ID: 959128875

View in Genome Browser
Species Human (GRCh38)
Location 3:102326359-102326381
Sequence GGCTGGCTTGCTATAGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959128871_959128875 3 Left 959128871 3:102326333-102326355 CCAGCCATAATAGAAATTTGTGA 0: 1
1: 0
2: 2
3: 8
4: 168
Right 959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 113
959128870_959128875 12 Left 959128870 3:102326324-102326346 CCTTGTGGACCAGCCATAATAGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 113
959128872_959128875 -1 Left 959128872 3:102326337-102326359 CCATAATAGAAATTTGTGAAATG 0: 1
1: 0
2: 4
3: 64
4: 519
Right 959128875 3:102326359-102326381 GGCTGGCTTGCTATAGAGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959128875 Original CRISPR GGCTGGCTTGCTATAGAGAG TGG Intronic