 15:82425670-82425692 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1130276511 15:82479623-82479645 TTATTTAACCAACTCTTTATTGG + Intergenic
1130468877 15:84207020-84207042 TTATTTAACCAACTCTTTATTGG + Intergenic
1130475134 15:84259057-84259079 TTATTTAACCAACTCTTTATTGG - Intergenic
1130476367 15:84321571-84321593 TTATTTAACCAACTCTTTATTGG + Intergenic
1130482549 15:84373110-84373132 TTATTTAACCAACTCTTTATTGG - Intergenic
1130495398 15:84466559-84466581 TTATTTAACCAACTCTTTATTGG - Intergenic
1130504089 15:84521164-84521186 TTACTTAACCAGTTCCCTGTTGG + Intergenic
1130507491 15:84559040-84559062 TTATTTAACCAACTCTTTATTGG + Intergenic
1130591171 15:85211619-85211641 TTATTTAACCAACTCTTTATTGG + Intergenic
1132427827 15:101734427-101734449 TTATTTAACCAACTGTTTATTGG + Intergenic
1134130245 16:11644414-11644436 TTATTCAACCAGTTCCTTCTTGG - Intergenic
1134395313 16:13857088-13857110 ATAGTTAACCAGTTCCCTATTGG - Intergenic
1135342690 16:21662872-21662894 TTATTTAAGCATTTCATTATTGG + Intergenic
1135623790 16:23978164-23978186 TTTTTTAAAAAGTTCTGTACAGG - Intronic
1135633874 16:24057481-24057503 TTCTTTAATCTCTTCTGTATGGG + Intronic
1135802250 16:25508251-25508273 TTATTAAACCAGATCTGGATTGG + Intergenic
1137812004 16:51361396-51361418 TTATTTAACCATCTGTGTATAGG + Intergenic
1139423704 16:66865860-66865882 TTGTTTAACCAGGTCTCTACAGG - Intronic
1140238784 16:73182649-73182671 TTCTTTATCCAGTTCTTCATTGG - Intergenic
1141332542 16:83124988-83125010 TTATAAAACCAATTCTTTATTGG + Intronic
1144113941 17:12067175-12067197 ATATTTAACTAGTTCCTTATTGG + Intronic
1145931490 17:28689264-28689286 TTATTTAACCAGTTCCCCATTGG + Intronic
1146247356 17:31300534-31300556 TTATTCAACCAGTCCCCTATTGG + Intronic
1153386780 18:4507262-4507284 TTCTTTATCTAGTTCTCTATAGG - Intergenic
1153902665 18:9631957-9631979 TTGTTTAATAAGTTCTCTATTGG - Intergenic
1155963079 18:32011557-32011579 TTATTTAACCAGTCACCTATTGG + Intergenic
1156797144 18:41059794-41059816 TAATTTAACCAGTACTGTAAAGG - Intergenic
1157785433 18:50477755-50477777 TTATTGAACCAGTCCCCTATTGG - Intergenic
1158377246 18:56884834-56884856 TTATTGCACCAGTTTTGTGTTGG - Intronic
1159526278 18:69594959-69594981 TTTTTTAACTAGTTCATTATTGG - Intronic
1163934123 19:20425937-20425959 GCATTTATCCAGTGCTGTATTGG + Intergenic
1164432840 19:28203059-28203081 TTATTTATCCAATCATGTATTGG - Intergenic
1164503957 19:28842655-28842677 CTATTTAATCAATTCTGTTTTGG - Intergenic
925159070 2:1670237-1670259 TTATTTAACAAGTTCTCTTTTGG - Intronic
925361777 2:3285029-3285051 GTATTTAACCACTTCTCCATTGG - Intronic
926545754 2:14237195-14237217 TTATTTAACAAGTTCCAGATGGG + Intergenic
927244679 2:20948027-20948049 TTATTGAATTAGTTCTCTATGGG + Intergenic
928023018 2:27718468-27718490 TTACTTAACCATTTCCTTATTGG - Intergenic
928047587 2:27952956-27952978 TTCTTTAGCCAGTTCTATATTGG + Intronic
929640170 2:43570189-43570211 TTATGGAACCAGTGCTGTACCGG - Intronic
931523282 2:63124007-63124029 TTATTTAACCACTCCTTTTTTGG + Intronic
932211455 2:69934821-69934843 TTATTTAACCAGTTCCCTCCTGG + Intronic
932333054 2:70910658-70910680 ATATTTAGCCATTTCTCTATCGG + Intronic
932843929 2:75115556-75115578 TTATTTAACCAATCATTTATTGG - Intronic
934207278 2:89942094-89942116 TTTTCTTACCAGTTCTGAATAGG + Intergenic
934981196 2:98843663-98843685 TTAATTAACCATATTTGTATGGG + Intronic
936744772 2:115561663-115561685 TTATTTAACCAGTGTTGCAATGG + Intronic
939053589 2:137334690-137334712 TTCTCTAACCACTCCTGTATGGG - Intronic
940206124 2:151203629-151203651 TTCTTTAACCATTTCTTTAAAGG - Intergenic
940308600 2:152253117-152253139 TTATTTAACCAGCTACGAATTGG - Intergenic
940902094 2:159134926-159134948 TTTTTTAAGCAGTTTTGTTTAGG + Intronic
941648922 2:168072018-168072040 TTATTTAACCATTTCCTTCTTGG - Intronic
942089828 2:172479106-172479128 TTATTTAACCAGTACCTAATCGG - Intronic
943325414 2:186491609-186491631 TAATTTACCCAGCTCTGTTTGGG + Intronic
943921993 2:193719821-193719843 TTATTTAAATAGTTATTTATTGG + Intergenic
945270716 2:207936820-207936842 TTATCTAACCAGTTCTTTTTTGG - Intronic
945832209 2:214801250-214801272 TCATTTAACCATTTCCTTATTGG - Intronic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
947102273 2:226633847-226633869 TGATTTAACCTCTTCTTTATAGG - Intergenic
947366422 2:229400678-229400700 TTATTTAATCATTTATTTATGGG - Intronic
1168872764 20:1145269-1145291 GTATTTATTCAGTTCTGTGTAGG + Intronic
1169005117 20:2200413-2200435 TTATTTACCCAGTTCCCTATTGG + Intergenic
1169282948 20:4282477-4282499 TTAATTAACCAGTTCTCTACAGG + Intergenic
1169472054 20:5894953-5894975 TTATTCATCCAATTCTGTGTCGG + Intergenic
1170875993 20:20250782-20250804 TTATTTAAACAGTTTTGTGAGGG - Intronic
1171117650 20:22539831-22539853 TTTTTTAACCAGTCCATTATGGG - Intergenic
1172856546 20:38008379-38008401 GTATTTAACCAGTCCTTTCTTGG - Intronic
1173506764 20:43593504-43593526 TTATTTAACCAGTCATCTACTGG - Intronic
1173900588 20:46585041-46585063 TTATTTAACCAATTCCTTATTGG - Intronic
1175097707 20:56554798-56554820 TAATTTAACCAGTTCCCTACTGG + Intergenic
1175416957 20:58807958-58807980 TTATTTAACCAATCCTGTGATGG + Intergenic
1176699806 21:10031964-10031986 TTACTTAGCCATTTCTCTATTGG - Intergenic
1177033116 21:16007398-16007420 TGAGTTAACAAGTTCTTTATTGG + Intergenic
1177217897 21:18153015-18153037 ATAATTAACCAGTTATGTCTAGG - Intronic
1177634152 21:23765402-23765424 TTAATTTACCAGCTCCGTATGGG + Intergenic
1179401539 21:41089072-41089094 TTATTTAATCAGTTCCTCATTGG - Intergenic
1181816708 22:25442974-25442996 TTAATTAAACAATTATGTATGGG + Intergenic
1184139245 22:42568505-42568527 TTATGTGACCTGTTCTGTAGTGG + Intronic
1185252042 22:49807887-49807909 TATTTTAACCAGTTTTGAATTGG - Intronic
950296757 3:11838726-11838748 TGATTTAATCAGTTGTGCATAGG - Intronic
950629229 3:14271041-14271063 TTATTTAACCAGTTCCCTGTTGG + Intergenic
951029453 3:17864799-17864821 TTATTTAACCATTCCTTTATTGG + Intronic
954549365 3:51467744-51467766 TTAATTCAACAGTGCTGTATAGG - Intronic
955759273 3:62260615-62260637 CTATTTATCAAGTTCTGAATAGG + Intronic
956170327 3:66428575-66428597 TTAATTTTCAAGTTCTGTATGGG - Intronic
956640764 3:71413305-71413327 TTATTTAGCCAGTTCCATACTGG - Intronic
959123358 3:102259715-102259737 TTATTTAACCAGTTCTGTATTGG + Intronic
959342800 3:105151852-105151874 TTATCTAACCAGTTGTGTGGAGG - Intergenic
960076972 3:113497397-113497419 TTATTTATCCTGTGCTTTATTGG - Intronic
961767412 3:129222152-129222174 TTATTTACCCATTTTTCTATTGG - Intergenic
962922386 3:139962514-139962536 TTATTTAAACAGAACTATATAGG + Intronic
963836659 3:150064568-150064590 GTATTTAATCAGTCTTGTATTGG + Intergenic
964323167 3:155518929-155518951 TTATTTTACCAGCTCTGGATCGG - Intronic
964865938 3:161260976-161260998 TTATTTATCCATTTTTGTTTTGG + Intergenic
965641187 3:170830465-170830487 TTACCTAACAATTTCTGTATGGG - Intronic
967679487 3:192343634-192343656 TTATATAACCACTTTTGTATTGG - Intronic
967970738 3:194997218-194997240 TTATTTAACCAATGCCCTATTGG - Intergenic
968034465 3:195534681-195534703 TTTTAAAAGCAGTTCTGTATTGG - Intronic
968263748 3:197346064-197346086 TTACTTAACCACTTCTTTATTGG + Intergenic
969161831 4:5266956-5266978 TTATTTAACCTGTGCTGCAGTGG - Intronic
970492768 4:16591747-16591769 TTTTTTTACCATTTCTGAATAGG - Intronic
971291239 4:25342106-25342128 TTATTGAGTCAGTTCTGTAGAGG + Intronic
972297245 4:37751778-37751800 GTATTTAACCAGTCCTCTACTGG + Intergenic
973694211 4:53474138-53474160 TTATTTAACCAGTTCCTAATTGG + Intronic
973964042 4:56142308-56142330 TTAATTAGCCACTTCTGTAATGG + Intergenic
974570799 4:63646170-63646192 TTATTTTTCCACTTCTGTATTGG + Intergenic
974738335 4:65970736-65970758 TTAATTATACAGTTCTGGATGGG - Intergenic
975958769 4:79875251-79875273 ATATTTATCCAGGTCTGTGTAGG + Intergenic
976010639 4:80484111-80484133 TTATTTCACCAGCTCTTTAGGGG - Intronic
976258502 4:83123730-83123752 TTTTTTAAACAGGTGTGTATAGG - Intronic
976925099 4:90486273-90486295 TTTTTTAACCTCTTATGTATAGG + Intronic
977375065 4:96192092-96192114 TTATTTCACCAATTCTCTCTTGG + Intergenic
978220027 4:106259908-106259930 TTATTTAATCACTTCTGTTATGG - Intronic
978383330 4:108153777-108153799 TTATTTAACCAGTATTTTATTGG - Intronic
978414151 4:108457987-108458009 TTATTTAACTAGTCCGCTATTGG - Intergenic
979253172 4:118586335-118586357 TTATTTCACAAGTTCAGTGTCGG - Intergenic
980164758 4:129212330-129212352 ATATTTAACCATTACTTTATTGG + Intergenic
984088145 4:175337338-175337360 TTATTTAACCAATTTTATATTGG + Intergenic
984309662 4:178041180-178041202 TGATTTAAACAGTTATTTATTGG - Intergenic
985326394 4:188775890-188775912 TTATTGTACCAGTTTTGTGTTGG + Intergenic
986600977 5:9472886-9472908 TTATTGAATAAGTTATGTATAGG + Intronic
986829981 5:11565942-11565964 TTATCTAAACAGTTATGTTTTGG + Intronic
990566419 5:57033966-57033988 TTATTTAACTACTTCTCTATTGG - Intergenic
990662064 5:58027185-58027207 GTATTTACCCAGTTCCGTCTTGG + Intergenic
992300752 5:75377476-75377498 TTATTTAATCAGTTCTGCATTGG - Intronic
992813220 5:80409817-80409839 TGATTTAACCATTTTTGGATTGG + Intronic
993331059 5:86600451-86600473 TTTTTTAGCCATTTCTTTATTGG - Intergenic
993820252 5:92605620-92605642 TTATTTAAACAGTTTGCTATAGG + Intergenic
994057832 5:95439468-95439490 TTATTTATCAAATTTTGTATTGG + Intronic
995296258 5:110526810-110526832 TTATTTAACCAATTTTCTATTGG - Intronic
995629474 5:114117726-114117748 TAATATTTCCAGTTCTGTATTGG - Intergenic
995698993 5:114912566-114912588 TTATTGGACTAGTTTTGTATTGG - Intergenic
995980075 5:118090777-118090799 TTATTTGAGCATTTTTGTATTGG - Intergenic
996693350 5:126365736-126365758 TTATTTAAACAGTGATGCATTGG - Intronic
997315271 5:132928626-132928648 TTATTTAATCAGTACTGTGTTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000815324 5:165914618-165914640 TTATGCATCCATTTCTGTATTGG + Intergenic
1001047055 5:168382109-168382131 TTATTTAACCAGACCTCGATGGG - Intronic
1001777051 5:174336963-174336985 TTATCTAACCAGTTCTTTTCAGG + Intergenic
1003575899 6:7294154-7294176 AGATTAAACCTGTTCTGTATTGG - Intronic
1003757165 6:9135003-9135025 TTTTTTAAAAAGTTCTGTCTTGG + Intergenic
1003894300 6:10592356-10592378 TTATTTAACCTCTTCAGTAAAGG + Intronic
1004226250 6:13787116-13787138 TTAATTAACCATGTCAGTATTGG - Exonic
1005720446 6:28596219-28596241 TTATTTAACCAGTTCTCTGTTGG - Intronic
1007634699 6:43292133-43292155 CTATTTAACCAGCTCCATATTGG + Intergenic
1007876456 6:45107831-45107853 TTATTTATTCAGGTATGTATAGG - Intronic
1008168343 6:48168443-48168465 TAATTTAAGAAGTTCTGTATGGG + Intergenic
1008222381 6:48871351-48871373 TTATTTAGCCTGTTTTCTATCGG + Intergenic
1008459575 6:51752479-51752501 CTATTTTACCAGTTTTGTAAAGG - Intronic
1009955010 6:70442904-70442926 TTATTCAACCAGTCCCCTATTGG + Intronic
1011709632 6:90039165-90039187 TTATATAACCAATTCTCTATTGG + Intronic
1012280621 6:97323624-97323646 TTTTATAACCAGTTCTCTAGGGG - Intergenic
1012817272 6:104039985-104040007 TTATTTAATCAGTCCTTTAATGG - Intergenic
1013089654 6:106888628-106888650 TTAATAAATCAGTTCTGTCTAGG + Intergenic
1015470984 6:133606174-133606196 TAAGTTAACCAGTCCTCTATTGG - Intergenic
1016278982 6:142391068-142391090 TTATTTAACCAGTATCCTATTGG + Intronic
1020570835 7:9859049-9859071 TTCTTTTGCCAGTGCTGTATGGG + Intergenic
1020678799 7:11211158-11211180 CACTTTAACCAGTTATGTATAGG - Intergenic
1021052116 7:15999830-15999852 TTGTTTAACCAATTCTTTACTGG - Intergenic
1021112713 7:16713782-16713804 TTCTTTAACAAGTTCAGCATTGG + Intergenic
1021207683 7:17805660-17805682 TCATTTAACCAGTTCATAATAGG - Intronic
1022007608 7:26280597-26280619 TTATTTAAACATTTCTGTATTGG + Intergenic
1022483079 7:30756716-30756738 TTCTATAACCAGCTCTGTAAAGG + Exonic
1022684657 7:32585076-32585098 TTTTTTAAACAGTTTTCTATTGG + Exonic
1022850917 7:34261112-34261134 TTATATAATTAGTTCTGTCTTGG - Intergenic
1023013121 7:35940830-35940852 GTATTTACCCAGTTCTCTACAGG - Intergenic
1023261261 7:38360522-38360544 TTATTTTATAAGTTCTGTTTTGG + Intergenic
1024425004 7:49215412-49215434 TTAATTGACCATATCTGTATGGG + Intergenic
1025126403 7:56348416-56348438 GTATTTACCCAGTTCTCTACAGG - Intergenic
1026325867 7:69309864-69309886 TTATTTCACCAGTCCTCTCTTGG - Intergenic
1028821093 7:95212849-95212871 TTCTTTAACCAGTTGGGTCTGGG + Intronic
1029136006 7:98372104-98372126 TTCTTTTAGTAGTTCTGTATAGG + Intronic
1030926437 7:115461168-115461190 TTATTTAATCAATTTTGGATGGG + Intergenic
1031234930 7:119162890-119162912 TTATTTATCCATTCATGTATTGG + Intergenic
1033495692 7:141892435-141892457 TTATTTCACCAGTAATTTATAGG - Intergenic
1033735937 7:144221886-144221908 TTACTTAATCAGTCCTGTATTGG + Intergenic
1033747114 7:144329066-144329088 TTACTTAATCAGTCCTGTATTGG - Intergenic
1033836402 7:145317507-145317529 TTATTTAACCAGTCTCCTATTGG + Intergenic
1034515477 7:151574193-151574215 TTATTTAACTAGTCCTATTTGGG - Intronic
1034575062 7:151989483-151989505 TTGTTTAGCCATTTCTGAATAGG + Intronic
1034918932 7:155063201-155063223 TTATTTATACAAATCTGTATGGG + Intergenic
1037849758 8:22317547-22317569 TTATTTAACCAATCCTCTCTTGG + Intronic
1038554622 8:28499401-28499423 TTATTTAACCAATTTCTTATTGG + Intronic
1039017393 8:33166909-33166931 TTATTTAGCCAGTTCTCTATTGG - Intergenic
1039770530 8:40682177-40682199 TTATTTTACCATTTATATATAGG + Intronic
1041112836 8:54502747-54502769 TAATTTTATCAGTTCTGGATTGG + Intergenic
1041199124 8:55433321-55433343 TCATTTAGCGACTTCTGTATAGG - Intronic
1042037419 8:64550659-64550681 TTATTCAACCAGTCCTCTCTTGG + Intergenic
1043112622 8:76206774-76206796 TTATTTATCCACTTCAGTATGGG + Intergenic
1043343059 8:79265411-79265433 TTATGTAGCCAGTTCTACATGGG - Intergenic
1044105204 8:88196503-88196525 TTATTTATTCAGCTCTTTATTGG - Intronic
1044983584 8:97738988-97739010 TTACTTAACCATTTCCCTATTGG + Intergenic
1046300625 8:112281611-112281633 TTATTCAAAGAGTACTGTATTGG + Intronic
1046485585 8:114883515-114883537 TTATTTGATCAGATCTGTTTGGG + Intergenic
1046572952 8:115989857-115989879 ATATTTCAGGAGTTCTGTATTGG - Intergenic
1047161161 8:122381544-122381566 TTATTTAACCAGTTCATGAGGGG - Intergenic
1047339315 8:123965232-123965254 TAACTTAATCAGTTCTCTATTGG + Intronic
1050427534 9:5526896-5526918 TTATTTAACCACTTCCCTGTTGG + Intronic
1051687646 9:19675305-19675327 TTATTGCACTAGTTTTGTATTGG + Intronic
1053267813 9:36728540-36728562 TTATTAAAGCAGTCCTGTAGTGG + Intergenic
1053636955 9:40018433-40018455 TTACTTAGCCATTTCTCTATTGG - Intergenic
1053769074 9:41446469-41446491 TTACTTAGCCATTTCTCTATTGG + Intergenic
1054317784 9:63615226-63615248 TTACTTAGCCATTTCTCTATTGG - Intergenic
1054547745 9:66357970-66357992 TTACTTAGCCATTTCTCTATTGG + Intergenic
1055061055 9:72069280-72069302 TTATTTAAGCCGTTCAATATAGG - Intronic
1055515253 9:77027091-77027113 TTATTTAAACATTTCCCTATGGG - Intergenic
1058968369 9:110057689-110057711 TTACTAAACCAGTGCTGTAGGGG + Intronic
1059927384 9:119224090-119224112 TTATTAAGCCAGTTCTATACTGG + Intronic
1202784819 9_KI270719v1_random:2023-2045 TTACTTAGCCATTTCTCTATTGG - Intergenic
1185979762 X:4764686-4764708 TTATTTAACCATTTTTGTATGGG + Intergenic
1186774065 X:12846592-12846614 TTACTTAACCATTTCTCTAACGG - Intergenic
1187165985 X:16804308-16804330 TTATTTAACCAGTTCCCTATTGG + Intronic
1187544926 X:20240697-20240719 TTATTTAACCAGTCCCTTGTTGG - Intronic
1188290797 X:28385948-28385970 TTATTTTTCCAAATCTGTATTGG - Intergenic
1188302069 X:28516660-28516682 TTATTTAACAAATTCTCTACTGG + Intergenic
1189024592 X:37379495-37379517 TTATTTAATCAGTCCTCTATTGG - Intronic
1189124076 X:38426933-38426955 TTATTTAGTCATTTCTGTCTAGG + Intronic
1190120579 X:47656109-47656131 TTATTGAAGCAGATCTGTGTTGG - Intronic
1190446495 X:50530568-50530590 TTATGGAACCAGTGCAGTATTGG - Intergenic
1191189107 X:57647556-57647578 TTATTTATCCTGTTCTTTAAAGG - Intergenic
1192413169 X:70953186-70953208 TTATTTAACTAGTTCCATACTGG - Intergenic
1193137307 X:77986123-77986145 TTATTTCCCCACTTCTGTTTTGG + Intronic
1193254808 X:79335227-79335249 TTATTTATCCAATTCTCTGTTGG + Intergenic
1193864206 X:86709844-86709866 TTATTTCAACAGGTGTGTATGGG - Intronic
1194073529 X:89359026-89359048 TTATTTAACCATATGTGTGTGGG + Intergenic
1194162423 X:90470385-90470407 CTATTTAAGAAGTTGTGTATGGG + Intergenic
1194305459 X:92241778-92241800 TTATTGAACCAATTCTAGATTGG + Intronic
1194570621 X:95550405-95550427 TCATTTAAGGGGTTCTGTATTGG + Intergenic
1194966274 X:100292202-100292224 CTACTTAACCAGTGCTGTAATGG + Exonic
1195028744 X:100905567-100905589 TTTTTTCAGCAGTTCTGTTTGGG - Intergenic
1196543874 X:116939934-116939956 TTGATAAATCAGTTCTGTATAGG + Intergenic
1196777989 X:119358340-119358362 TTATTTAACTAGTCTTATATTGG - Intergenic
1197577075 X:128227657-128227679 TTCTTTATCCATTTCTCTATTGG - Intergenic
1198536967 X:137595890-137595912 TTATTTTACCAGTGCTCCATCGG + Intergenic
1199083519 X:143604307-143604329 TTTTTTAACCAGTTTTATTTTGG + Intergenic
1200508702 Y:4048119-4048141 CTATTTAAGAAGTTGTGTATGGG + Intergenic
1200728911 Y:6710603-6710625 TTATTTAACCATATATGTGTGGG + Intergenic
1201383686 Y:13414166-13414188 TTATTTAACCATTTATTTAGTGG - Intronic
1202365817 Y:24163432-24163454 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1202504965 Y:25506690-25506712 TTACTTAACCAGTTCCCTGTTGG + Intergenic