ID: 959124169

View in Genome Browser
Species Human (GRCh38)
Location 3:102270245-102270267
Sequence TATAATGCTGATAATGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959124169 Original CRISPR TATAATGCTGATAATGTTAT TGG Intronic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
907998508 1:59657141-59657163 AATAATACTGATAATGTAATGGG - Intronic
908835105 1:68221894-68221916 AATAAGGCTTACAATGTTATGGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909119987 1:71590298-71590320 TATAATTCAGATAGTGGTATTGG + Intronic
909961211 1:81845362-81845384 TATAATTCTGATAATTGTACTGG + Intronic
910135548 1:83964548-83964570 TTTAATGCTCATCATCTTATTGG + Intronic
910136319 1:83975071-83975093 TATAATGCTCACTATGTAATAGG - Intronic
910787376 1:91015041-91015063 TATAATGGTAATAAGATTATGGG + Intronic
910941297 1:92537838-92537860 CATAATGCTGAAAATGTTTTTGG + Intronic
911404944 1:97425174-97425196 TATACTGCTGATTTTCTTATAGG - Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911605668 1:99901982-99902004 TATAATGCTGTGAATATTTTTGG - Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
916553020 1:165867564-165867586 TCTAATGCTGAAAATGCTGTGGG - Intronic
916629129 1:166593050-166593072 TTTAAAGCTGACAATGGTATAGG + Intergenic
917967872 1:180189854-180189876 TTTAATCCTCATAATGTTAGTGG + Intronic
918723388 1:187884348-187884370 TATAGTACTGATAATTTTAGAGG + Intergenic
919986665 1:202680548-202680570 TATAACAGTGATAATGTTGTGGG - Intronic
920723239 1:208409759-208409781 GATCATGGTGAAAATGTTATTGG + Intergenic
920945813 1:210527510-210527532 TATGATGCTGATAATGGTGATGG - Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922110177 1:222548282-222548304 TCTAGTGCTGCTAGTGTTATGGG + Intergenic
922496977 1:226064725-226064747 TATATCACTGATAATGTTAATGG + Intronic
922991542 1:229917483-229917505 TATAACGCTGGTATTATTATCGG - Intergenic
923264752 1:232303766-232303788 GATAATGCAGATAAAGTTCTTGG + Intergenic
1063988840 10:11537553-11537575 AATAATGGTAATAATGCTATTGG - Intronic
1065608759 10:27449052-27449074 TAAAATGCATATAATGTTATGGG + Intergenic
1066097070 10:32082692-32082714 TCTAATACAGATGATGTTATTGG - Intergenic
1066152943 10:32643173-32643195 TTAAATGCTGCTTATGTTATTGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067720842 10:48726681-48726703 AATAATGCTGCTGATCTTATTGG + Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068061251 10:52070533-52070555 AATAATGCTGAGAATTTTCTAGG - Intronic
1068372319 10:56132627-56132649 TATAATGCTAGTACTGTTTTAGG - Intergenic
1069306156 10:66972647-66972669 TATAAAGCTTTTAATATTATGGG - Intronic
1071936938 10:90542446-90542468 TATGGTGCTTATTATGTTATAGG + Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1072933545 10:99690066-99690088 TAAAATACTAATAATGTGATGGG - Intronic
1079290819 11:19186226-19186248 TATGCTGCTGAGAAGGTTATGGG - Exonic
1080051860 11:27866109-27866131 TATAATGCTTACTGTGTTATGGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080546896 11:33329456-33329478 TATAATCATGATTATGTAATAGG - Intronic
1080831928 11:35902645-35902667 TAGGATGCTGATATTGTTACTGG - Intergenic
1080907610 11:36562378-36562400 TATGAAGCTGGTAATGTTCTTGG - Intronic
1081113705 11:39171357-39171379 AATAATGATGATGATGCTATCGG - Intergenic
1086274068 11:85104117-85104139 TAAAATGGTGCAAATGTTATGGG + Intronic
1086802826 11:91198516-91198538 TTCAATGTTGATAATGATATAGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087274399 11:96146190-96146212 TATAATTTTTATAATATTATTGG + Intronic
1087513455 11:99128058-99128080 TATATTTCTTTTAATGTTATTGG - Intronic
1087646798 11:100817365-100817387 TATAAGTCAGATAATGTTAAGGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088029820 11:105234120-105234142 TATAATACTTTTAATGATATGGG + Intergenic
1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG + Intronic
1088392833 11:109334326-109334348 TATAATACTAAAAATATTATAGG - Intergenic
1089028866 11:115301809-115301831 TTTAATTCTTATAATGTTATGGG - Intronic
1090444369 11:126750712-126750734 TATAATGTTTATTATTTTATAGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1091136530 11:133195736-133195758 TATAGAGCTTATAATCTTATGGG - Intronic
1092316367 12:7419135-7419157 TATCTTTCTGATAATGTTGTTGG - Intronic
1093350043 12:18087912-18087934 TAAAATGTTCATAATGTCATAGG + Intronic
1093600365 12:21014166-21014188 TGTAATGATAATACTGTTATAGG + Intergenic
1093818995 12:23588488-23588510 TATTATTCTTTTAATGTTATGGG - Intronic
1093947879 12:25130826-25130848 TGTAATACTAATAATATTATAGG - Intronic
1094785221 12:33840964-33840986 CCTAATTCTGATAATGTTATTGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095992975 12:48050833-48050855 TATAATGTTGGCCATGTTATAGG + Intronic
1097852263 12:64423797-64423819 TAAAATATTGATAATATTATTGG + Intronic
1098436971 12:70478008-70478030 AATAATGTTGATAATTTGATAGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099554498 12:84094109-84094131 CATAATACAAATAATGTTATAGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100703583 12:97176464-97176486 TAAACTGCTGATAATGTTTTTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101286369 12:103317402-103317424 AATAAGGCTGATGATGTCATGGG - Intronic
1103405705 12:120673731-120673753 TAAAATGGAGATGATGTTATAGG + Intergenic
1104101718 12:125618782-125618804 TATTATGTTAATAATGTTATAGG + Intronic
1104790371 12:131477772-131477794 GATAATGATGATAATGTTGACGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106790744 13:33152875-33152897 TTTAATGCTCATTCTGTTATAGG - Intronic
1108259551 13:48643165-48643187 TATAATGTTGATTATCTTATAGG - Intergenic
1109165984 13:59035751-59035773 TATAATACTAATTATGTAATTGG + Intergenic
1109332592 13:60948070-60948092 TATAATGCTCTTAATGGCATAGG - Intergenic
1109401495 13:61835515-61835537 TATAATGATGAAAAAGTTAATGG + Intergenic
1109856162 13:68130523-68130545 AATAATAATGATAATGTTTTTGG + Intergenic
1109932156 13:69230141-69230163 AATAATGTTGATAATCTGATAGG + Intergenic
1109960329 13:69620853-69620875 TATATAGGTGATAATGTTACCGG + Intergenic
1110304649 13:73971263-73971285 TATAATGAGGATAATGGTTTGGG + Intronic
1111188853 13:84781568-84781590 TATACTGATGAGAATGTTGTAGG - Intergenic
1111267748 13:85840711-85840733 TATAATGCTTAATATGTTTTGGG - Intergenic
1112423415 13:99274626-99274648 CATAATACTGTTAATGTTAATGG + Intronic
1112581788 13:100682602-100682624 TATGAACCTGATTATGTTATAGG + Intergenic
1112608752 13:100934748-100934770 TATAATGATCATTGTGTTATTGG - Intergenic
1112873847 13:104011114-104011136 TATATTGATGCTAATGATATAGG - Intergenic
1114207947 14:20590696-20590718 AATAATGGTGATAATTTTCTTGG - Exonic
1114235327 14:20818700-20818722 TAAAATGTTAATAATGTTGTAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1115012168 14:28562123-28562145 AATAATTCTGATATTGCTATAGG + Intergenic
1115840126 14:37460957-37460979 TATGATGCTGGTAATTTGATAGG - Intronic
1115979383 14:39032664-39032686 TTTCATGATGATAATGTTTTTGG - Exonic
1116146698 14:41082091-41082113 TATAATGTTTATAATATTCTTGG - Intergenic
1117734745 14:58757129-58757151 TATTTTGCTTATAATGTTGTGGG + Intergenic
1118083097 14:62384835-62384857 TATTTTGCTCATAATTTTATTGG + Intergenic
1120454747 14:84717041-84717063 TACAATGCAGATAAAGGTATTGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1125738786 15:41946807-41946829 TAAAATGCTGATCATTTAATTGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1128830704 15:70765619-70765641 TAGAATGCTTAGCATGTTATAGG + Intergenic
1129915168 15:79263554-79263576 TATTATGCTAAAAATTTTATGGG + Intergenic
1130083723 15:80758912-80758934 TATAATGCTTATTATGTTTTGGG - Intergenic
1131444143 15:92481936-92481958 TATAATGTTGAGAAGATTATTGG - Intronic
1138098164 16:54230057-54230079 TAAAATGTTGATATTTTTATCGG - Intergenic
1138240366 16:55422766-55422788 AATAATGCTGATAGAGTTATTGG - Intronic
1138919939 16:61515192-61515214 TATAATTCTTATAGTGATATAGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139205751 16:65026796-65026818 TCTAATGTGGAAAATGTTATGGG - Intronic
1139238618 16:65367337-65367359 TATAATGCTTATAATGTGCCAGG + Intergenic
1143613255 17:8033108-8033130 TATAATAATGATTATATTATTGG - Intergenic
1147473918 17:40691440-40691462 TATCAAGCTGATATTGTTATTGG + Intergenic
1149037496 17:52151700-52151722 GATGATGATGATAATTTTATGGG + Intronic
1149115470 17:53089564-53089586 TATAATGCCTATCATGTAATAGG - Intergenic
1149206727 17:54256423-54256445 TATTATGCTCACAATGTTGTTGG + Intergenic
1149280372 17:55098001-55098023 TATAATGATGATGATGATAATGG - Intronic
1149490437 17:57081000-57081022 TATAATGATAAAAATGTCATTGG + Intergenic
1150744249 17:67803505-67803527 TATAAAGCTGATGATGTCTTAGG - Intergenic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1153031320 18:715523-715545 TTTAATGTTGATAATTTAATTGG - Intergenic
1153194137 18:2574781-2574803 TATAATGCTTGTAATGTTGGGGG - Intronic
1153724139 18:7937650-7937672 TCAATGGCTGATAATGTTATGGG - Intronic
1155129722 18:22920917-22920939 TATTTTTCTGATAATGTTAATGG - Intronic
1155333124 18:24737997-24738019 TATGAAGCTGATAATGTAAAAGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157218233 18:45803112-45803134 TGTAAGGCTGATAATGTCTTTGG - Intergenic
1157493121 18:48137562-48137584 TATAATTCTAGTAATTTTATTGG - Intronic
1158223654 18:55177674-55177696 AATAATGCAGATAATTTCATGGG + Intergenic
1158693126 18:59679644-59679666 TTTAATGATGATAATGCTGTGGG + Intronic
1158754219 18:60302709-60302731 TATAATGCTGATAGTGTTGATGG + Intergenic
1159265073 18:66069969-66069991 TATTTTGCAGATAATGTAATAGG + Intergenic
1159527662 18:69613805-69613827 TATAATGAGGATATTTTTATAGG + Intronic
1164676089 19:30102641-30102663 TAAAATGCTTATAATTTTAGGGG - Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1167843472 19:52140610-52140632 TATAATGGTGATAAAGGCATAGG - Intergenic
1168431316 19:56283245-56283267 AATAATGATGATAATAGTATTGG - Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925043446 2:752068-752090 TTTAATTCTCATAATATTATGGG + Intergenic
926132355 2:10311749-10311771 GATAATGGTGATAATGGTTTTGG - Intronic
928970270 2:37021030-37021052 AGTAATGCTGATGATGTTATAGG + Intronic
930853203 2:55984119-55984141 TATAATTCTGAGAGTGTTACAGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
932393449 2:71418580-71418602 TAAAATGCTGATTATATTACAGG + Exonic
932505177 2:72222392-72222414 TATAATGATTATATTTTTATAGG + Intronic
932722041 2:74145606-74145628 TATTATGCCGATAGTTTTATAGG + Intronic
932938163 2:76130593-76130615 TATAAAGCTGATAAGAGTATAGG + Intergenic
933871355 2:86568429-86568451 TCTAATTCTGATACTGTTTTTGG - Intronic
934026766 2:88007388-88007410 AATAATACTGATTAGGTTATAGG - Intergenic
935386098 2:102501561-102501583 TATAATGGAGGTGATGTTATAGG + Intronic
935870223 2:107439949-107439971 TATGATCATGATAATGGTATCGG - Intergenic
936776449 2:115979787-115979809 AATGATGCTGATATTTTTATGGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
939044642 2:137236040-137236062 TATATTGCTGATAATCTCCTTGG - Intronic
939236941 2:139506784-139506806 AATAATGTTGATAATTTGATTGG - Intergenic
939915267 2:148033567-148033589 TATAATGCTCTTAATATTTTGGG - Intronic
940261812 2:151788576-151788598 TAGCTTGCTGATAATGTTGTGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
943668954 2:190640104-190640126 AGAAATGCTCATAATGTTATGGG - Intergenic
943776467 2:191772210-191772232 TATATAGCTGAAAATTTTATAGG + Intergenic
944748165 2:202679031-202679053 TATTATTATGATATTGTTATAGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945594474 2:211774653-211774675 TCTAATACTGATAATGCTAGAGG + Intronic
946007695 2:216539598-216539620 TAAAAAGCAGAAAATGTTATGGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1170432392 20:16288412-16288434 TGTACTGGTGATAAGGTTATTGG + Intronic
1170432418 20:16288649-16288671 TGTACTGATGATAAGGTTATTGG + Intronic
1170432426 20:16288728-16288750 TGTACTGATGATAAGGTTATTGG + Intronic
1170432434 20:16288807-16288829 TGTACTGGTGATAAGGTTATTGG + Intronic
1170652748 20:18257559-18257581 TATAATGCAGAAAATATAATTGG + Intergenic
1170684848 20:18560183-18560205 TATAATTTTATTAATGTTATGGG - Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1172347366 20:34213296-34213318 TATAATGCAAAGAAAGTTATTGG - Intronic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177957086 21:27611704-27611726 CATAGTGCTGATAATGGTAATGG - Intergenic
1178061607 21:28859112-28859134 AATAATGAAGATAATATTATAGG - Intergenic
1178544990 21:33485490-33485512 TATAATGGTAATAATATTTTGGG - Intergenic
1182056233 22:27357347-27357369 TATAAGGATGCTAATCTTATGGG - Intergenic
949339262 3:3010848-3010870 TAGAATGCTTATCATGTTAGTGG - Intronic
949837370 3:8283580-8283602 TATCAAGGTGAAAATGTTATAGG - Intergenic
949850556 3:8416272-8416294 TATATTGCTGACAATTTTGTTGG - Intergenic
950849197 3:16045877-16045899 AAAAATGCTGATAATGTATTTGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
951947248 3:28153463-28153485 TATATTGCTGGTAATAATATTGG + Intergenic
952050655 3:29380461-29380483 TGTAATGCTTATAATGTGCTTGG + Intronic
952594083 3:34993457-34993479 TACAATGAGGATAATGTTAGAGG + Intergenic
955095705 3:55795820-55795842 TATAAGGCAGGTACTGTTATTGG - Intronic
955618218 3:60832097-60832119 TATAATGCTCATTATGTGCTGGG + Intronic
955885559 3:63594741-63594763 GATAATGATGATAGTGTTAATGG - Intronic
956018106 3:64905645-64905667 TATAATGCTGAAACAGTTAAGGG + Intergenic
956553877 3:70495507-70495529 TTTAATCCTCATAATGCTATAGG + Intergenic
957828332 3:85480568-85480590 TATAATGCTTATAATGGGACAGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958269973 3:91487426-91487448 TATGATGATGATCCTGTTATGGG - Intergenic
958458348 3:94361678-94361700 TATAATCCTCATAATTTTAAGGG + Intergenic
958625450 3:96617371-96617393 TCTAATACTGATAATGCTAGAGG + Exonic
958713187 3:97743305-97743327 CATAATGCTGAAAACATTATAGG - Intronic
958715101 3:97771041-97771063 TATATTTCTGTGAATGTTATTGG + Intronic
958987567 3:100800097-100800119 AATAATGCTGAAAATGCTTTTGG - Intronic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959363141 3:105420795-105420817 TATAATGGAGATATTGCTATGGG + Intronic
959775072 3:110149625-110149647 TATAAAACTGATACTTTTATAGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963493659 3:146033122-146033144 TTTAGGGCTGATAATCTTATGGG - Intergenic
964093226 3:152900395-152900417 TATAATGCCAATATTGTTAATGG + Intergenic
964193093 3:154028943-154028965 TATTAGGCTAATAATGTTGTAGG + Intergenic
964778883 3:160313393-160313415 TATAATTTTAATAATGTTAGAGG - Intronic
965948064 3:174267021-174267043 TCTAATAATGATAATTTTATGGG + Intronic
966042712 3:175510956-175510978 TACTATGGTGATGATGTTATCGG + Intronic
966064874 3:175807635-175807657 TATATTGCTGATATATTTATTGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967382622 3:188876593-188876615 AATAGGGCTGATAATGTAATCGG + Exonic
969104359 4:4793818-4793840 GATAATGGTGATAATGTTTGAGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970373930 4:15437146-15437168 TATAATCCTGATGTTATTATAGG - Intronic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971774549 4:30945913-30945935 CATAATGTCCATAATGTTATAGG - Intronic
972367185 4:38387159-38387181 TATAATGCTTACTATGTGATAGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974189600 4:58488078-58488100 TATAATGCTGTTAACGGTAGAGG + Intergenic
974289024 4:59906929-59906951 AATCATGTTGATAATGTTACTGG - Intergenic
974499559 4:62683297-62683319 TACAATTCAGATAATGTTATTGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975080616 4:70275507-70275529 GTTAGTGCTGATATTGTTATAGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977404823 4:96583572-96583594 TATAATCCTGATAAACTTTTTGG - Intergenic
978116876 4:105029824-105029846 TTTAATGCTAATATTGTTATGGG - Intergenic
979084902 4:116395845-116395867 AATAATTCTGATAATATTTTAGG - Intergenic
979997213 4:127445185-127445207 TATAAGGGAGACAATGTTATTGG + Intergenic
980203081 4:129681080-129681102 TATAATGCTAACTATGTCATAGG - Intergenic
980389611 4:132125821-132125843 TATCATGCAGGTTATGTTATAGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982447112 4:155505345-155505367 GATAATGCTGCTGCTGTTATTGG - Intergenic
982512160 4:156296755-156296777 TATAACATTGATAAAGTTATGGG - Intergenic
982938913 4:161523439-161523461 TTTAATGCTTATAATTTAATAGG + Intronic
983069556 4:163253111-163253133 TAAAATTCTTAAAATGTTATTGG - Intergenic
983182363 4:164663158-164663180 TATAATGATGAGAAATTTATTGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983695701 4:170527267-170527289 GATAATGCTGATAGTTTTATGGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
985020980 4:185690083-185690105 TATAATGCTTATAACACTATGGG + Intronic
985138565 4:186814382-186814404 TTTAATCCTGACAATGTTACTGG - Intergenic
985274080 4:188220639-188220661 TACATTGCTGCTAATGTTACAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986204347 5:5610001-5610023 TATATTGCTGTTTATGTTGTAGG + Intergenic
986909629 5:12538738-12538760 AATAATGTTGATAATTTGATAGG - Intergenic
987590532 5:19920110-19920132 TATAGTACTGAAAATATTATGGG - Intronic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988095877 5:26609463-26609485 GATGATGATGATAATGATATCGG + Intergenic
988146319 5:27313310-27313332 TAGCATGCTCATAATTTTATAGG - Intergenic
989088103 5:37697330-37697352 TATTATGCTTATAAAGTTATTGG - Intronic
989319087 5:40114150-40114172 TAAAATGCTGATACTGTGTTAGG + Intergenic
989346425 5:40435470-40435492 TATAATGATGACAATTATATGGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990712457 5:58600376-58600398 AATAATGGTGATATTTTTATGGG + Intronic
990803380 5:59631130-59631152 CATAATGCAAATAAAGTTATTGG - Intronic
990917756 5:60929948-60929970 TAAAAAACTGATAATTTTATAGG - Intronic
991934489 5:71788532-71788554 TTTAAGGGTGATAATGTCATAGG + Intergenic
992836851 5:80650183-80650205 TCTAATACTGATAATGCTAGAGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993389529 5:87301444-87301466 TAAGATGCTGATAATATTCTGGG - Intronic
993389596 5:87302702-87302724 TAGGATGCTGATAATATTCTGGG - Intronic
993507656 5:88730982-88731004 TAAGATGAAGATAATGTTATGGG - Intronic
993937614 5:94023281-94023303 TATGGTGCTGATAGTGATATGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994886290 5:105566014-105566036 CATAATTCTAAAAATGTTATAGG - Intergenic
995406046 5:111797543-111797565 TATAAAGCTGATAATATTGCTGG + Intronic
996860920 5:128064600-128064622 TATATTGTTGATAATGGTGTTGG + Intergenic
998706634 5:144769648-144769670 CATAATGCTGATAAAGTAGTTGG + Intergenic
999045988 5:148470034-148470056 TATAATGATGATAATGGTGATGG + Intronic
999823837 5:155255354-155255376 TATAATTCAGATAATATAATAGG + Intergenic
1002630934 5:180577722-180577744 TATAGTGCAGATAATGTGCTGGG - Exonic
1003899945 6:10645194-10645216 TATTATGCTCAAAATGTTCTTGG + Intergenic
1003993473 6:11512904-11512926 AATAATGCAGACAATGTTTTTGG + Intergenic
1005176364 6:23049466-23049488 TATATTGATGAAAATTTTATAGG + Intergenic
1005930904 6:30483032-30483054 TATAATCTTGATAATGTGTTTGG - Intergenic
1008145001 6:47880445-47880467 TATAATGTTGATAATCTCCTTGG + Intronic
1008838452 6:55867415-55867437 TATAATGTTTATAGTGTTGTGGG - Intronic
1009567589 6:65330659-65330681 AATAATGTTGATGATGTTAACGG - Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009638849 6:66303880-66303902 AAAATTGCTGATAATATTATAGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010298436 6:74229112-74229134 TATAATAATGTTCATGTTATTGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011873673 6:91928686-91928708 TATATTACTGATAGTGCTATTGG - Intergenic
1012390535 6:98733137-98733159 TATAATGCTTAAAATGCTAATGG + Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012789424 6:103674858-103674880 TATAAGGCAGATAGTGGTATTGG + Intergenic
1013268636 6:108524971-108524993 TGGAATGCTGAGAATGTAATAGG - Exonic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014412415 6:121142504-121142526 TAGAATGCTGATTATTTTATAGG + Intronic
1014792224 6:125686156-125686178 TATTATGCTAAAAATTTTATGGG - Intergenic
1015182504 6:130375835-130375857 TGTAATGATGATATTGGTATTGG + Intronic
1015828290 6:137339491-137339513 TAAAATCCTGATGATGTTAAAGG - Intergenic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1018241773 6:161783083-161783105 TGTAATACTGATACTGTTGTGGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1022786506 7:33643193-33643215 TATGAGGGTGATAATGGTATTGG - Intergenic
1023417290 7:39945440-39945462 TATAATGCTGATGACGATATAGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024456692 7:49616178-49616200 TATAATGGAGATAAATTTATTGG + Intergenic
1024470251 7:49762260-49762282 TATTATGCTGATACTGCTTTTGG + Intergenic
1025069563 7:55887105-55887127 TATAATGATGATGATGTTATTGG - Intergenic
1028102499 7:86838568-86838590 TACAATGCTTATTATGTAATGGG - Intronic
1028366691 7:90040403-90040425 TTTAATGCTGAAAATTTTATTGG + Intergenic
1029102384 7:98142782-98142804 TAAAATGCTGATGATGTTCCAGG - Intronic
1029200055 7:98833413-98833435 AATAATGATGATAATGATGTTGG - Intergenic
1029794776 7:102882394-102882416 TAGAATTCTTATAATCTTATAGG - Intronic
1030651183 7:112117690-112117712 TGTATTGCTGATAAAGTTTTTGG + Intronic
1031094077 7:117398286-117398308 TATAATTGTGATAGTGTTATGGG - Intronic
1031202517 7:118706260-118706282 TAAAATGCTGTCAGTGTTATTGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1033875252 7:145809776-145809798 ATGAATGCTGATAATATTATTGG + Intergenic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035237042 7:157504317-157504339 TTTAATGCTGTTAATGTCACTGG + Intergenic
1037301451 8:17455846-17455868 TATAATGTTTATAACATTATAGG + Intergenic
1037631202 8:20658035-20658057 AATCATGCTGATCATCTTATGGG + Intergenic
1038570421 8:28657460-28657482 CATAATGCTGAAGATGTCATTGG - Intronic
1038875878 8:31548478-31548500 TATGATGATGATAATGGTAATGG + Intergenic
1040925138 8:52673033-52673055 TACATTGCTGTTAAAGTTATAGG - Intronic
1040994002 8:53382684-53382706 TAAAATGCTTACAATGTTTTTGG + Intergenic
1041180429 8:55241934-55241956 AATAATAATAATAATGTTATGGG + Intronic
1041340731 8:56843133-56843155 TCTAATGATGATAATGATACTGG - Intergenic
1042192688 8:66203556-66203578 TATAATACTGATAAACATATAGG - Intergenic
1042447088 8:68897667-68897689 TATAATGCTATTTAAGTTATTGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044495567 8:92876370-92876392 TATAATGGTCTTAATATTATAGG - Intergenic
1045084268 8:98664054-98664076 TATACTGCTGATAACTTTTTGGG - Intronic
1046798411 8:118397622-118397644 TATAATACTGATGATGTGAAAGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1051046593 9:12882832-12882854 TATACTGCAGAGAATGTCATAGG - Intergenic
1051977091 9:22963726-22963748 TATAATGCTCATGATCTTAAAGG + Intergenic
1052197510 9:25735341-25735363 TATACTGCTTATAAGCTTATAGG - Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052256257 9:26460360-26460382 TATAATGCAGATAATATAGTGGG - Intergenic
1052364435 9:27596155-27596177 AAAAATACTGATACTGTTATGGG - Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055277181 9:74631344-74631366 TAATATGCTGGTAAAGTTATTGG + Intronic
1057507952 9:95651775-95651797 TAAATTGCTAATTATGTTATTGG + Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1060973239 9:127750849-127750871 TATTATGCTGTTATTGTTACTGG - Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186642964 X:11475461-11475483 TATAATGCTGGTAATTGGATTGG - Intronic
1187639228 X:21269602-21269624 AATAATGCTGATATTTTGATAGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188947446 X:36324182-36324204 TACAAAGCTAATAAAGTTATAGG + Intronic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189915110 X:45848971-45848993 TTTTAAGCTGATATTGTTATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192631149 X:72778633-72778655 TATAATGATGATCATTTTACAGG + Intronic
1192650560 X:72942168-72942190 TATAATGATGATCATTTTACAGG - Intronic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1195470585 X:105225464-105225486 AATAGTGGTGATAATGTTAAAGG + Intronic
1195509524 X:105698173-105698195 AATAATGATGATAATGATAGTGG - Intronic
1196984391 X:121252710-121252732 TATAATGCAGAAAATGTATTCGG - Intergenic
1197037400 X:121891071-121891093 TATAATGATGATGAAATTATTGG - Intergenic
1197660449 X:129165425-129165447 GATAATGATGATAAAGTTATAGG + Intergenic
1197970814 X:132113021-132113043 TATTAGGCTGATAATCTTACTGG - Intronic
1198919172 X:141706835-141706857 TATAGTGCTTATTATGTGATAGG - Intergenic
1199245815 X:145602477-145602499 TATAATGCTAATCATACTATTGG + Intergenic
1199314269 X:146358765-146358787 TAAAATGCTAATAAAGTCATTGG - Intergenic
1199518585 X:148707922-148707944 TTTAATGGTGGTAATGTTAGAGG + Intronic
1199849928 X:151718365-151718387 TATAATGTTGCAAATGATATTGG + Intronic
1200895421 Y:8370859-8370881 TGTAATACTGATAATGCTAGAGG - Intergenic
1202103877 Y:21340856-21340878 TATAATTCTGAGAATGTATTAGG + Intergenic