ID: 959126059

View in Genome Browser
Species Human (GRCh38)
Location 3:102291325-102291347
Sequence AAGGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 4, 1: 34, 2: 84, 3: 158, 4: 457}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959126059_959126066 27 Left 959126059 3:102291325-102291347 CCCACAATCACTGTGCTCTCCTT 0: 4
1: 34
2: 84
3: 158
4: 457
Right 959126066 3:102291375-102291397 TAATATGTGGCCACTGCCACAGG 0: 1
1: 0
2: 1
3: 9
4: 125
959126059_959126065 14 Left 959126059 3:102291325-102291347 CCCACAATCACTGTGCTCTCCTT 0: 4
1: 34
2: 84
3: 158
4: 457
Right 959126065 3:102291362-102291384 GATTCTCTCTCAGTAATATGTGG 0: 1
1: 0
2: 0
3: 26
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959126059 Original CRISPR AAGGAGAGCACAGTGATTGT GGG (reversed) Intronic