ID: 959128875

View in Genome Browser
Species Human (GRCh38)
Location 3:102326359-102326381
Sequence GGCTGGCTTGCTATAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959128870_959128875 12 Left 959128870 3:102326324-102326346 CCTTGTGGACCAGCCATAATAGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 113
959128872_959128875 -1 Left 959128872 3:102326337-102326359 CCATAATAGAAATTTGTGAAATG 0: 1
1: 0
2: 4
3: 64
4: 519
Right 959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 113
959128871_959128875 3 Left 959128871 3:102326333-102326355 CCAGCCATAATAGAAATTTGTGA 0: 1
1: 0
2: 2
3: 8
4: 168
Right 959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959128875 Original CRISPR GGCTGGCTTGCTATAGAGAG TGG Intronic
902080788 1:13819188-13819210 GGCTGGCTTCCTAAACAGACTGG + Intronic
904575683 1:31503792-31503814 GGCTGGCTTCCTAGAGGCAGCGG - Intergenic
905317637 1:37093742-37093764 GGCTGGGTTGCTCCACAGAGAGG - Intergenic
905351067 1:37346786-37346808 GGATGGCCTTCTATAGAGTGTGG - Intergenic
905471169 1:38193179-38193201 GGCAGGCTTCCTAGAGAAAGTGG + Intergenic
907401006 1:54224808-54224830 GGCTGGCAAGATATGGAGAGAGG - Intronic
907506184 1:54920194-54920216 GGCTGGCTTACCAAAGGGAGAGG - Intergenic
910866918 1:91797286-91797308 GCCTGGCCAGCTACAGAGAGAGG - Exonic
912269834 1:108197999-108198021 GGCTGGGTTGCTATAAAGCCAGG + Intronic
912954464 1:114144805-114144827 TGCTGGCTTCCCAGAGAGAGTGG - Intronic
917644082 1:177012795-177012817 GGCTGGCTCGCTGTAGTGACTGG - Intronic
921560737 1:216655242-216655264 GGCTGGTTTGGATTAGAGAGAGG + Intronic
922814549 1:228439243-228439265 GGGTGGCTTCCTTTGGAGAGAGG - Intergenic
1063469944 10:6276206-6276228 GGGTGGCATGCTATAGAAATAGG + Intergenic
1067742732 10:48908170-48908192 GGCAGGCTTGCTACAGTGACTGG - Intronic
1068870254 10:61935870-61935892 GTCTAGCTTTATATAGAGAGCGG + Intronic
1075901926 10:126050022-126050044 GGCTGGCTGGCTGCAGAGAAGGG + Intronic
1077026866 11:443771-443793 GGCTTCCTTGCCATAGAGTGTGG - Intergenic
1083631636 11:64098332-64098354 GGAGGGCTTGGTATAGTGAGAGG - Intronic
1084697400 11:70763818-70763840 TGCAGGCTTACTAGAGAGAGAGG + Intronic
1087365306 11:97211313-97211335 AGCTCTCTTGCTACAGAGAGGGG + Intergenic
1090750517 11:129743049-129743071 GGGTGGCTGGATAAAGAGAGAGG - Intergenic
1092926942 12:13280044-13280066 GGCTGGCAGGAAATAGAGAGTGG + Intergenic
1095864626 12:46957935-46957957 GGCTGGCTGGCCATCCAGAGAGG - Intergenic
1096975770 12:55698567-55698589 GTCTGGCCAGCTATGGAGAGAGG + Exonic
1099788747 12:87302545-87302567 GTCTGGCATGCCAAAGAGAGAGG + Intergenic
1100173547 12:92004569-92004591 TGCTTGCTTGCTTTAGAGACAGG + Intronic
1100252933 12:92848894-92848916 GGCTAACTTTCTATAGAGACAGG + Intronic
1102523981 12:113497762-113497784 TGCGGGCTTGTTATAGAGATGGG + Intergenic
1103970031 12:124664757-124664779 AACTGGCTTGATATAGAGACAGG - Intergenic
1109192785 13:59345478-59345500 GGCTGGCATTCTATGGAGAAGGG + Intergenic
1110551652 13:76817384-76817406 TTCTGGCTTGCTTTAGAAAGGGG + Intergenic
1112354419 13:98661916-98661938 AGCTGGCTTGCTGGAGTGAGAGG + Intergenic
1114386676 14:22262297-22262319 GCCTGGCTTTCAACAGAGAGGGG - Intergenic
1117217287 14:53564662-53564684 AGCTGTCTTGCTGAAGAGAGAGG - Intergenic
1117322676 14:54639038-54639060 GGTTGGCATGCTAGAGAGAAAGG + Intronic
1119134396 14:72203660-72203682 GGCTGGCTTCCCCCAGAGAGGGG + Intronic
1120757906 14:88261372-88261394 GCCTAGCATGCTATAGAGAATGG - Intronic
1129073588 15:72972553-72972575 GGCTAGCCTGCTGTAGAGAGAGG + Intergenic
1130038831 15:80386650-80386672 AGCTCTCTTGCTACAGAGAGGGG + Intronic
1135138286 16:19900880-19900902 GGCTGGGTTCCAAGAGAGAGTGG + Intergenic
1135502904 16:23012652-23012674 TGCTGGCTTGGTATATAGAGGGG + Intergenic
1135876009 16:26200571-26200593 GGCTGTCTTGCTTTATAGATGGG + Intergenic
1139111914 16:63902635-63902657 AGCTGGATAGCTATAGAGAAAGG - Intergenic
1141364723 16:83432107-83432129 GGCAGGGTTGCTGTTGAGAGTGG + Intronic
1144957587 17:19027005-19027027 GGCAGGCTGGCTATAGAGCTGGG - Intronic
1144977569 17:19147511-19147533 GGCAGGCTGGCTATAGAGCTGGG + Intronic
1147484036 17:40795419-40795441 GGCTGGCTTGTCAAAGAGGGAGG + Intronic
1147777451 17:42912577-42912599 GGTTGGCTTGGGATAGAGAAAGG - Exonic
1148644246 17:49210338-49210360 GGCTGGCCTGCTATAGGGGGCGG - Exonic
1151560731 17:74868156-74868178 GGCTGGCCTGGGATGGAGAGAGG - Intronic
1152841768 17:82573878-82573900 GGCTTTCTTGCTAAAGAGGGTGG + Intronic
1157377498 18:47179787-47179809 GGCTGCCTTCCCATAGAGATTGG - Intergenic
927184590 2:20473226-20473248 GGCTGCCTTCCTGTAGGGAGAGG + Intergenic
932357177 2:71076516-71076538 GGCTGCCTTGCAACAGAGAGAGG + Intronic
932560521 2:72863395-72863417 GGCTGGCTTCTCATAGGGAGGGG + Intergenic
941278308 2:163518281-163518303 GTCTGGCTTTTTATAGAGATGGG - Intergenic
942612410 2:177755792-177755814 GACTGGCTTGCTCTACAAAGGGG - Intronic
943448790 2:188022053-188022075 AGGTAGCTTCCTATAGAGAGAGG + Intergenic
944081799 2:195796437-195796459 GGCTGGATTGCAGGAGAGAGAGG - Intronic
1169330734 20:4714139-4714161 GACTGGCTTGCCAAAGAGAGTGG - Intergenic
1170350134 20:15430542-15430564 GGCTTTCTAGCTATAGAAAGTGG - Intronic
1170793214 20:19525116-19525138 GGCTGGCTTGGGAGAGAAAGGGG - Intronic
1170835409 20:19879823-19879845 GGTTTGTATGCTATAGAGAGAGG + Intergenic
1172107067 20:32523143-32523165 GGCTGGCGTGCCACAGGGAGGGG + Intronic
1174420163 20:50394220-50394242 GGCTGGAGTGCTGGAGAGAGTGG + Intergenic
1181058008 22:20268869-20268891 GGCTGGCTTGGTAGAGTGGGGGG - Intronic
1181489501 22:23252737-23252759 GGTTGGGTTGCTATAGAAAGGGG - Intronic
1183922031 22:41177344-41177366 GGGTGGCATGCTATTGGGAGGGG - Exonic
949266385 3:2161424-2161446 GGGTGGCTTGTAATAGAGTGGGG + Intronic
949418276 3:3836873-3836895 GGTTGGCCTGCTATTAAGAGGGG + Intronic
950874647 3:16260259-16260281 GACTGGCTTGGTATAGAAACTGG + Exonic
952201510 3:31133552-31133574 GGCTGGCTTCCTATAGATTATGG - Intergenic
955150377 3:56361126-56361148 GTCTGACGTGCTATGGAGAGTGG + Intronic
957175617 3:76804176-76804198 GGTTTGCTGGCTAAAGAGAGAGG + Intronic
958785706 3:98594074-98594096 GGATGGTTTTCTAAAGAGAGTGG + Intergenic
959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG + Intronic
960416632 3:117392985-117393007 GGTTGGCTTGCGACAGAGATTGG - Intergenic
961033771 3:123628421-123628443 GGGTGGCGTGCTAGAGAGAAGGG - Intronic
961211714 3:125130805-125130827 GGCTGGCTTTCCTAAGAGAGAGG - Intronic
966344367 3:178962054-178962076 GGCTGACTTGGTTTGGAGAGGGG - Intergenic
969734328 4:8976981-8977003 GGCTGACTTGCTACAGAAAACGG + Intergenic
971372803 4:26031935-26031957 CTCTGGCCTGCTACAGAGAGGGG - Intergenic
973844686 4:54899525-54899547 GTCTGGTTGGCTATGGAGAGGGG - Intergenic
975856738 4:78632679-78632701 GGCAGTCTTCCTATATAGAGAGG + Intergenic
985217480 4:187669613-187669635 GGCTGTCTTGAGAGAGAGAGAGG + Intergenic
989973944 5:50559433-50559455 GGTTGCCTTGGGATAGAGAGTGG - Intergenic
998268204 5:140682550-140682572 GGCTGGTTTGTTTTAGAGACAGG + Intronic
1001030583 5:168259672-168259694 GGCTGGCTCACTATGGAAAGGGG - Intronic
1003196806 6:3921798-3921820 GGCTGCCTGGCTGTAGAGCGGGG - Intergenic
1007247833 6:40475143-40475165 AGCTGGCTTGCTATGGAGCAAGG - Intronic
1016464743 6:144314347-144314369 GGCTGGCCAGCTCTAGGGAGTGG - Intronic
1017528303 6:155262395-155262417 GGCTGGCGAGGTGTAGAGAGTGG - Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1022152075 7:27618317-27618339 TGCTGCCATGCTATACAGAGTGG - Intronic
1025250812 7:57350272-57350294 GGCTGGAGTGCTGGAGAGAGTGG - Intergenic
1026849864 7:73717903-73717925 GGCTTGCCTGCTAGAGGGAGGGG - Intronic
1026954024 7:74365544-74365566 GGCTGGCTGGCTCTGGATAGGGG + Intronic
1028614270 7:92747635-92747657 GACTGGCTTCCTAAAGAAAGTGG - Intronic
1032150421 7:129424552-129424574 GGATATTTTGCTATAGAGAGTGG + Intronic
1037922139 8:22814918-22814940 GTCTTCCTTGTTATAGAGAGGGG + Intronic
1039143143 8:34416030-34416052 AGCTCTCTTGCTACAGAGAGGGG + Intergenic
1039580518 8:38662411-38662433 TGCTTGCCTGCTATAGAGATTGG + Intergenic
1042522471 8:69728286-69728308 AAATGGCTTCCTATAGAGAGAGG + Intronic
1045916416 8:107476990-107477012 AGCTGGGGTGCTATGGAGAGTGG - Intronic
1049431546 8:142567526-142567548 GGCTGGCCTGCCAGAGGGAGAGG + Intergenic
1050696076 9:8280812-8280834 GGCTTGCCTGCTATGGAGTGTGG - Intergenic
1051758892 9:20438377-20438399 GGCTGGGGTGTTATAGAGTGGGG + Intronic
1051783046 9:20711621-20711643 GGCTGACTGGATTTAGAGAGTGG + Intronic
1053019409 9:34684663-34684685 GGCTGGCTTCCTCTTGGGAGAGG + Intergenic
1054814527 9:69462358-69462380 GTCTGGCTTTCTCTAGAAAGGGG + Intronic
1056024304 9:82476953-82476975 TACTGGCTTGCTATAGTGATTGG - Intergenic
1060600922 9:124876801-124876823 GCCTGGCTTGCCAGAGACAGGGG - Intronic
1062137875 9:134939186-134939208 GGCTGTCCTGTTACAGAGAGGGG + Intergenic
1187284089 X:17886286-17886308 GGGTTGCTTGCTATGGAAAGGGG - Intergenic
1188397452 X:29702673-29702695 GTCTGGCTGGCTATAGAGCATGG + Intronic
1189981403 X:46514439-46514461 GGCTGGGTTACTTTAGAAAGAGG + Intronic
1190389623 X:49919294-49919316 GGCTGGATTTCTGTAGAGAGTGG + Intergenic
1194988671 X:100520636-100520658 GCCTGGATTACTATAGAAAGTGG - Intergenic
1198674164 X:139114103-139114125 AGCTGGCTTGCTAAAGGGAATGG + Intronic
1198711541 X:139509414-139509436 GTCTGGCTTAATTTAGAGAGAGG + Intergenic