ID: 959129154

View in Genome Browser
Species Human (GRCh38)
Location 3:102331357-102331379
Sequence TAGTGGGGAGGGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1976
Summary {0: 1, 1: 2, 2: 15, 3: 215, 4: 1743}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959129154 Original CRISPR TAGTGGGGAGGGCAGGAGGA AGG (reversed) Intronic
900010095 1:98851-98873 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900026206 1:275435-275457 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900035990 1:409288-409310 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900057614 1:645039-645061 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
900095190 1:937386-937408 TGGGGGGGGGGGCAGGTGGAAGG - Intronic
900238806 1:1605101-1605123 GCGCTGGGAGGGCAGGAGGATGG - Intergenic
900295817 1:1948965-1948987 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
900391553 1:2436102-2436124 AAGGGAGGAGGGGAGGAGGAAGG - Intronic
900482180 1:2904741-2904763 TGGGAGGGAGGGAAGGAGGATGG - Intergenic
900499388 1:2993366-2993388 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
900634020 1:3652935-3652957 GAGAGGGGACAGCAGGAGGAGGG - Intronic
900658268 1:3770791-3770813 TCTGGGGGAGGGGAGGAGGAAGG + Intronic
901015281 1:6225825-6225847 GCGTGGGGAGGGCAGGAGACTGG - Intronic
901018486 1:6244631-6244653 TATAGGGGAGGGCTGGAGGGAGG + Intronic
901076350 1:6557241-6557263 GATTGGGTAGAGCAGGAGGAGGG + Intronic
901167230 1:7229457-7229479 AAGGAAGGAGGGCAGGAGGAGGG + Intronic
901167281 1:7229584-7229606 AGGAGGGGAGGGCAGGAGGAGGG + Intronic
901420331 1:9146363-9146385 GTGTGGGGAGGGTAGGGGGAAGG - Intergenic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901790218 1:11650021-11650043 TGGTGGGGACGGCTGGAGGGTGG - Exonic
902039731 1:13483926-13483948 GAGTGGGGAGGGGAGGAGCGGGG + Intronic
902086818 1:13869016-13869038 TCGTGGGGACAGCGGGAGGAGGG + Intergenic
902117096 1:14130242-14130264 GTGTGGGGAGGGCAGGTGGCTGG + Intergenic
902392750 1:16115827-16115849 CAGTGGCGCGGGCAGGAGGCAGG + Intergenic
902528264 1:17073610-17073632 GAGTGGGGAGGGAGAGAGGAGGG + Intronic
902769098 1:18635292-18635314 CAGTGTGGAGGGCTGGAGGTGGG + Intronic
902986984 1:20160900-20160922 TAAAGGGGAGGGCAAGAGGATGG + Intergenic
903019732 1:20385684-20385706 CAGTGGGGAGGGGTGCAGGAAGG + Intergenic
903377412 1:22875612-22875634 AAGTGAGGAAGGAAGGAGGAAGG - Intronic
903664630 1:24998788-24998810 TAGAGGGCTGGGCAGGGGGAAGG - Intergenic
904087158 1:27917029-27917051 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
904260597 1:29285420-29285442 TAGTAGGGGCGGCAGGGGGAGGG - Intronic
904322611 1:29707311-29707333 GAGTGGGGAGGGAAGGAGGGAGG + Intergenic
904322737 1:29707604-29707626 GAGAGGGGAGGGGAGGAGGGAGG + Intergenic
904328318 1:29741922-29741944 GGGTGGGGTGGGGAGGAGGAGGG - Intergenic
904376626 1:30086025-30086047 GAATGGGGAGGGAAGGAGGGAGG - Intergenic
904441400 1:30534356-30534378 TAGGGGGGTGGGGAGGAGAATGG - Intergenic
904453511 1:30632262-30632284 CTGTGGGGAGGGCAGGGCGAGGG + Intergenic
904491126 1:30859789-30859811 TGGTGGTGAGGGCAGGAGGGTGG - Intergenic
904538745 1:31218704-31218726 AAGTGGGGACGTGAGGAGGAGGG - Intronic
904594848 1:31637140-31637162 TTGTGGGGAGGGCAGGAAGCAGG + Intronic
904614858 1:31744164-31744186 AGGTGGGGTGGGGAGGAGGATGG + Intronic
904622145 1:31782097-31782119 TGGGGGGCAGGGCAGGAGGGAGG - Intergenic
904767151 1:32858948-32858970 TAGTGGGGTGGGGAGGGGGGCGG + Intergenic
905228108 1:36493025-36493047 CACTGGGGTGGGCAGGTGGAAGG + Intergenic
905252468 1:36658528-36658550 TGCTGGGGAGGGCAGGGAGAGGG + Intergenic
905303112 1:36999025-36999047 GGGTGGGGAGGGAAGGAGCAGGG + Intronic
905707698 1:40074411-40074433 AAGCGGGGGGGACAGGAGGAGGG - Intronic
905852781 1:41286546-41286568 CAGTGGGGTGGGGAGGAGAAAGG + Intergenic
905876011 1:41432516-41432538 TACAGGGCAGGCCAGGAGGAGGG + Intergenic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
906114197 1:43345187-43345209 TAGAGGGGAGGGGAAAAGGAGGG + Intronic
906429321 1:45742217-45742239 GAGAGTGGAGGGTAGGAGGAGGG + Intronic
906454583 1:45982769-45982791 TTGTGGGGATGGCAGGGGGAGGG - Intronic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906906813 1:49903351-49903373 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907591341 1:55675195-55675217 AAGTGGGGAGGGTGGGAGCAGGG - Intergenic
907722159 1:56982255-56982277 TGGTGGGGAGGGCAGCAGTGGGG - Intergenic
907755978 1:57311210-57311232 TAGTGGGCTAGGCAGGATGATGG + Intronic
907793220 1:57688914-57688936 GAGTGGGGAGGAAAGGAGGAAGG + Intronic
908021666 1:59904678-59904700 TTGTGGGGAGGGGAGCAGGAAGG - Intronic
908224682 1:62044276-62044298 TAGTGGGAGGGGCTGGTGGATGG - Intronic
908262453 1:62349526-62349548 AAGTGGGGAGGGGAAGGGGAAGG + Intergenic
908262473 1:62349567-62349589 AAGTGGGGAGGGGAGGGGGAAGG + Intergenic
908429476 1:64041921-64041943 TACTGGGGAGTGCAAGAGGAAGG + Intronic
908525641 1:64985100-64985122 TAGTGGAAAGGGCAGTAAGAAGG - Intergenic
908548996 1:65190448-65190470 TTGGGGGGGGGGCGGGAGGAGGG + Intronic
908550825 1:65207203-65207225 TAGGGAGGAAGGGAGGAGGAAGG - Intronic
909174519 1:72339171-72339193 CACTGGGGAGGGCAGGAGGATGG + Intergenic
909193695 1:72588400-72588422 AAGTGAGGAAGGCAGGAGGAAGG + Intergenic
909334160 1:74451241-74451263 TGTTGGGGAAGGCAGGGGGAGGG + Intronic
909371506 1:74888080-74888102 AAGGTGGGAGGGTAGGAGGAGGG + Intergenic
909487157 1:76186991-76187013 AAGTGGGAAGGGTGGGAGGAAGG - Intronic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
910575488 1:88758521-88758543 GAGTGTGGAGGGTGGGAGGAGGG - Intronic
910632998 1:89375946-89375968 TAGTGGAGAGGGGAACAGGAAGG - Intronic
910780114 1:90922729-90922751 AAGGGTGGAGGGTAGGAGGAGGG - Intronic
911245099 1:95508327-95508349 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
911398097 1:97337449-97337471 TGGTGGTCAGGGCAGAAGGATGG - Intronic
912168533 1:107069411-107069433 GAAGGAGGAGGGCAGGAGGAGGG + Intergenic
912188500 1:107309872-107309894 TATTTGGGAGGCCAGGAGTAAGG - Intronic
912269360 1:108193327-108193349 AAGGGGGGAGGGAGGGAGGAGGG - Intronic
912283608 1:108344457-108344479 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
912416884 1:109514866-109514888 TGGAGGTGGGGGCAGGAGGATGG - Intergenic
912449577 1:109760838-109760860 TGGTGGGGAGAGCAGGCAGAGGG - Intronic
912557250 1:110525142-110525164 CAGTGGGGAGGTCAGCAGGCTGG + Intergenic
913168238 1:116209177-116209199 TAATGGGGAGGGAAAGAAGAGGG - Intergenic
913169838 1:116222019-116222041 AAGTGAGGAGGGAAGGAGGAGGG + Intergenic
913212147 1:116590568-116590590 TTGTGTGGAGGGCAGGGGCAGGG + Intronic
913305423 1:117425162-117425184 AAGGGGGGAGGGAAGGGGGAAGG + Intronic
913710203 1:121475026-121475048 GAGTGGGGAAGGGATGAGGAAGG - Intergenic
913713341 1:121509675-121509697 GAGTGTGGAGGGTGGGAGGAAGG + Intergenic
913969442 1:143403402-143403424 TAGAGGGGAGGGGATGGGGAGGG - Intergenic
914200555 1:145480929-145480951 TAGGGGAGAGGGCAGGGGGCAGG - Intergenic
914320799 1:146557598-146557620 TGGGGGAGAGGGCAGGAGGAGGG + Intergenic
914479669 1:148054056-148054078 TAGGGGAGAGGGCAGGGGGCAGG - Intergenic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
915004423 1:152623298-152623320 CAGGGGAGAGGGCCGGAGGAAGG - Intergenic
915063365 1:153204903-153204925 GGCTGGGGAGGGCAGGATGAAGG - Exonic
915119203 1:153617894-153617916 CAGTGGGGAAGCCAGAAGGAGGG - Intergenic
915271400 1:154756184-154756206 GGATGGGGAGGGGAGGAGGAGGG + Intronic
915303821 1:154966551-154966573 ATGTGTGGTGGGCAGGAGGAGGG + Intronic
915426758 1:155833733-155833755 GAGAGGGGAGGAGAGGAGGAGGG + Intronic
915581686 1:156816605-156816627 CAGGAGGGAGGGCAGGGGGATGG + Intronic
915736993 1:158091332-158091354 TGGTGGAGAGGGAAGGAAGAAGG - Intronic
916166642 1:161971686-161971708 TTGGGGGGAGGGCAGGTGTAGGG - Intergenic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916429741 1:164715996-164716018 TAGTGGGGAGGTGGTGAGGAGGG + Intronic
916452096 1:164930527-164930549 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
916646126 1:166786777-166786799 GAGCGGGGAGGGTGGGAGGAGGG - Intergenic
917079726 1:171245132-171245154 TAGGGGAAAGGGCAGGAGGGAGG + Intergenic
917333174 1:173903250-173903272 AAGGGGGGAGGGCAGGAGGGTGG + Exonic
917343862 1:174008443-174008465 AAGAGGGGAAGGGAGGAGGAGGG + Intronic
917679569 1:177352212-177352234 TACTGGGGAGGGCAGGAGGCAGG + Intergenic
917854198 1:179088108-179088130 TAGTCAGGAGGGCTGGGGGAGGG + Intronic
918085729 1:181243704-181243726 GAGAGAGGAGGGAAGGAGGAAGG - Intergenic
918135695 1:181672234-181672256 GAGTGTGGAGGGTGGGAGGAGGG + Intronic
918346297 1:183610188-183610210 TGGAGGGGAGGGCAGGAGCAGGG + Intergenic
918356152 1:183707875-183707897 AGGTGGGGTGGGGAGGAGGAAGG + Intronic
918500626 1:185191251-185191273 TAGTAGGGAGGGAAGAAGCAGGG - Intronic
918539143 1:185608825-185608847 GAGAGGGGAGGGTGGGAGGAGGG + Intergenic
918668873 1:187187580-187187602 GAGGGGGGAAAGCAGGAGGAGGG + Intergenic
918720147 1:187842101-187842123 TAGAGGGGAGGGAAGGAGGAGGG - Intergenic
918786066 1:188765535-188765557 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
918928271 1:190816076-190816098 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
918952758 1:191160711-191160733 GGATGGGGAGGGGAGGAGGAGGG + Intergenic
919056959 1:192583075-192583097 GAGGGGGGAGCACAGGAGGAAGG + Intergenic
919194050 1:194260559-194260581 TTGTGGGGGGGGCGGGAGGGGGG + Intergenic
919227497 1:194725682-194725704 GAGGGTGGAGGGCAGAAGGAGGG - Intergenic
919686295 1:200486733-200486755 CTGTGGGGAGGGCCGGTGGAGGG - Intergenic
919728038 1:200896327-200896349 TTCTGGGGAGGGTGGGAGGATGG + Intronic
919862540 1:201750377-201750399 GGGTGGGGAGGGGAGGAAGAGGG + Intronic
919965091 1:202515142-202515164 GAGGGAGGAGGGTAGGAGGAGGG + Intronic
919995525 1:202745174-202745196 GAGGGTGGAGGGCAGGAGGAGGG + Intronic
920046587 1:203136646-203136668 GAGTGGGGATGGCAGGAGACTGG + Intronic
920558086 1:206919081-206919103 TTGTGCTGTGGGCAGGAGGAAGG - Intronic
920610921 1:207437150-207437172 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
921155222 1:212433481-212433503 TAGTGGGGAGTGGCGGGGGACGG + Intronic
921266152 1:213422180-213422202 TAGAGATGAGGGCTGGAGGAAGG - Intergenic
921298821 1:213729915-213729937 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
921326481 1:213989581-213989603 TAGTGAGGAGGGCGGGAAGAGGG + Intronic
921563405 1:216686203-216686225 TAGTGGGGAGACAGGGAGGAGGG + Intronic
921582061 1:216906533-216906555 TGGTAGGGAGGGAAGTAGGAGGG - Intronic
921887960 1:220325360-220325382 TAGTGGAGAGGGCAGGACTCAGG + Intergenic
922473240 1:225889201-225889223 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
922501260 1:226098620-226098642 AGATGGGGAGGGCAGGGGGAGGG - Intergenic
922574897 1:226654982-226655004 GAGAAGGGAGAGCAGGAGGAGGG + Intronic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
923714064 1:236410237-236410259 AAGGGGGGAGGGTGGGAGGAGGG - Intronic
924039668 1:239971929-239971951 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
924044193 1:240011152-240011174 CAGTCTGGAGGGGAGGAGGAGGG - Intergenic
924370145 1:243338990-243339012 AAGTGGGGTGGGCGGCAGGAGGG + Intronic
924370158 1:243339044-243339066 AAGTGGGGTGGGCGGCAGGAGGG + Intronic
924370171 1:243339098-243339120 AAGTGGGGTGGGCGGCAGGAGGG + Intronic
924383973 1:243486462-243486484 TACTGGGGTGGGAAGGAGGAAGG - Intronic
924388844 1:243528465-243528487 GAGGGTGGAGGGCAGGAGGAAGG - Intronic
924865413 1:247974267-247974289 TTGTGGGGGGGCCAAGAGGAGGG + Intronic
1062962112 10:1580260-1580282 GATGGTGGAGGGCAGGAGGAGGG - Intronic
1063157305 10:3391567-3391589 TAGAAGGGAGGAAAGGAGGAAGG + Intergenic
1063260986 10:4389237-4389259 TGGTGGGGAGGTGGGGAGGAGGG + Intergenic
1063572633 10:7230234-7230256 TAGAGAGAAGGGCAGGAGAAAGG - Intronic
1063685778 10:8235879-8235901 AAGTGGGGAGGGCAGGGCCAGGG + Intergenic
1063694545 10:8320584-8320606 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1063699982 10:8374982-8375004 GAGGGTGGAGGCCAGGAGGAAGG - Intergenic
1063711414 10:8482713-8482735 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1063768645 10:9172293-9172315 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1063920657 10:10928996-10929018 AATTGGGAAGGGAAGGAGGAAGG + Intergenic
1064503991 10:16009631-16009653 GGGTGGGGAGGGTGGGAGGACGG + Intergenic
1064652100 10:17519652-17519674 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1064795540 10:19007573-19007595 GAGTGGGGAGGGGAGGGGGGAGG - Intergenic
1065205831 10:23357007-23357029 TAGAGAGGAGGGGAGGAGAAAGG + Intergenic
1065232780 10:23615599-23615621 GAGTGGGGAGGGTGGAAGGAGGG - Intergenic
1065368362 10:24956281-24956303 GAGGGTGGAGGGCGGGAGGAGGG - Intergenic
1065862681 10:29885097-29885119 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1066174166 10:32886642-32886664 GAGGGGGGAGGGTGGGAGGAGGG + Intergenic
1066337102 10:34488981-34489003 TAGTGGGGCGGGCAAGCGGCGGG - Intronic
1066426589 10:35312854-35312876 TAGGAGGCAAGGCAGGAGGACGG - Intronic
1066671462 10:37844936-37844958 AAGGGGGGAGGGAAGGGGGAGGG - Intronic
1066681486 10:37939879-37939901 TATTTGGGAGGGCAAGAGCAGGG - Intergenic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1066975335 10:42363267-42363289 GGGAGGGGAGGGCAGGATGAAGG - Intergenic
1068467896 10:57418423-57418445 TGGGGTGGAGGGCAGGGGGAGGG + Intergenic
1068493902 10:57760002-57760024 GAGGATGGAGGGCAGGAGGAGGG + Intergenic
1069077044 10:64049149-64049171 TAGTGGGGAGAGGAAGAGGAAGG + Intergenic
1069195447 10:65545598-65545620 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1069309453 10:67016233-67016255 CAATGGGGAGGGGAAGAGGAAGG + Intronic
1069651429 10:70052810-70052832 TAGCGGGGGGAGGAGGAGGAGGG - Exonic
1069716874 10:70526738-70526760 TGCTGGGGAGGACAGGAAGATGG + Intronic
1069717634 10:70531173-70531195 TGGTGTGGGGTGCAGGAGGAAGG + Intronic
1069855080 10:71435754-71435776 AAGTGAGGAGGCCAGGAGGCTGG + Intronic
1069864198 10:71491332-71491354 TCCTGGGGTGTGCAGGAGGAGGG - Intronic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070156114 10:73836588-73836610 GAGTGGGGAGGGAACGGGGAGGG + Intronic
1070289190 10:75103803-75103825 AAGTGGGGAGGGGAGGAGAGAGG - Intronic
1070565408 10:77600337-77600359 TAGTGGGGAGAGCAGGAGGTGGG + Intronic
1070691624 10:78531417-78531439 AAGTGGGGAGGGCAAAATGAAGG + Intergenic
1070719022 10:78743650-78743672 TACTGGGGAGTGCAGGAGGTGGG - Intergenic
1070765240 10:79052621-79052643 TGGCGGGGAGGGCAGGGGCAGGG + Intergenic
1071167774 10:82826757-82826779 GAGGTGGGAGGGTAGGAGGAGGG + Intronic
1071328255 10:84537554-84537576 TAGTGGGGAGGGCCGGCGGGAGG + Intergenic
1071383290 10:85093383-85093405 TGGTGGGGAGGGGAGGAGTAAGG - Intergenic
1071494075 10:86155768-86155790 GAATAGGGAGGGCAGGAGGGAGG + Intronic
1071524573 10:86350942-86350964 GACTGGGGAGGGCAGGGGGAGGG - Intronic
1071753534 10:88509475-88509497 GAGAGGGGAGGAGAGGAGGAGGG + Intronic
1072327176 10:94310268-94310290 TAGTGGTGAGGGCAGGAGAAGGG - Intronic
1072406580 10:95159773-95159795 TGGGGTGGGGGGCAGGAGGAGGG + Intergenic
1072806523 10:98427087-98427109 CCCTGGGGTGGGCAGGAGGAGGG + Intronic
1072862958 10:99025699-99025721 GAGTGGGGAGGGTAGGAAGAGGG + Intronic
1072863414 10:99030995-99031017 AGGTGGTGAGGGCAGGAAGAAGG + Intronic
1072929287 10:99646815-99646837 AAGGTGGGAGGGTAGGAGGAGGG - Intergenic
1073053433 10:100684034-100684056 CAGGGGGGAGGGGAGGAGCAGGG + Intergenic
1073426657 10:103459216-103459238 CAGTGGGAAGGGCAAAAGGAGGG - Intergenic
1073644688 10:105288662-105288684 GAGAGTGGAGGGGAGGAGGAGGG - Intergenic
1073734018 10:106325764-106325786 TAGTGGGGTGGGGTGCAGGAAGG - Intergenic
1073881764 10:107989761-107989783 TACTAGAGAGGGCAGGGGGAAGG + Intergenic
1073948052 10:108775385-108775407 TGTTGGGGAGGGCAGGGGCAGGG - Intergenic
1073992118 10:109273775-109273797 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1074073038 10:110092567-110092589 GAGTGGGGAAGGTAGCAGGAGGG + Intronic
1074241417 10:111643075-111643097 TCGTGGGGTGGGGGGGAGGAGGG + Intergenic
1074279295 10:112035828-112035850 TTGTGGTGATGTCAGGAGGAGGG - Intergenic
1074384592 10:113006891-113006913 AAGTGGGAAGGGCAGGAGGCTGG - Intronic
1074432827 10:113408468-113408490 TTGTGGTGAGGGCAGGGGGCAGG - Intergenic
1074729698 10:116356373-116356395 AAGAGGGGAGGGAGGGAGGAAGG + Intronic
1074984058 10:118641882-118641904 CAGTGGGGAGGGAAAGAGAAGGG - Intergenic
1075015340 10:118906611-118906633 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1075425866 10:122341436-122341458 GGCTGGGGCGGGCAGGAGGAAGG + Intergenic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1076188154 10:128464617-128464639 AGGAGGGGAAGGCAGGAGGATGG - Intergenic
1076291231 10:129347444-129347466 GAGAGGGGAGGGGAGGAGAATGG + Intergenic
1076347758 10:129791759-129791781 TGGTGGGGAGTGGAGGAAGAGGG - Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1076795362 10:132795500-132795522 TAGTGGGGAGGGGTGGGGGCTGG + Intergenic
1076862957 10:133150605-133150627 GAGTGGGGAGGGTGAGAGGAGGG + Intergenic
1076985521 11:233280-233302 CAGTGGGGAGGGCAGGAGTCAGG + Intronic
1077248846 11:1551801-1551823 GAGTGGGGTGGGCAGGTGGGTGG - Intergenic
1077248880 11:1551919-1551941 GAGTGGGGTGGGCGGGTGGATGG - Intergenic
1077262763 11:1631712-1631734 GGGTGGCGGGGGCAGGAGGAGGG - Intergenic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077361138 11:2140579-2140601 AAGTGGGGCGGGCAGGGGGCTGG - Intronic
1077367637 11:2167523-2167545 GAGTGAGAAGGGCAGGAGGGAGG + Intronic
1077393972 11:2312220-2312242 GAGTTGGGAGGGAAGCAGGAGGG + Intronic
1077777801 11:5290995-5291017 AAATGGGGAGGGTAGAAGGAAGG + Intronic
1077796977 11:5502517-5502539 TAGTGCATATGGCAGGAGGAGGG - Intronic
1077798647 11:5516729-5516751 TGGTGGGTGGGGTAGGAGGAGGG - Intronic
1077828725 11:5839432-5839454 TAGTGAGGAGGGCAGGATAGAGG + Intronic
1077914995 11:6605652-6605674 GAGTGGGGCGGGTAGGAAGAGGG - Intronic
1077988161 11:7376364-7376386 GAGAGGGGAGGGGAGGAGGAAGG - Intronic
1078068000 11:8090368-8090390 GAGTAGGGAGGGCAGAGGGAAGG + Intronic
1078470379 11:11581525-11581547 GAGGGGGCAGGGGAGGAGGAGGG - Intronic
1079021474 11:16912702-16912724 TAGAGGGGAGGGCAGGGAGCTGG + Intronic
1079186126 11:18238800-18238822 TAGTGGGGAGGGGGGGAGTGAGG - Intergenic
1079238048 11:18703436-18703458 AAGTGGGGAGGGGAGGAGGTGGG - Exonic
1079272592 11:19002778-19002800 GAGTGGGGAGAGTGGGAGGAGGG - Intergenic
1079349386 11:19679901-19679923 TAGTGCTGAAGGCAAGAGGAAGG + Intronic
1079363870 11:19792347-19792369 TCCTTCGGAGGGCAGGAGGAGGG - Intronic
1079403021 11:20121422-20121444 GAGAGAGGAGGGGAGGAGGAAGG - Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079995748 11:27293544-27293566 AAGAGGGGAGGGGAGGAGGTGGG + Intergenic
1080017769 11:27525647-27525669 TAGCATGGAGGGTAGGAGGAAGG + Intergenic
1080083432 11:28249869-28249891 GAGGGTGGAGGGTAGGAGGAAGG - Intronic
1080086469 11:28288662-28288684 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
1080114571 11:28607233-28607255 TGGTGGGGAGGGGGAGAGGAGGG - Intergenic
1080425893 11:32154018-32154040 TAGTGTACAGGGCAGGAAGAAGG + Intergenic
1080438960 11:32272795-32272817 TAGTGGGAGGGTCAGGAGGGAGG + Intergenic
1080456420 11:32423607-32423629 AAGTGCAGAGGGTAGGAGGATGG + Intronic
1080711070 11:34748555-34748577 TGGCCTGGAGGGCAGGAGGAAGG + Intergenic
1080799616 11:35598205-35598227 AGATGGGGAGGGGAGGAGGAAGG - Intergenic
1081054659 11:38394511-38394533 TAGTGGGGAGTGAAGGAGTAGGG - Intergenic
1081084136 11:38778053-38778075 TGGAGAGGAGGGCAGGAAGAGGG + Intergenic
1081089667 11:38847633-38847655 AAGGTGGGAGGGCAGGAGGAGGG - Intergenic
1081188076 11:40069857-40069879 GAGAGGGGAGGGCAGGAAGGGGG + Intergenic
1081526069 11:43928589-43928611 GAGTGGGGAGCGGAGGAGGTGGG + Intronic
1081553570 11:44136738-44136760 GACTGGAGAGGGGAGGAGGAGGG - Intronic
1081566558 11:44264356-44264378 AAGATGGGAGGGCAGGAGGCTGG + Exonic
1081632020 11:44695699-44695721 TAGAGGGCAGGGCAGCAGGCTGG + Intergenic
1081683002 11:45021963-45021985 CAGGGGGCAGGGCAGGAGGGAGG + Intergenic
1081704684 11:45174794-45174816 TAGTGGTTAGTTCAGGAGGAGGG - Intronic
1081837740 11:46170920-46170942 TATTGGGGACAGCAGGAGGCAGG - Intergenic
1081991781 11:47341966-47341988 GAGTGTGCAGGGCAGGTGGATGG - Intronic
1082024876 11:47564985-47565007 GACAGGGGAGGGGAGGAGGAAGG + Intronic
1082135968 11:48549635-48549657 TCGGGTGGGGGGCAGGAGGATGG - Intergenic
1082217998 11:49598027-49598049 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1082712058 11:56565093-56565115 GAGGGGGGAGGGTGGGAGGAGGG - Intergenic
1082820025 11:57538427-57538449 TCCTGGGGAAGGAAGGAGGAAGG + Intergenic
1082884993 11:58071909-58071931 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1083282316 11:61634722-61634744 TGGTGGCTAGGGCAGGATGAGGG + Intergenic
1083657311 11:64235700-64235722 GAGTGGGGAGGGCTAGTGGAGGG + Intronic
1083758941 11:64805528-64805550 GATTAGGGATGGCAGGAGGAAGG - Intronic
1083862750 11:65432835-65432857 AAGTGGGGAGGGTAAGAGGGGGG - Intergenic
1083891081 11:65595987-65596009 TGGTGGGGATGGGTGGAGGAAGG + Exonic
1083941120 11:65896508-65896530 TAGCGGGGGTGGCAGGAGCAAGG - Intronic
1084001615 11:66298278-66298300 TATTGGGGAAGGGAGGAGAATGG - Intergenic
1084125561 11:67096755-67096777 GAGTTGGGAGGGCAGGAGGCAGG - Intergenic
1084165430 11:67373018-67373040 TAGGAGGGCGGGCGGGAGGAAGG - Intronic
1084360883 11:68667817-68667839 AAGTGGAGAGGGCAGGGGCAGGG - Intergenic
1084640257 11:70421593-70421615 TCGGGGGGAGGGTAGGAGGCTGG - Intronic
1084699750 11:70778798-70778820 CAGTGTGGAGGGCAGTAGGCAGG - Intronic
1084716479 11:70877493-70877515 TGGTGGGGAGGGCAGGAGCCGGG - Intronic
1084738561 11:71122497-71122519 TAGTGTGGAGGGTTGGGGGAGGG + Intronic
1084956791 11:72695864-72695886 CACTGGAGAGGGGAGGAGGAGGG + Exonic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085135559 11:74084293-74084315 TGGGGTGGAGGGCAGGGGGAGGG + Intronic
1085244523 11:75089222-75089244 TGCTGGGATGGGCAGGAGGAGGG + Exonic
1085388740 11:76171531-76171553 CAGTGGGGATGGCAGGCGGGAGG + Intergenic
1085401975 11:76240906-76240928 TAGTGGAGAGGGCAGGGGTCGGG + Intergenic
1085569526 11:77547282-77547304 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1085709058 11:78812678-78812700 TAGAGGAGAGCGCTGGAGGAGGG - Intronic
1085864567 11:80274404-80274426 TAGAGTGGAGGGCAGGAGGAGGG - Intergenic
1085965858 11:81525240-81525262 GAGGAGGGAGGGTAGGAGGAAGG - Intergenic
1086124694 11:83338407-83338429 GACTGGGGAGGGAGGGAGGAAGG + Intergenic
1086170647 11:83832604-83832626 GAGTGGGGAGGGAAGGAAAAGGG + Intronic
1086271617 11:85074091-85074113 GAGTGTGGAGAGTAGGAGGAAGG + Intronic
1086631574 11:89026161-89026183 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1086760541 11:90625059-90625081 GAGAGTGGAGGGTAGGAGGATGG + Intergenic
1086866326 11:91984240-91984262 CAGGAGGGAGGGCAGGGGGAAGG + Intergenic
1086991606 11:93309824-93309846 AAGGGGGGAGGGTAGGAGGAGGG + Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087417768 11:97879873-97879895 GAGGTTGGAGGGCAGGAGGAGGG - Intergenic
1087999838 11:104864510-104864532 TAGTGTGGAGAGTGGGAGGAGGG - Intergenic
1088420356 11:109638354-109638376 GAGGGGGGAGGGTGGGAGGAGGG - Intergenic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1089125640 11:116174662-116174684 GGGAGGGGAGGGGAGGAGGATGG - Intergenic
1089139666 11:116275653-116275675 GAGTGGGGAGGACAGGGGGCAGG + Intergenic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089315307 11:117587390-117587412 TGATGGGGAGGGTAGGAGGAGGG - Intronic
1089563453 11:119357410-119357432 CCGGAGGGAGGGCAGGAGGAAGG - Intronic
1089643629 11:119863990-119864012 CTGTGATGAGGGCAGGAGGAAGG - Intergenic
1089794328 11:120967886-120967908 TCGAGGGAAGGCCAGGAGGAGGG - Intronic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1089905270 11:122031724-122031746 GAGTGGGGAGGGTGGGTGGAGGG + Intergenic
1090261944 11:125327604-125327626 GAGTGTGGAGGGCAAGAGGAGGG + Intronic
1090306208 11:125693382-125693404 AAGTGGGTAGGGGAGAAGGAGGG - Intergenic
1090683896 11:129094089-129094111 TAGTGGGGTGGGGAGGAGGTGGG + Intronic
1091037515 11:132247000-132247022 GTTTGGGGAGGGGAGGAGGATGG - Intronic
1091037550 11:132247116-132247138 TCATGGGGAGCCCAGGAGGAGGG - Intronic
1091151621 11:133334493-133334515 TGATGGGGAGGGTGGGAGGAAGG + Intronic
1091191006 11:133695272-133695294 CAGTGGGGAGGACAGGATGGAGG - Intergenic
1091275734 11:134348434-134348456 GAGTCGGGTGGGCAGCAGGATGG + Intronic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091393439 12:139396-139418 TGGGAGGGAGGGAAGGAGGAGGG + Intronic
1091396607 12:157268-157290 TTCTGGTGTGGGCAGGAGGATGG + Intronic
1091449457 12:563316-563338 GTGTGGGCAGGGCAGGAGGCTGG - Exonic
1091450701 12:570492-570514 GAGTGGGGAGCGCAGCAGGGTGG + Intronic
1091456228 12:610154-610176 GGATGGGGAAGGCAGGAGGATGG - Intronic
1091802619 12:3334159-3334181 TTTTGGGGAGGGAAGGAGAAGGG - Intergenic
1092253490 12:6914409-6914431 GAGTGGGGAAGGGAGGAGGATGG - Intronic
1092358890 12:7819554-7819576 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092372010 12:7924482-7924504 TGGTGGAAAGGGCAGGAAGAAGG - Exonic
1092514152 12:9190494-9190516 GAGGGTGGAGGGCGGGAGGAGGG + Intronic
1093097528 12:14988883-14988905 AAACGGGGAGGGAAGGAGGAGGG + Intergenic
1093141632 12:15516560-15516582 GAAGGGGGAGGGCAGGGGGAGGG + Intronic
1093385045 12:18542550-18542572 GAGGGGCGAGGGTAGGAGGAGGG - Intronic
1093586346 12:20841718-20841740 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1093675392 12:21933224-21933246 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1093893266 12:24548705-24548727 TAGAGAGGAAGGCAAGAGGAAGG - Intergenic
1094084479 12:26574785-26574807 ATGTGGCGAGGGCAGGAGCAAGG + Intronic
1094186191 12:27645452-27645474 AAGTGTGGGGGGCAGGAGGGAGG + Intronic
1094257112 12:28444678-28444700 GAGAGTGGAGGGTAGGAGGAGGG + Intronic
1094299297 12:28943808-28943830 GAGGGTGGAGGGCAGGAGGTGGG - Intergenic
1094448198 12:30555782-30555804 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1094498618 12:31004750-31004772 TGCAGTGGAGGGCAGGAGGAAGG + Intergenic
1094793048 12:33936403-33936425 TTGTGGGGGGGGCAGGGGGGAGG + Intergenic
1095277199 12:40300605-40300627 TATTCAGGAGGGTAGGAGGAAGG - Intronic
1095519545 12:43046291-43046313 GAGAGTAGAGGGCAGGAGGAGGG + Intergenic
1095617375 12:44206812-44206834 GAGTGGGGAGGGTGAGAGGAGGG + Intronic
1095991482 12:48037525-48037547 TAGGAGAGAGGGCAGGAGGAGGG + Intergenic
1096154248 12:49332984-49333006 GGGTGGGGCGGGCAGGAGGTGGG + Exonic
1096356880 12:50948864-50948886 GAGGGGGGAGGGGAGGGGGAGGG + Intergenic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096633654 12:52945300-52945322 TGGTGGGGTGGGCTGGAGGGAGG - Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096791838 12:54050167-54050189 TACTGGGGAGGGGAGGAATATGG + Intronic
1096809010 12:54158026-54158048 TTGGGGGGAAGGCAGCAGGAAGG - Intergenic
1096929358 12:55188553-55188575 CTGTTGGGAGGGCATGAGGAGGG + Intergenic
1096958895 12:55557433-55557455 AAGGGTGGGGGGCAGGAGGAGGG - Intergenic
1097185133 12:57192685-57192707 CAGTGGGGAGGGCATGGGGATGG - Intronic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1097319957 12:58214434-58214456 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097405535 12:59184961-59184983 TGGTGGGGAGTGCAGGAGATTGG + Intergenic
1097520352 12:60661304-60661326 GAGAGGGGAGGGAAGGAGGAGGG - Intergenic
1097598531 12:61664213-61664235 TCCTGGGGAGGGTTGGAGGAGGG - Intergenic
1097844205 12:64350138-64350160 TAGGGGGAAGGGTAGGAGGGAGG + Intronic
1097901898 12:64881772-64881794 AGGTGGGGTGGGCAGGGGGAGGG - Intergenic
1097950390 12:65420619-65420641 GAGGGAGCAGGGCAGGAGGAGGG - Intronic
1098085204 12:66834935-66834957 AAGGGGGGGGGGCAGGAGTAGGG + Intergenic
1098549097 12:71743126-71743148 TTGTGGCCAGGGCAGGGGGAGGG + Intergenic
1098569327 12:71971035-71971057 TAGAGGGTTGGGGAGGAGGAAGG + Intronic
1098850782 12:75593730-75593752 TAGTGGGTGGGGGATGAGGATGG - Intergenic
1099036233 12:77590511-77590533 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1099196604 12:79624276-79624298 TAGTTGAGGGGGCAGGAGGAGGG - Intronic
1099310407 12:81013738-81013760 TAGTAGGGAGAGCAGGAGAGGGG - Intronic
1099313296 12:81054408-81054430 GAGAGTGGAGGGTAGGAGGAGGG + Intronic
1099320235 12:81137949-81137971 AAGTGGCGAAGGCAGAAGGAAGG - Intronic
1099870814 12:88347149-88347171 TGGGGTGGAGGGCAGGGGGAGGG - Intergenic
1100196645 12:92253861-92253883 GAGTGTGGGGGGCGGGAGGAGGG - Intergenic
1100375564 12:94013190-94013212 GAGAGGGGAGGGGAGGGGGAGGG + Intergenic
1100396871 12:94193364-94193386 TAGTGGTGAGGGAAGGAAGTGGG + Intronic
1100846999 12:98669890-98669912 AAGAGGGGAGGGCAGGAAGAGGG - Intronic
1100847005 12:98669906-98669928 AAGAGGGGAGGGCAGGAAGAGGG - Intronic
1100914551 12:99404172-99404194 GAGAGTGGAGGGTAGGAGGAAGG + Intronic
1101331550 12:103761573-103761595 GAGTGGGGATGGCAGGAAGCAGG - Intronic
1101363701 12:104051726-104051748 CACTGGGAAGGGCAGGAGGAAGG - Intronic
1101371054 12:104130917-104130939 GGGTGGGGAGGGCAGGCGGTGGG + Intronic
1101640233 12:106581954-106581976 GGGTGGGGAGGGCAGGGGGAGGG + Intronic
1101751340 12:107584995-107585017 GAGTGGGGAGGGCAGTGGAAGGG + Intronic
1101925623 12:108969236-108969258 AAGGAGGGAGGGAAGGAGGAGGG - Intronic
1101952440 12:109187143-109187165 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
1102420668 12:112800570-112800592 GAGAGGGGAGTGCAGGAGGTGGG + Intronic
1102434564 12:112910882-112910904 CAGTGGAGAGGGCAGGAGGGAGG + Intronic
1102703138 12:114857563-114857585 GAGGATGGAGGGCAGGAGGAGGG - Intergenic
1103725752 12:122996684-122996706 AGTTGGGGAGGGGAGGAGGATGG - Intronic
1103956804 12:124581979-124582001 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1104200207 12:126581481-126581503 TACTGGGCATGGCAGGCGGAAGG + Intergenic
1104298038 12:127536392-127536414 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1104404563 12:128506721-128506743 TGGTGGTGAGGACAGGAGCATGG - Intronic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104519209 12:129457445-129457467 TAGGGGGGAGGGGAGAGGGATGG + Intronic
1104544454 12:129698634-129698656 GAGAGGGGAGGGGAGGGGGAGGG + Intronic
1104587499 12:130059339-130059361 AGGTGGGGAAGCCAGGAGGATGG - Intergenic
1104647722 12:130509044-130509066 TGGTGGGGAGGGCCGGGGGCCGG - Intronic
1104674480 12:130703475-130703497 GATTGGGGAGGGCAGGCGGGTGG - Intronic
1104921834 12:132294629-132294651 AAGAGGGCAGGGCAGGAGCAAGG + Intronic
1105039963 12:132954456-132954478 GGGTGGGGAGGGGAGGAGAAGGG + Intronic
1105215392 13:18281190-18281212 TTGTGTGGAGGGCAGGGGCAGGG + Intergenic
1105446218 13:20459695-20459717 TAGGGTGGAGGGTGGGAGGAGGG + Intronic
1105530558 13:21215327-21215349 GAGAGTGGAGGGTAGGAGGAGGG + Intergenic
1105924030 13:24990434-24990456 GAGAGTGGAGGGTAGGAGGAGGG - Intergenic
1105975580 13:25469246-25469268 TAGTGGGGTGGGGAGGGGGCAGG - Intronic
1106048496 13:26168045-26168067 TAGGGTGGAGGGTGGGAGGAGGG + Intronic
1106065176 13:26340856-26340878 TAGAAGGGAGGGAGGGAGGAAGG + Intronic
1106125029 13:26894237-26894259 AAGGGAGGAGGGAAGGAGGATGG + Intergenic
1106414893 13:29538285-29538307 AAGTGGGGAGGAAATGAGGAGGG + Intronic
1106426897 13:29639921-29639943 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1106669053 13:31885530-31885552 TTTTGGGGAGGGGAGGGGGAAGG + Intergenic
1106986414 13:35357440-35357462 CAGGGTGGAGGGTAGGAGGAGGG - Intronic
1107534532 13:41315140-41315162 TGTTGGGGAAGGAAGGAGGATGG + Intronic
1107888799 13:44896293-44896315 GGGTTGGGAGGGCGGGAGGAAGG - Intergenic
1108703876 13:52967602-52967624 TAATAGGGAGTGCAGAAGGAGGG + Intergenic
1108973871 13:56411685-56411707 TAGTGGTGAGGGAATGGGGATGG + Intergenic
1109862145 13:68213988-68214010 AAGTGGGGAGGAAGGGAGGAGGG - Intergenic
1109915562 13:68981101-68981123 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1110334627 13:74313244-74313266 GAGTGTGGAGGGTAGGAGGAGGG - Intergenic
1110396681 13:75037856-75037878 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1110431932 13:75434491-75434513 GAGGGTGGAGGGCGGGAGGAGGG + Intronic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110788968 13:79566497-79566519 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1110802705 13:79718281-79718303 AAGTGTAGAGGGTAGGAGGAGGG - Intergenic
1110846511 13:80195836-80195858 TGGGAGGGAGGGCAGAAGGAAGG + Intergenic
1111331593 13:86765430-86765452 AGGTGGGGAGGGAAGGAGAAAGG + Intergenic
1111363006 13:87200970-87200992 GAGTGTAGAGGGTAGGAGGAGGG + Intergenic
1111634552 13:90887185-90887207 TACTGGGGAATGGAGGAGGAGGG + Intergenic
1111791288 13:92858653-92858675 AAAGAGGGAGGGCAGGAGGAGGG + Intronic
1111861713 13:93715458-93715480 AAGAGGGGAGGGAAGGAGGAAGG + Intronic
1111882044 13:93969710-93969732 TAGAGGGGAGGGAGGGATGAAGG - Intronic
1112099948 13:96177635-96177657 TTGTAGGGAGGGTGGGAGGAGGG + Intronic
1112346421 13:98593750-98593772 TTATGGGGCTGGCAGGAGGAGGG - Intergenic
1112501950 13:99949817-99949839 TGCTGGGGAGGGGAGGAGGCTGG + Intergenic
1113078366 13:106491076-106491098 TGCGGGGGAGGACAGGAGGAGGG + Exonic
1113193576 13:107778756-107778778 GAGTGGGGAGGGAAGAAAGAGGG - Intronic
1113391614 13:109903318-109903340 ACGTGGGGAGTGCGGGAGGAAGG + Intergenic
1113677240 13:112215273-112215295 AAGTGGGGGGGACTGGAGGAGGG + Intergenic
1113753977 13:112796253-112796275 TAGTGTGGCAGGCAGAAGGATGG + Intronic
1113796579 13:113061842-113061864 AAGAGGGGAGGGGAGGAGGAGGG - Intronic
1113804503 13:113105628-113105650 AAGTGGGGGGGACAGGAGAAAGG - Intergenic
1113988256 13:114336830-114336852 GAGGGGGGAGGGTGGGAGGAGGG + Intergenic
1114040411 14:18673132-18673154 AAGAGAGGAGGGAAGGAGGAAGG + Intergenic
1114136047 14:19852392-19852414 GAGGGAGGAGGGTAGGAGGAGGG - Intergenic
1114189111 14:20427804-20427826 CAGTGGGGAGAGCAGGATGGGGG + Intergenic
1114378662 14:22177112-22177134 CAGTGGGGAAGGCAGGGGCAGGG - Intergenic
1114417766 14:22555772-22555794 GAGTGGGGAGTACAGGAGAAAGG + Intergenic
1114616311 14:24070299-24070321 GAGTGGGGAAGGCATCAGGAAGG - Intergenic
1114662212 14:24354252-24354274 GAGGGAGGAGGGAAGGAGGAAGG - Intergenic
1114829158 14:26118377-26118399 TAGAGTGGAGGGTAGGCGGAGGG + Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1114901924 14:27072279-27072301 GAGGGGAGAGGGCAGGAGGAGGG + Intergenic
1115283256 14:31688806-31688828 GAGGGTGGAGGGCGGGAGGAGGG - Intronic
1115754780 14:36519859-36519881 GAGCGGGGAGGGCAGGAGGTGGG + Intronic
1116185339 14:41593208-41593230 GAGAGAGGAGGGTAGGAGGAGGG + Intergenic
1116205049 14:41854361-41854383 TCGTGGGGTGGGGAGGGGGAGGG + Intronic
1116501936 14:45634466-45634488 GAAGGGGGAGGGAAGGAGGAGGG - Intergenic
1116504944 14:45666246-45666268 AAGAGTGGAGGGTAGGAGGAGGG - Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117221840 14:53613899-53613921 CTGTGGGGAGTGCAGGAGGCTGG - Intergenic
1117342164 14:54801862-54801884 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1117442698 14:55774838-55774860 CAGTGGGGAGAGGATGAGGAGGG - Intergenic
1117548678 14:56812588-56812610 CAGAGGGGAAGGCCGGAGGAAGG + Intergenic
1117838631 14:59833676-59833698 GAGGGTGGAGGGCGGGAGGAGGG - Intronic
1117955947 14:61123793-61123815 TGGTGGGGAGGGCTGGGGGAGGG - Intergenic
1118034883 14:61856076-61856098 TGGAAGGGAGTGCAGGAGGAGGG + Intergenic
1118360690 14:65054078-65054100 TGCTGGGCAGGGCTGGAGGATGG + Intronic
1118597795 14:67449475-67449497 AAGTGGGGTGGCAAGGAGGAGGG + Intronic
1118598825 14:67457127-67457149 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1118653498 14:67923016-67923038 TAAGGGGAAGGGCAGGAGGCAGG - Intronic
1118707693 14:68495243-68495265 AAGTGGGGTGGGCAGGATGCAGG - Intronic
1118816586 14:69318382-69318404 AAGTGGGGAAGGCAGCAGGCTGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118903448 14:70005462-70005484 GAGTGGGCAGGGCAGGAGACAGG - Intronic
1119131335 14:72175809-72175831 TAGTGGGGAGGGAGAGAGAAAGG + Intronic
1119162111 14:72461254-72461276 CAGTGGAGAGGGTGGGAGGATGG + Intronic
1119276490 14:73361604-73361626 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1119519662 14:75276987-75277009 GAGCGGGGAGGGCAGGAGGCGGG - Intergenic
1119543923 14:75458312-75458334 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1119557111 14:75561751-75561773 GAGGGTGGAGGGCAGGAAGAGGG - Intergenic
1119759780 14:77142007-77142029 GAGAGGGAAGGGCAGGATGATGG - Intronic
1119827755 14:77671650-77671672 AAGTGGGGAGGGCTAGAGGGAGG + Intergenic
1119842057 14:77800480-77800502 GAGTGGGCAGAGCTGGAGGAGGG + Intronic
1119945552 14:78689914-78689936 TAGTGGGGAGGAGCGGAGGAGGG - Intronic
1120277950 14:82401179-82401201 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1120521194 14:85530081-85530103 TAGGAGGGAGAGGAGGAGGAGGG + Intergenic
1120701348 14:87702792-87702814 TAGTGGGGAGGGCAGGGTTTAGG - Intergenic
1120840507 14:89081170-89081192 TTGTGGGGAGGGCAGCAAAAAGG - Intergenic
1120982288 14:90300868-90300890 AGGAGGGGAGGGGAGGAGGAAGG + Intronic
1121141351 14:91545255-91545277 AAGAAGGGAGGGAAGGAGGAAGG - Intergenic
1121301383 14:92874174-92874196 TAGAGGTTTGGGCAGGAGGAAGG + Intergenic
1121491025 14:94361365-94361387 CCCTGGGGAGGGCAGGAGAAGGG + Intergenic
1121800322 14:96769119-96769141 GAGAGGGGAGGGAAGAAGGAAGG - Intergenic
1121850871 14:97220000-97220022 TAGTGGGAAGGGCAGGATCCTGG - Intergenic
1122044990 14:99016971-99016993 TTGTGGGGAGGGCAGGGGGTGGG - Intergenic
1122112260 14:99510674-99510696 CAGGGGGGACGGCAGGAGGTGGG - Exonic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1122140648 14:99660928-99660950 TAATGGGGAGAGGAGGAGGTGGG + Intronic
1122178241 14:99936765-99936787 AGGTTGGGAGGGGAGGAGGAGGG - Intronic
1122416744 14:101553454-101553476 GAGAGGGGAGGCCAAGAGGAGGG - Intergenic
1122428537 14:101625517-101625539 TAGGGAGCAGGGCAGGAGAAAGG + Intergenic
1122442807 14:101744375-101744397 TGGGGTGGAGGGCAGGGGGAGGG - Intergenic
1122557612 14:102590168-102590190 TCGAGGGGAGGGCAGCGGGATGG + Intergenic
1122633842 14:103121278-103121300 TGGTGGGGAGGGCAGCAGACAGG - Intergenic
1122651492 14:103229363-103229385 TAGGGTGTGGGGCAGGAGGAAGG - Intergenic
1122654889 14:103251501-103251523 TAGTTTGGTGGGCAGGAGGATGG - Intergenic
1122898332 14:104771538-104771560 TGGAGGGCAGGGCAGGAGGGTGG + Intronic
1122964327 14:105114771-105114793 AAGTTGGGAGGTCAGAAGGAGGG + Intergenic
1122965051 14:105119575-105119597 AAGTTGGGAGGTCAGAAGGAGGG + Intergenic
1123217859 14:106828795-106828817 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1124078432 15:26468881-26468903 GAGTGTGGAGGGCAGGAGGGGGG + Intergenic
1124253138 15:28120668-28120690 TGGTGGGGAGGGTGTGAGGATGG + Intronic
1124447855 15:29754368-29754390 GAGGGGGGAGGGTAGGAGGAGGG + Intronic
1124486554 15:30122364-30122386 TAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1124541629 15:30591343-30591365 TAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1124548294 15:30653144-30653166 TAGGGTGGAGGGTGGGAGGAGGG - Intronic
1124689680 15:31811681-31811703 CAGTTGTGAGGGCAAGAGGAAGG - Intronic
1124757030 15:32416242-32416264 TAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1124812675 15:32956879-32956901 TATTGGGGAGGGGAGAAGGGTGG - Intronic
1124855271 15:33381557-33381579 GAGTGGTCAGGGCAGGAAGAAGG - Intronic
1124924096 15:34054681-34054703 TGGGGGTGAGGGTAGGAGGAGGG + Intronic
1125093706 15:35826678-35826700 AAGTGGGGAGGGCAAGAGGGTGG + Intergenic
1125586487 15:40824239-40824261 TAGTGGAGAGGTCAGGAGTAAGG - Intronic
1125608525 15:40955987-40956009 TGGTGTGGTGGGCAGGTGGAGGG + Exonic
1125728942 15:41882245-41882267 TAGTGGGGAGGGGTGGAGGCGGG - Intronic
1125873788 15:43126153-43126175 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1126046561 15:44646824-44646846 GAGGGTGGAGGGTAGGAGGAAGG + Intronic
1126416536 15:48423651-48423673 TAGAGGGGAGAAGAGGAGGAAGG - Intronic
1126426227 15:48529466-48529488 GAGTGTGGAGGGCAGATGGATGG + Intronic
1126502479 15:49361389-49361411 GAGGGAGGAGGGAAGGAGGAGGG - Intronic
1126520461 15:49587330-49587352 AAGGGTGGATGGCAGGAGGAGGG + Intronic
1126741930 15:51786172-51786194 GAGTGAGGAGGGGAGGAGGGTGG - Intronic
1127003522 15:54538845-54538867 AAGAGTGGAGGGCGGGAGGAGGG + Intronic
1127022858 15:54769426-54769448 GAGGGTGGAGGGAAGGAGGAGGG + Intergenic
1127047522 15:55043016-55043038 TGGTGGGTGGGGCAGGAGGGTGG + Intergenic
1127227618 15:56949899-56949921 TAGTGGGGAAGACAGGAAAAGGG + Intronic
1127440135 15:58998391-58998413 GAGTGTGGAGGGTGGGAGGAGGG - Intronic
1127636035 15:60870697-60870719 TAGTGGGGAGGGGAAGATGCAGG - Intronic
1127682326 15:61309893-61309915 CAGTGGGGAGCCCAGCAGGAGGG + Intergenic
1127829745 15:62739807-62739829 TTGGAGGGAGGGTAGGAGGAGGG + Intronic
1127889009 15:63230975-63230997 TAGTAGAGAGGGGAGGAGGAAGG - Intronic
1128113429 15:65090588-65090610 CAGAGAGGAGGTCAGGAGGATGG - Intergenic
1128147164 15:65338067-65338089 TAGTGCTGAGGGGAGGAGGAGGG - Intronic
1128745778 15:70113379-70113401 TGGTGGGGAGAGCAGGGGAAGGG - Intergenic
1128756123 15:70185213-70185235 TGGTGGGAAGGAGAGGAGGAGGG + Intergenic
1128762639 15:70227925-70227947 CAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1129068732 15:72933237-72933259 GAGTGGGGAGGGATGGAGGGAGG + Intergenic
1129250862 15:74308219-74308241 TAGTGGTGAGGGTTGGGGGAGGG - Intronic
1129384091 15:75185978-75186000 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1129599994 15:76993261-76993283 TGGAAGGGAGGGGAGGAGGAAGG + Intergenic
1129732684 15:77941000-77941022 TAGCATGGAGGGCAGGAGGCTGG - Intergenic
1129921916 15:79326599-79326621 TAGGGAGGAGGGCGGGAAGAAGG + Intronic
1129959572 15:79671233-79671255 AAGAGTGGAGGGTAGGAGGAGGG + Intergenic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130301091 15:82680329-82680351 CAGTGCGGAGGGCAGGACTACGG + Intronic
1130324460 15:82868431-82868453 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1130791991 15:87165166-87165188 TAGGGGCTAGGGCAGGAGGTGGG - Intergenic
1131063834 15:89420736-89420758 TAGTGGGGAGGCCACAGGGAAGG + Intergenic
1131081372 15:89539105-89539127 GAGGGGGGAGGGAAGGAGGGAGG + Intergenic
1131091296 15:89626583-89626605 AAAGGGGGAGTGCAGGAGGAGGG + Intronic
1131235944 15:90697256-90697278 TAGTTGAGAGGGCAAAAGGAAGG + Intergenic
1131313157 15:91309086-91309108 TAGTTGGCAGGGGCGGAGGAGGG - Intergenic
1131341671 15:91608371-91608393 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1131344965 15:91637886-91637908 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1131434516 15:92412340-92412362 AGGTGGGGAGGGGAAGAGGAGGG + Intronic
1131751027 15:95508510-95508532 GAGAGGAGAGGGGAGGAGGAGGG - Intergenic
1132515519 16:364121-364143 TGGTGAGGATGGCAGAAGGAGGG + Intergenic
1132626452 16:893977-893999 CAGTGGGGTGGACAGGTGGATGG - Intronic
1133303611 16:4797244-4797266 TAGTGGGGAGGTCAGGGAGGCGG - Exonic
1133320300 16:4909375-4909397 GGGTGGGGAGGTCAGGAGGGAGG - Intronic
1133527486 16:6619850-6619872 TAGGGTGGAGGGTGGGAGGAGGG - Intronic
1133551161 16:6855814-6855836 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1133736524 16:8620119-8620141 TGGTGGGGAGGGCACTAGGAAGG - Intergenic
1133739465 16:8640567-8640589 TGGGTGGGAGGGCAGAAGGATGG + Intronic
1133739498 16:8640691-8640713 TAGATGGAAGGGCAGGAAGATGG + Intronic
1134335987 16:13300183-13300205 TACTGGGGAGGGAAGAAGAAAGG - Intergenic
1134793718 16:17014721-17014743 GAGCAGGGAGGGAAGGAGGAGGG - Intergenic
1135007457 16:18839334-18839356 GAGGGTGGGGGGCAGGAGGAGGG - Intronic
1135110924 16:19690314-19690336 GAGTGGGGAGGGAAGGAGGGAGG + Intronic
1135166105 16:20140556-20140578 CAGTGGGTGGGGCAGAAGGAAGG - Intergenic
1135186836 16:20322812-20322834 GAGGGGGCAGGGCAGGAGGGAGG - Intronic
1135302859 16:21345804-21345826 GAGGGGGGAGGGGAGGAGGGAGG - Intergenic
1135420769 16:22304255-22304277 CAGTGGGAAGGGCAGGGGCAAGG + Intronic
1135500691 16:22993310-22993332 TGGTGGAGAGGGCTGGAGAATGG + Intergenic
1135640238 16:24113517-24113539 AAGGGGGGAGGGAGGGAGGAAGG - Intronic
1135872077 16:26160513-26160535 TGGTGGAGAGGGCAGGGAGATGG + Intergenic
1136051884 16:27656786-27656808 TGGTGGGGAGGGGAGGGGGGAGG + Intronic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1136085594 16:27882675-27882697 GAGTGGGGTGGGCATGGGGAAGG - Intronic
1136184221 16:28576249-28576271 GGGCGGGGAGGGTAGGAGGAGGG + Intronic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1137357187 16:47778150-47778172 TTGTGTGGAGGGTAGTAGGAAGG + Intergenic
1137506906 16:49062010-49062032 GAGTGGGGAGGGTGGGAGGAGGG - Intergenic
1137714847 16:50592345-50592367 GAGTGGGGAGGGCATGGGGCAGG - Intronic
1137904209 16:52302759-52302781 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1137982101 16:53078722-53078744 AAGTGGGGAGGGAAGCAGTAAGG - Intronic
1138072644 16:54008571-54008593 AAGTGGGGAATGCAGGGGGAAGG - Intronic
1138226749 16:55302657-55302679 GATTTGGGAGGGCAGGGGGAGGG - Intergenic
1138458811 16:57135973-57135995 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
1138667749 16:58586361-58586383 GGGAGGGGAGGGCAGGGGGAGGG + Intronic
1138940903 16:61787938-61787960 TGGTGGGGGGGGCGGGGGGAGGG + Intronic
1139209900 16:65067036-65067058 TGGTGGGGAGAGCTGGAGGGAGG + Intronic
1139345533 16:66300664-66300686 AAGTGGGGAGGCCAGGATGAAGG - Intergenic
1139353003 16:66349265-66349287 TAGTGGGGAGAGTTGGAGGAGGG + Intergenic
1139549290 16:67664589-67664611 CAGTGGGAAGGGCAGGGGTATGG - Intronic
1139683195 16:68581239-68581261 TTTTGGGGAGGGAAGGGGGATGG + Intergenic
1140012734 16:71152507-71152529 TGGGGGAGAGGGCAGGAGGAGGG - Intronic
1140264670 16:73409975-73409997 TAGTGGGTGGGGCAGGGGGGTGG + Intergenic
1140344140 16:74195817-74195839 TATTGGGAAGGGTAGGAAGATGG - Intergenic
1140419295 16:74804949-74804971 TGGAGGGGAGGGGAGAAGGAGGG - Intergenic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1140892671 16:79298494-79298516 AACTGGGGAGGGGAAGAGGAGGG + Intergenic
1140980116 16:80100431-80100453 AAGTGGGAGGGGCAGGAGTAGGG + Intergenic
1141113996 16:81292917-81292939 AGGTGAGGAGGGCAGGAGGTAGG - Intergenic
1141173328 16:81704440-81704462 AAGTGGGTAGGGGAGGGGGAGGG - Intronic
1141211491 16:81984806-81984828 AGGTGGGGAGGGTAAGAGGAGGG + Intergenic
1141427147 16:83951911-83951933 AAGTAGGGAGGGAAGGAGGGAGG - Intronic
1141427188 16:83952019-83952041 AAGTAGGGAGGGAAGGAGGGAGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141646572 16:85370960-85370982 AGGCTGGGAGGGCAGGAGGAGGG + Intergenic
1141895892 16:86958667-86958689 TGGTGAGGAGGGGAGGTGGAGGG - Intergenic
1142105223 16:88299040-88299062 TAGGGTGGAGGTCAGGAGAAAGG + Intergenic
1142119224 16:88377680-88377702 GAGGAGGGAGGGCTGGAGGAGGG - Intergenic
1142159288 16:88548315-88548337 TGGTGGGTGGGGCAGGAAGAGGG - Intergenic
1142172255 16:88628872-88628894 TAGGGGGCAGGGCAGAGGGACGG + Intronic
1142180689 16:88668192-88668214 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180701 16:88668230-88668252 ATGGGGGGAGGGCAAGAGGAGGG - Intergenic
1142180712 16:88668268-88668290 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180724 16:88668306-88668328 ATGGGGGGAGGGCAAGAGGAGGG - Intergenic
1142180735 16:88668344-88668366 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180747 16:88668382-88668404 GAGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142243495 16:88957827-88957849 TGGTGGGCAGGGCAGAGGGAGGG + Intronic
1142246425 16:88972209-88972231 TACTGGGGAGGGAGGGAGGGAGG + Intronic
1142299260 16:89247229-89247251 GAGCGGGGAGCCCAGGAGGACGG + Intergenic
1142317833 16:89360047-89360069 GAGGGGAGAGGGCGGGAGGAGGG - Intronic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1142751663 17:1992252-1992274 TACTTGGGGGGGCAGGAGAATGG + Intronic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1142969298 17:3600757-3600779 GAGTGGCCAGGGCAGGAGGAGGG - Intergenic
1142981901 17:3677266-3677288 GGGTGGGGAGGGCAGGAGCTCGG + Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143500456 17:7335759-7335781 TTGAGGAGAGGGGAGGAGGAAGG + Intergenic
1143619836 17:8074462-8074484 TGGTGGTGAGGGGAGGAGGAGGG - Intronic
1143679232 17:8463996-8464018 CACTGGAGAGGGCAGGAGGGTGG - Intronic
1143778801 17:9218626-9218648 TGGGGGGCGGGGCAGGAGGAAGG - Intronic
1143983316 17:10889737-10889759 TAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1144018614 17:11220687-11220709 GAGAGGGCAGGGCAGGAGGGAGG - Intergenic
1144232263 17:13219903-13219925 AAGGGTGGAGGGCAGGTGGAGGG - Intergenic
1144534776 17:16077508-16077530 GAGAGGGGAGGGGGGGAGGAGGG + Intronic
1144534805 17:16077567-16077589 GAGGGGGGAGGGGAGGGGGAGGG + Intronic
1144659452 17:17058622-17058644 TGGTGAGGAGGCCAGGAGGAGGG - Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144802736 17:17941878-17941900 TACTAGGGAGGGAAGGTGGAAGG + Intronic
1144924001 17:18787615-18787637 TGGTGAGCAGGGCATGAGGAAGG + Intronic
1145961126 17:28887037-28887059 TAGTGGGGAGGGAAGAAGGGAGG + Intronic
1145993306 17:29091943-29091965 CAGTGGGCTGGGCAGGGGGAAGG + Intronic
1146052956 17:29567256-29567278 GAGTGGGGAGGGCACGAGCCGGG + Intronic
1146266706 17:31457721-31457743 CAGAGGGTAGGGCAGCAGGAGGG - Intronic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146399631 17:32492963-32492985 AAGGCTGGAGGGCAGGAGGAGGG - Exonic
1146441157 17:32896368-32896390 AAGTTGGGTGGGCAGGAGGAAGG - Intergenic
1146521179 17:33526761-33526783 TTCTGGGGAGGGGAGGAGAAGGG - Intronic
1146593835 17:34152837-34152859 TAGAGTGGAAGGAAGGAGGAGGG - Intronic
1146792869 17:35762716-35762738 TGGTGGGGTGGGCAGGCGGGTGG - Intronic
1146799491 17:35807249-35807271 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1146916759 17:36682905-36682927 CAGTTGGGAGGGAAGGAGGAAGG - Intergenic
1147388505 17:40095586-40095608 CAGGTGGGAGGGTAGGAGGAGGG + Exonic
1147419096 17:40313220-40313242 TCCTGGGCAGGGCAGGAGGAGGG - Intronic
1147427004 17:40350686-40350708 TTGTGGGGAGGGCAGTGGGGAGG + Intronic
1147492132 17:40879399-40879421 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1147498749 17:40942310-40942332 GAGGGAGGAGGGGAGGAGGAAGG - Intergenic
1147523185 17:41194440-41194462 TAGGGTGGAGGGCAAGAAGAGGG + Intronic
1147575133 17:41594612-41594634 GAGGAGGGAGAGCAGGAGGAAGG + Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147853551 17:43460686-43460708 AATTGGGGAGGGAAGGGGGAAGG + Intergenic
1148216393 17:45835988-45836010 GAGGGGTGAGGGCAGGAGGGAGG + Intergenic
1148354797 17:46968685-46968707 TGGTGGGGAAGGCAGGCAGAGGG - Intronic
1148686133 17:49502212-49502234 GAGGGTGGCGGGCAGGAGGAGGG + Intronic
1148758663 17:49987920-49987942 TAGAGGAGAGGAGAGGAGGAAGG + Intergenic
1148874739 17:50680282-50680304 TGGTGGGGTGGGCAGTGGGAAGG + Intronic
1148937999 17:51180400-51180422 TAGTCGGGGGGGCAGGGGGGTGG - Exonic
1148967106 17:51445304-51445326 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1149294452 17:55249334-55249356 GAGTGGGGAAGGAATGAGGAAGG - Intergenic
1149315130 17:55431857-55431879 GGGAGGGGAGGGCAGGGGGAGGG + Intergenic
1149381339 17:56097089-56097111 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1149578030 17:57727688-57727710 AGGAGGGAAGGGCAGGAGGAGGG + Intergenic
1149596583 17:57868005-57868027 TGGAGGAGAGGGGAGGAGGAAGG + Intronic
1149601550 17:57896135-57896157 TAGTGTGGAGGGCAAGGGCAGGG - Intronic
1149965226 17:61155871-61155893 GAGTGGAGAGGGAAGAAGGAGGG - Intronic
1150423754 17:65060068-65060090 GAGGGTGGAAGGCAGGAGGAGGG + Intergenic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1150542029 17:66111707-66111729 GAGAGGGGAGGGTGGGAGGAGGG + Intronic
1150929862 17:69573039-69573061 GAGAGGGGAGGGGAGGAGAAGGG - Intergenic
1151150955 17:72086462-72086484 TGGTGGGGATGGGAGGAGGAAGG - Intergenic
1151327669 17:73388944-73388966 GAGAGGGGAGGGGAGGGGGAAGG - Intronic
1151383932 17:73743824-73743846 AAGGGGGGAGGGAAGGAAGAGGG - Intergenic
1151408814 17:73907221-73907243 TAGTGGGCAAGGGAGGAGGGAGG + Intergenic
1151443408 17:74148196-74148218 AGGTGGGGAGGGCAGGAGCAGGG - Intergenic
1151520984 17:74629329-74629351 GAGGGGGGAGGGGAGGGGGAGGG + Intergenic
1151544484 17:74784409-74784431 TGGAGGGGAAGGAAGGAGGATGG + Intronic
1151579696 17:74971232-74971254 GAGTGGGGAGGCAGGGAGGAAGG - Intronic
1151625384 17:75272461-75272483 TGATGGGGATGGCAGAAGGAAGG - Intergenic
1151821206 17:76497909-76497931 AAGTGGGCAGTGCAGGAGGTGGG - Intronic
1152026781 17:77815102-77815124 AAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1152139571 17:78528575-78528597 AAGGGGAGAGGGCGGGAGGAGGG + Intronic
1152474714 17:80510478-80510500 AAGTGGGGTGAGCATGAGGAAGG - Intergenic
1152524553 17:80880075-80880097 CAGTGTGGAGGGCAGAGGGAGGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152614692 17:81332389-81332411 CAGCAGGGAGGGCAGGGGGAAGG - Intergenic
1152884920 17:82844171-82844193 TAGTGGGGAGTGGAGGAGTGGGG + Intronic
1152891043 17:82881925-82881947 TAGGAGGGAGGGAGGGAGGAAGG - Intronic
1152933364 17:83121806-83121828 GAGAGGGGATGGCAGCAGGACGG + Intergenic
1153000428 18:450455-450477 TAATGGCCAGAGCAGGAGGAAGG - Intronic
1153045057 18:848354-848376 AAGTGGGAAGTGAAGGAGGAAGG - Intergenic
1153101322 18:1473219-1473241 GAGTGGGGAGGGAGAGAGGAAGG + Intergenic
1153262258 18:3236011-3236033 GACTGGGGAGGGCAGGAAGTAGG + Intergenic
1153284343 18:3444444-3444466 GAGTGAGGAGGGTGGGAGGAGGG - Intronic
1153330379 18:3867470-3867492 GGGTGGGGAAGGAAGGAGGAGGG + Intronic
1153339922 18:3963095-3963117 TTGTGGGGAGAGCAGGATGGGGG + Intronic
1153399908 18:4672523-4672545 GAGTGTGGAGGGTAGGAGGAAGG + Intergenic
1153537486 18:6117521-6117543 TTGGTAGGAGGGCAGGAGGATGG + Intronic
1153572347 18:6486013-6486035 TGTCGGGGAGGGAAGGAGGAAGG - Intergenic
1153723789 18:7935811-7935833 TAGGGTGGAGGGTGGGAGGAAGG - Intronic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1153951807 18:10064148-10064170 CAGTGGGTAGGTGAGGAGGAAGG - Intergenic
1154294288 18:13135997-13136019 TCGTGGGGAGGGCCTGGGGAAGG + Intergenic
1154505333 18:15033567-15033589 TTGTGGGGAGTAAAGGAGGATGG - Intergenic
1154945292 18:21156931-21156953 TGGTGGGGTAGGCAGGTGGATGG + Intergenic
1155085120 18:22451164-22451186 GAGGGGGGAGGGTGGGAGGAGGG + Intergenic
1155088665 18:22484129-22484151 GGGTGGGGAGAGCAGCAGGAAGG - Intergenic
1155135452 18:22987233-22987255 GAAGGGGGAGGGAAGGAGGAAGG + Intronic
1155334227 18:24748676-24748698 GAGGGAGGAGGGAAGGAGGAAGG - Intergenic
1155334236 18:24748699-24748721 GAGGGAGGAGGGAAGGAGGAAGG - Intergenic
1155334245 18:24748722-24748744 GAGGGAGGAGGGAAGGAGGAAGG - Intergenic
1155630574 18:27887628-27887650 GAGAGGGGAGGGAAAGAGGAGGG - Intergenic
1155709098 18:28853535-28853557 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1155880842 18:31146229-31146251 AAGGTGGGAGGGAAGGAGGAGGG - Intronic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156449954 18:37261254-37261276 GAGTGAGGATGGGAGGAGGAAGG - Intronic
1156482513 18:37445188-37445210 TGGTGGGGAGGGGAGGATGTAGG - Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156843818 18:41639513-41639535 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1156865392 18:41883710-41883732 TAGGGGAGAGGTCAGGGGGATGG + Intergenic
1156920924 18:42521656-42521678 TAATGGGGAGAGGAGGAGAAAGG - Intergenic
1157210629 18:45739242-45739264 GAGTGGGGAGGAGAGTAGGATGG - Exonic
1157279364 18:46335570-46335592 GAGTGGGGAGAGGGGGAGGAGGG - Intronic
1157287944 18:46390125-46390147 GGGTGGGGAGGTCAGGAAGAGGG - Intronic
1157383671 18:47245405-47245427 TAGTGGGTAGGTGAGGAGGCTGG + Intronic
1157583592 18:48787360-48787382 AAGGAAGGAGGGCAGGAGGAAGG + Intronic
1157975981 18:52327438-52327460 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1158004424 18:52655926-52655948 TAATGGAGAGGGCAGGCGGGGGG - Intronic
1158062831 18:53366810-53366832 GAGTGGGCAAGGCCGGAGGATGG - Intronic
1158103826 18:53861492-53861514 AAGAAGGGAGGGCAGAAGGAAGG + Intergenic
1158375299 18:56856797-56856819 TAGGGGAGGAGGCAGGAGGACGG - Intronic
1158500363 18:57995489-57995511 TAGTGGGAAGGGCAGGTGCATGG + Intergenic
1158543081 18:58374467-58374489 CAGTGGGGTGGGGAGGAGGCCGG - Intronic
1158560098 18:58506215-58506237 AAGAGGGGAGGGAGGGAGGAGGG + Intronic
1158566830 18:58561261-58561283 TACTGGGGAGGGTGTGAGGAAGG + Intronic
1158823861 18:61192110-61192132 TAGTTGGGGGGGGAGGAGGGGGG - Intergenic
1158858393 18:61567478-61567500 TGTTGGGGAGGGTGGGAGGAGGG - Intergenic
1159031215 18:63234236-63234258 TATTGGAGGGGGCAGGAGGAGGG - Intronic
1159122147 18:64183539-64183561 AAGCGAGAAGGGCAGGAGGATGG - Intergenic
1159245371 18:65798651-65798673 TTGTGGGGAGGTCAGGAGTAGGG + Intronic
1159273167 18:66180272-66180294 GACTGGGGAGGGTAGGGGGAAGG - Intergenic
1159518036 18:69483032-69483054 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
1159916041 18:74188778-74188800 AGGTGGGGAAGGCTGGAGGAGGG - Intergenic
1159964102 18:74579292-74579314 GAGTGGGGAGAGGAGAAGGAAGG - Intronic
1159973027 18:74676958-74676980 AAGAGGAGAGGGCAGAAGGAGGG - Intronic
1160024743 18:75208563-75208585 GAGGAGGGAGGGCTGGAGGAGGG + Intronic
1160108173 18:75999203-75999225 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1160394509 18:78562113-78562135 CAGTGGGAAGGGCAGAGGGATGG - Intergenic
1160499289 18:79394390-79394412 TGGAGGGGAGGGGAGGGGGAGGG + Intergenic
1160545063 18:79647424-79647446 GAGGGGGGAGGGGAGGGGGAAGG + Intergenic
1160554128 18:79715045-79715067 GAGCTGGGTGGGCAGGAGGAGGG + Exonic
1160695980 19:484744-484766 AGGAGGGGAGAGCAGGAGGAGGG + Intergenic
1160705125 19:525947-525969 CAGAGGGGAGGGGAGGAGGAGGG + Intergenic
1160819840 19:1052686-1052708 TAGGAGGGAGAGGAGGAGGAGGG + Intronic
1161303744 19:3555978-3556000 CTGTTGGGAGGGCAGGAGGCTGG - Intronic
1161318612 19:3630927-3630949 GAGGGGCGGGGGCAGGAGGACGG - Exonic
1161378425 19:3951660-3951682 TGGTGGTGAGGGCGGAAGGAAGG - Intergenic
1161383903 19:3980905-3980927 CACAGGGGAGGGCAGGTGGATGG + Exonic
1161475655 19:4483426-4483448 AAGAGGGGGGGCCAGGAGGAGGG - Intronic
1162013656 19:7832111-7832133 GAGTGGGGAGGGCGGCGGGATGG - Intronic
1162111849 19:8403799-8403821 GGGTGGGGAGGGCGGCAGGATGG + Exonic
1162491033 19:10991788-10991810 TGGCGGGGAGAGCTGGAGGAAGG + Intronic
1162532079 19:11241865-11241887 CATTGGGGAGGGGTGGAGGAAGG + Exonic
1162568440 19:11457208-11457230 GGGTGGGGAGGGCAGGCCGACGG - Intronic
1162745007 19:12793162-12793184 GAGAGGGGAGGGCAGGGGGCGGG - Exonic
1162761518 19:12891412-12891434 GAGTGTGGAGGGAAGGAGGGAGG + Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1163176169 19:15565290-15565312 TAGGGGGGAGGCTAGGATGAGGG - Intergenic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163366801 19:16880021-16880043 GGGTGGGGAGCCCAGGAGGACGG - Exonic
1163378505 19:16948944-16948966 GAGGGGGGAGGGGAGGGGGAGGG + Intronic
1163566136 19:18052287-18052309 AGGTGGGGAGGGGAGGAGGGGGG + Intergenic
1163625948 19:18389772-18389794 AAGTGGGGAGAGCAACAGGATGG - Intergenic
1164063155 19:21692708-21692730 TATTTGGGAGGGCAAGAGCAGGG + Intergenic
1164757386 19:30700328-30700350 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
1165148812 19:33749377-33749399 GAGGGGGGATGGTAGGAGGATGG - Intronic
1165149673 19:33753480-33753502 GAGGGGGGATGGTAGGAGGATGG - Intronic
1165149860 19:33753965-33753987 GAGGGGGGATGGTAGGAGGATGG - Intronic
1165643379 19:37409761-37409783 GAGTGAGGAGGACAGGAAGATGG + Intergenic
1165670273 19:37672399-37672421 TAGGGGGGAGGGATGGAGGGAGG + Intronic
1165895710 19:39139689-39139711 TTGGGGAGTGGGCAGGAGGATGG - Intronic
1166154385 19:40899944-40899966 CACAGGGGAGGGCAGAAGGAAGG - Intergenic
1166173730 19:41050638-41050660 CACAGGGGAGGGCAGAAGGAAGG + Intergenic
1166181731 19:41113542-41113564 TGCTCAGGAGGGCAGGAGGAGGG + Intergenic
1166329594 19:42070250-42070272 GAGGAGGGCGGGCAGGAGGAAGG + Intronic
1166331678 19:42081384-42081406 TGGTGGGGATGGGAAGAGGAAGG - Exonic
1166334358 19:42096245-42096267 TGGTGGGGTGGGCAGGTGGGTGG + Intronic
1166349477 19:42188738-42188760 AAGAAGGGAGGGAAGGAGGAAGG + Intronic
1166361758 19:42255437-42255459 CAGTGGGCAGGAGAGGAGGAGGG - Intergenic
1166375174 19:42323894-42323916 GAGTGCGAAAGGCAGGAGGAGGG - Intronic
1166559116 19:43720133-43720155 CACTGGGGAGGGGAGGAGGGAGG + Intergenic
1166681603 19:44771050-44771072 AAGTGGGGAGGGAAGAAGGGAGG - Intergenic
1166810160 19:45509501-45509523 TGGTGGGGAGGACAGGGGGCCGG - Intronic
1166935325 19:46329186-46329208 TCCTGCGGAGGGCAGGAGGGAGG - Exonic
1166944700 19:46389860-46389882 GAATGGGAGGGGCAGGAGGATGG - Intronic
1166959364 19:46488496-46488518 TAGAGAGGAGGGCAGGATGAAGG - Intronic
1167564181 19:50246029-50246051 AAGGAGGGAGGGCAGGAGGAAGG - Intronic
1167571736 19:50292894-50292916 TGGTGAGGGGGGCCGGAGGAGGG + Intronic
1167617240 19:50542173-50542195 TAAAAGGGAGGGAAGGAGGAAGG + Intronic
1167792160 19:51689435-51689457 TGGCGGGGACGGCGGGAGGAAGG + Intergenic
1167796967 19:51715872-51715894 CAGTGGGGAGTGAAGTAGGAAGG - Intronic
1167848087 19:52180926-52180948 TACTCAGGAGGGCAGGAGAATGG + Intergenic
1167992736 19:53374210-53374232 GAGTGGGGAGAGTGGGAGGAAGG - Intronic
1168101751 19:54145065-54145087 TTGAGGGGAGGGCAGGAGCGAGG + Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168345165 19:55647109-55647131 AAGTGGGGAGGGGAGGATCATGG + Intronic
1168357862 19:55713627-55713649 GAGAGGGGAGAGGAGGAGGAGGG - Intronic
1168380099 19:55913097-55913119 TGGTGGGGAGGGCAGGGGTTGGG - Exonic
1168402150 19:56091598-56091620 GAGTGGGGAAGGCAGGAGGTGGG + Intronic
1168411224 19:56141472-56141494 TTGCGGGGAGGGGAGGAGAAGGG + Intronic
1168543510 19:57231686-57231708 GAGAGGGGAGGGAAGGAGAAGGG - Intronic
924959617 2:22243-22265 GAGGGGGGAGGGCGGGAGAAGGG - Intergenic
925100341 2:1238868-1238890 TGGTGGGCAGGGCAGGGGCAGGG - Intronic
925315761 2:2921914-2921936 CGGTGGGGAGGGAAGTAGGAAGG + Intergenic
925348704 2:3187445-3187467 TGGTGGGGGGGGCATGGGGAGGG - Intergenic
925348760 2:3187569-3187591 TGGTGGGGAGGCCATGGGGAGGG - Intergenic
925355532 2:3238567-3238589 CAGTGGGGAGACCAGAAGGAAGG - Intronic
925418379 2:3690280-3690302 GAGGGGGGAGGGGAGGGGGAGGG - Intronic
925418394 2:3690303-3690325 GAGGGGGGAGGGGAGGGGGAGGG - Intronic
925955843 2:8963127-8963149 TACTGGGGAGGTGAGGTGGAAGG + Intronic
926464735 2:13174458-13174480 TAGTTGGGAGGGAAAGAGGTGGG - Intergenic
926633858 2:15160591-15160613 GAGGGGGGGGGGCAGGAGGCTGG + Intergenic
926683586 2:15681147-15681169 GAGGGGGGAGGGGAGGGGGAGGG + Intergenic
926687987 2:15712929-15712951 CAGTGGGCAGGGGAGAAGGAAGG - Intronic
926832605 2:16979813-16979835 TAGTGAGGAGGGCGAGATGAAGG + Intergenic
927038377 2:19203996-19204018 TATGGGTGGGGGCAGGAGGAAGG - Intergenic
927172225 2:20379767-20379789 TTGTGGGGTGGGCAGGGGGAGGG - Intergenic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927384971 2:22522219-22522241 GACGGGGGAGGGTAGGAGGAGGG + Intergenic
927739244 2:25552672-25552694 CAATGGGCAGGGCAGGCGGAAGG - Intronic
927744817 2:25608928-25608950 TAGTGGGGATGGCAGCAGTAGGG + Intronic
928250804 2:29677205-29677227 AAGAAGGGAGGGAAGGAGGAAGG - Intronic
928280069 2:29938147-29938169 GAGAAGGGAGGGCAGGGGGAAGG + Intergenic
928372429 2:30750305-30750327 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
928448139 2:31351105-31351127 TAGGGGTGAGGGCTGGAGGGAGG - Intronic
928754206 2:34504216-34504238 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
929023409 2:37576188-37576210 GAGAGGGGAGGGTGGGAGGAGGG - Intergenic
929032861 2:37664909-37664931 GAGGGGGAAGGGCGGGAGGAGGG + Intronic
929434098 2:41914125-41914147 TAGAGGTGAGTGGAGGAGGATGG - Intergenic
929969893 2:46565016-46565038 TAGTGTGGAGGAGAGGAGGTGGG + Intronic
929969921 2:46565171-46565193 TAGTGGGAGGGGCAGGAGTGGGG + Intronic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930088137 2:47512764-47512786 GGTTGGGGAGGGCAGGAAGAGGG + Intronic
930233326 2:48864880-48864902 GTGTGGGGAGGACAGAAGGATGG + Intergenic
930235649 2:48886541-48886563 GAGTGGGGAGGGTAGGAGGAGGG + Intergenic
930365619 2:50435802-50435824 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
930394561 2:50804715-50804737 TAGTGAGGAGGGAATTAGGAAGG - Intronic
930428236 2:51239057-51239079 AAGTAGAGAGGGAAGGAGGAAGG - Intergenic
930570824 2:53084638-53084660 TGGTGGGAAGGGTAGGAGGAAGG + Intergenic
930736077 2:54779887-54779909 TAGTAAGGAAGGCAGGAGGGAGG + Intronic
930807591 2:55506796-55506818 GAGGCAGGAGGGCAGGAGGATGG - Intergenic
930826348 2:55700339-55700361 GAGAGGGGAGGGGAGGGGGAGGG - Intergenic
931124570 2:59260263-59260285 CAGTGTGGAGGTCAGGAGTAGGG + Intergenic
931316608 2:61139036-61139058 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
931661769 2:64571605-64571627 TATTGGGGAAGGGAGGAGGCAGG + Intronic
931918479 2:66985895-66985917 TATTGGGAAGAGCAGGAGAAAGG + Intergenic
931983017 2:67714392-67714414 GAGAGTGGAGGGTAGGAGGAGGG - Intergenic
932087256 2:68773500-68773522 AAGTGGGGAAGGCAGGAGGAAGG + Intronic
932136173 2:69230948-69230970 GAGTGGGGAAGGTAGGAGGAGGG - Intronic
932465916 2:71924020-71924042 TATGGTGGAGGGGAGGAGGATGG + Intergenic
932493730 2:72136548-72136570 AAGGAGGGAGGGCAGGAGGCCGG + Intronic
932661749 2:73660529-73660551 TAGATGGGAGGAAAGGAGGAGGG - Intergenic
932689065 2:73897066-73897088 GGGTGGGGAAGGCAGGGGGAAGG - Exonic
932695198 2:73950543-73950565 GAATGGGGAGGGCAGGAGAATGG - Intronic
933167901 2:79095493-79095515 AGGTGGGAAGGACAGGAGGAGGG + Intergenic
933234511 2:79850283-79850305 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
933286437 2:80389410-80389432 TAGTGAGGAGGGAGGAAGGAAGG - Intronic
933432542 2:82202047-82202069 TAGTGAGAAAGGCAGGAGAATGG + Intergenic
933554371 2:83813441-83813463 GAGAAGGGATGGCAGGAGGAAGG - Intergenic
933669260 2:84991245-84991267 ACATGGGGAAGGCAGGAGGAAGG + Intronic
933684584 2:85133373-85133395 GAGCGGGGAGGGAGGGAGGAGGG - Intergenic
933728745 2:85441190-85441212 AAGAGGGGAGGGTGGGAGGAGGG + Intergenic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
934174133 2:89564305-89564327 TAGAGGGGAGGGGATGGGGAGGG - Intergenic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934284449 2:91638654-91638676 TAGAGGGGAGGGGATGGGGAGGG - Intergenic
934298936 2:91765537-91765559 TTGTGTGGAGGGCAGGGGCAGGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
934710504 2:96511120-96511142 TTGTGGGGAGGGGGGCAGGAAGG + Intergenic
935014168 2:99164305-99164327 GAGTGGAGAGGGGAGGAGGGGGG - Intronic
935074705 2:99729761-99729783 TGGTGGGGCGGGCAGGGGGCGGG - Intronic
935098363 2:99968799-99968821 TAAAGGGAAAGGCAGGAGGAAGG - Intronic
935308422 2:101759684-101759706 GAATGGGGAGGGGAGGGGGAGGG - Intronic
935384577 2:102487043-102487065 TGTTGGGGAGGGCAGGAGTCTGG + Intronic
935558646 2:104538198-104538220 AAGTGGGGAGGGAAGAAGAAGGG + Intergenic
935704986 2:105848689-105848711 TACTGGGGAGGGGTAGAGGAAGG - Intronic
935717623 2:105952954-105952976 GGGTGAGGAAGGCAGGAGGAAGG - Intergenic
935744762 2:106180829-106180851 AAGTTGGGAGGAGAGGAGGAAGG - Intronic
935847715 2:107184834-107184856 AAGGGAGAAGGGCAGGAGGAAGG + Intergenic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
935980859 2:108625481-108625503 GAGTGAGGAGGGCAGAAGCATGG - Intronic
936015851 2:108958552-108958574 CAGTAGAGAGGGCAGAAGGACGG + Intronic
936118553 2:109722065-109722087 GAGTGGGGTGGAGAGGAGGATGG + Intergenic
936342981 2:111654053-111654075 TAGGAGGGAGGGCAGAGGGAAGG - Intergenic
936449813 2:112625686-112625708 GGGTGGGGTGGGCAGCAGGAAGG - Intergenic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937227655 2:120378949-120378971 TAGAGGGGAGGGGCGGAGGGAGG + Intergenic
937308179 2:120884948-120884970 TAGTGGGGAAAGCAGGAGTGAGG - Intronic
937360074 2:121223578-121223600 TTGTGGGGAGGTTAGGGGGATGG - Exonic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937718802 2:125066374-125066396 GAGAGGGGAGAGTAGGAGGAGGG - Intergenic
937814081 2:126231736-126231758 AAGAGGGGAGAGGAGGAGGAGGG - Intergenic
937908448 2:127064087-127064109 AAGAGGGGTGGGCAGGAGGTGGG - Intronic
937946058 2:127338475-127338497 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
937993941 2:127679325-127679347 AAGTGGGGAGGGGAAGGGGAGGG + Intronic
938124878 2:128664441-128664463 AAGAGGGGAGGGGAGGGGGATGG - Intergenic
938143272 2:128813223-128813245 AAGTTGGGAGGGAAGCAGGAGGG - Intergenic
938393162 2:130921021-130921043 TAGTGGGTAGGGCAGGGAGGAGG - Intronic
938395018 2:130939046-130939068 GAGGGTGGAGGGCAGGAGGAGGG - Intronic
938516114 2:132009431-132009453 AAGTGAGGAAGGAAGGAGGAAGG - Intergenic
938539210 2:132272765-132272787 TTGGGGGGAGGGGGGGAGGAGGG - Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938736530 2:134191448-134191470 TGGTGGGGGGGGTAGGGGGAGGG - Intronic
938771020 2:134500815-134500837 GACTGGGGAGGGGAGGGGGAAGG + Intronic
939048561 2:137279650-137279672 GATTGGGGAAGGGAGGAGGAAGG + Intronic
939236644 2:139502773-139502795 GAATGGGGAGGGTAGAAGGAGGG + Intergenic
939294165 2:140237166-140237188 GGGTGGAGAGGGGAGGAGGAAGG - Intronic
939482630 2:142769022-142769044 TAGTGGGGAGGGTAGTGGGGAGG - Intergenic
939522335 2:143246658-143246680 TGGAGGAGAGGGCAGGTGGAGGG + Intronic
939995028 2:148911964-148911986 AAGAGGGAGGGGCAGGAGGAAGG - Intronic
940220646 2:151347875-151347897 GAGTGCCGAGGGAAGGAGGATGG + Intergenic
940546611 2:155096787-155096809 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
941067507 2:160919926-160919948 CAGTGGTGATGGCAGCAGGATGG + Intergenic
941110573 2:161415898-161415920 TAGAGCGGAGGGGCGGAGGAGGG - Intergenic
941282287 2:163567934-163567956 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
941338602 2:164276735-164276757 AAGAGGGGAGGGAAGGAGAAAGG + Intergenic
941811574 2:169760727-169760749 TAGGGTGGAGGGTTGGAGGAGGG + Intronic
941846020 2:170133910-170133932 TGGTGGGGGGAGCAGGAGGAGGG + Intergenic
942085247 2:172437542-172437564 TTGGGGGCAGGGCAGGAGTATGG + Intronic
942138062 2:172948802-172948824 TAGGGTAGAGGGTAGGAGGAGGG + Intronic
942512996 2:176722687-176722709 CAGTGGGGATGGCAGGTGGGAGG + Intergenic
942570914 2:177313413-177313435 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
943532666 2:189103884-189103906 TAGGAGGAAGGGAAGGAGGAAGG - Intronic
943729094 2:191282807-191282829 AAGTAGGGAAGGAAGGAGGAGGG + Intronic
944059664 2:195559173-195559195 AAGTGGGGAGGGCATCAGGAGGG + Intergenic
944089305 2:195887827-195887849 CACTGGGGAGGGGAAGAGGAGGG - Intronic
944229771 2:197380911-197380933 TAGGTGGGAGAGAAGGAGGACGG + Intergenic
944438997 2:199723106-199723128 TATTGGTGGGGGCAGGGGGAGGG - Intergenic
944440548 2:199739264-199739286 TAGAGGGTAGGGAAAGAGGAAGG - Intergenic
944676662 2:202038659-202038681 TAGTGGGGTGGTGTGGAGGAAGG - Intergenic
944734060 2:202545204-202545226 GTGTGGGGAGGGGAGGGGGACGG - Intronic
944989755 2:205221952-205221974 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
945035042 2:205697345-205697367 TAGTTGGGTGGGTAGGGGGAGGG + Intronic
945183245 2:207113382-207113404 TAGTTGAGAAGGCAGGATGAGGG + Intronic
945183253 2:207113473-207113495 CAGTGGGGAGGGGAGGAAAAGGG - Intronic
945323752 2:208458590-208458612 GAGGGGGGAAGGTAGGAGGAGGG - Intronic
945818030 2:214629559-214629581 TACTGGGGAGGTCTGGAGTAGGG + Intergenic
945974924 2:216263019-216263041 TAGTGCTGAGGACAGGAGTAGGG + Intronic
946045820 2:216820064-216820086 GTGTGGGGTGGGCAGGATGATGG + Intergenic
946187729 2:217990743-217990765 TGGTGGGCATGGCAGGTGGAGGG - Intronic
946196355 2:218034804-218034826 GAGTGGGGAGGGGAGGTCGAGGG - Intergenic
946200614 2:218068859-218068881 GAGTGGGGAGGGCAGGGCGAGGG - Intronic
946241340 2:218357770-218357792 TGGAGGGGAGGGTTGGAGGAAGG - Intronic
946357501 2:219197508-219197530 GGGTGGGGAGGACAGGGGGAAGG - Intronic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
946975421 2:225142880-225142902 TTGGGGGGTGGGCAGGAGAAGGG + Intergenic
947029988 2:225782809-225782831 AAGCGGGGAGGGGAGAAGGACGG - Intergenic
947367314 2:229410019-229410041 TGGTGAGGAGGGCAGGAAGAGGG - Intronic
947473847 2:230424013-230424035 TAGTAGAGAGGGTAGGAGCAGGG + Intronic
947652372 2:231797789-231797811 TAGTGGGGAAAATAGGAGGAGGG + Intronic
947661192 2:231869954-231869976 GAGGGGGGAGGGAAGGAGGGAGG - Intergenic
947774510 2:232697237-232697259 GAGTGGGGAGGGAAGCGGGAAGG + Intergenic
947808312 2:232983342-232983364 GAGCGGTGAGGGAAGGAGGAGGG + Intronic
948229214 2:236337352-236337374 GTGTGGGCTGGGCAGGAGGAGGG - Intronic
948534440 2:238635542-238635564 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
948593414 2:239065165-239065187 TTGTGGGGCGGGCAGAGGGATGG - Intronic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948777006 2:240294419-240294441 CAGTTGGGGAGGCAGGAGGAGGG - Intergenic
948796674 2:240406494-240406516 TTTTGGAGGGGGCAGGAGGAAGG - Intergenic
948815914 2:240510264-240510286 TGGGGAGGAGGGCAGGAGGCAGG - Intronic
948835733 2:240625164-240625186 AAGTGGGCTGGGGAGGAGGAAGG + Intronic
948922619 2:241072836-241072858 TGGGGGCGAGGGCATGAGGAAGG + Intronic
949032348 2:241803056-241803078 CCGTGGGCAGAGCAGGAGGAGGG - Intronic
949085694 2:242152708-242152730 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1168742629 20:206063-206085 GAGGGTGGAGGGCGGGAGGAGGG + Intergenic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1169073553 20:2748678-2748700 TGGAGGGGAGGGGAGGGGGAAGG + Intronic
1169118288 20:3081310-3081332 CAGGAGGGAGTGCAGGAGGAGGG - Intergenic
1169209935 20:3760199-3760221 GAGTGGGGAGGGCAGGGGTCAGG + Intronic
1169241022 20:3980964-3980986 TGTTGGGGGGGGCAGGGGGAGGG + Intronic
1169241620 20:3986265-3986287 GAGTGAGGAGGGAGGGAGGAAGG - Intronic
1169365173 20:4986220-4986242 CAGAGGCGGGGGCAGGAGGATGG + Intronic
1170134823 20:13061383-13061405 TGGTGGAGGGGGCAGGTGGATGG - Intronic
1170171577 20:13419301-13419323 GAGGGAGGAGGGCATGAGGATGG + Intronic
1170562467 20:17569576-17569598 TAGTTGGGGGAGGAGGAGGATGG - Intergenic
1170759069 20:19233505-19233527 TAGGAAGGAGGGGAGGAGGAAGG + Intronic
1170796637 20:19553026-19553048 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1170857857 20:20074025-20074047 CATTCGTGAGGGCAGGAGGAAGG + Intronic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1171118881 20:22550941-22550963 CAGTGGGGAGGGAAGGTGAAGGG - Intergenic
1171202663 20:23254627-23254649 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1171356413 20:24549217-24549239 GAGTGGGCAGAGTAGGAGGAAGG - Intronic
1171872063 20:30536452-30536474 TAGGGTGGAGGGAAGGGGGAGGG - Intergenic
1171878255 20:30598147-30598169 AGGGGAGGAGGGCAGGAGGAGGG - Intergenic
1171936919 20:31283527-31283549 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1171976161 20:31596039-31596061 TAGTGGGCAGGGGAGGAGTTTGG + Intergenic
1172053897 20:32140852-32140874 TTCTGGGGAGGCCAGGAGCATGG + Intronic
1172128353 20:32638852-32638874 TTGCCGGGAGCGCAGGAGGAGGG - Intergenic
1172334468 20:34102844-34102866 TAGGAGGGAGGGTAGGTGGATGG - Intronic
1172343182 20:34175505-34175527 GGGTGTGGAAGGCAGGAGGAGGG + Intergenic
1172523581 20:35584243-35584265 TAGGGTGGAGGGTAGGAAGAGGG - Intergenic
1172729979 20:37078880-37078902 TTGGGGGGCGGGCAGGGGGAAGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172782590 20:37446063-37446085 TAGTGCGGAGGCCAGGTGAATGG + Intergenic
1172874246 20:38154735-38154757 TTGGGGGGAGGGCTGGGGGAGGG - Intronic
1173059622 20:39648758-39648780 GAATGGGGAGGGTAGGAGGGAGG + Intergenic
1173133978 20:40422945-40422967 AAGGGGGGAGGGAAAGAGGAAGG + Intergenic
1173288989 20:41697877-41697899 TAGTGGGCAAGGGAAGAGGAGGG - Intergenic
1173388249 20:42608447-42608469 TTTGGGGCAGGGCAGGAGGAAGG + Intronic
1174305086 20:49609340-49609362 GAGTGGAGAGGGGAGGAGGTAGG + Intergenic
1174819105 20:53712139-53712161 AAGTAGGGAGGGAAGAAGGAAGG - Intergenic
1175050155 20:56147912-56147934 CAGTGGGGACGGAAGGGGGACGG - Intergenic
1175059626 20:56230355-56230377 GAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175229569 20:57465252-57465274 TGGTCTGGAGGGCAGCAGGAAGG - Intergenic
1175282348 20:57812454-57812476 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1175293685 20:57894701-57894723 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1175411201 20:58770685-58770707 TCGTGGGGTGGGCAGGATCATGG - Intergenic
1175576034 20:60061402-60061424 TAGTGGGTAGGGGAAGAGGAGGG + Intronic
1175607488 20:60322878-60322900 TAGTTTGGAAGGCAAGAGGAAGG - Intergenic
1175784404 20:61703517-61703539 TAGTGGGGAAGGAAGGAGTGAGG + Intronic
1175807586 20:61838299-61838321 TGGAGGGGAAGGCAGGAGGTGGG + Intronic
1175813340 20:61870536-61870558 TGGTGGGGGTGGCAGGATGATGG - Intronic
1175872977 20:62217077-62217099 CAGTGGGGAGGGTTAGAGGAAGG - Intronic
1175986518 20:62766649-62766671 GAGGAGGGCGGGCAGGAGGAGGG - Intergenic
1176057120 20:63154780-63154802 AAGAGGAGAGGGGAGGAGGAGGG - Intergenic
1176343357 21:5718400-5718422 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1176384017 21:6127998-6128020 GAGAGAGGAGGGAAGGAGGAGGG + Intergenic
1176385465 21:6136821-6136843 GCGTGGAGAGGGCAGGAGGGCGG - Intergenic
1176501470 21:7606056-7606078 TAGGGGGAAGGGCATGGGGAAGG + Intergenic
1176537678 21:8116469-8116491 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1176792518 21:13335533-13335555 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1177206793 21:18019335-18019357 TAGTGGGGAGGAAGTGAGGATGG + Intronic
1177309539 21:19371823-19371845 AAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1177477076 21:21637246-21637268 GACTGGGGAGGGTAGGAGGAAGG - Intergenic
1177617738 21:23545942-23545964 TAGAGGGGAGGGTAGGAAGGGGG + Intergenic
1177658548 21:24052041-24052063 TGGGGTGGAGGGCAGGGGGAGGG - Intergenic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1177991920 21:28046407-28046429 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1178516080 21:33248375-33248397 TAGGGGGGAGGGAGGGAGGGGGG + Intronic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1178689762 21:34741182-34741204 GTGTGGGGAGTTCAGGAGGATGG + Intergenic
1179030131 21:37712800-37712822 TAGTTGGGTGGGGAGGAGGAAGG - Intronic
1179032840 21:37735490-37735512 CAGTGAGAAGGGCTGGAGGAGGG - Intronic
1179102730 21:38368758-38368780 GAGCGGGGAGGGTGGGAGGAGGG - Intergenic
1179315647 21:40241996-40242018 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1179318356 21:40267024-40267046 AAGTGGGGAGGGTGGGAGGGAGG + Intronic
1179370811 21:40804611-40804633 AAGTGGGCAGGGCAGGAGGCAGG - Intronic
1179388926 21:40969826-40969848 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1179411316 21:41165782-41165804 TAGGGGTGAGGTCAGGAGGGTGG + Intergenic
1179583795 21:42362026-42362048 CAGTGGGGTGTGCAGTAGGACGG - Intergenic
1179583804 21:42362066-42362088 CAGTGGGGTGTGCAGTAGGACGG - Intergenic
1179682348 21:43032305-43032327 GGGTGGTGAGGGAAGGAGGAAGG - Exonic
1179714297 21:43279870-43279892 AAGTGTCGAGGGCAGGTGGAGGG + Intergenic
1179714304 21:43279886-43279908 TGGAGGGGAGGGGAGGTGGAAGG + Intergenic
1179714414 21:43280149-43280171 TGGAGGGGAGGGGAGGTGGAGGG + Intergenic
1179714422 21:43280165-43280187 TGGAGGGGAGGGGAGGTGGAGGG + Intergenic
1179714430 21:43280181-43280203 TGGAGGGGAGGGGAGGTGGAGGG + Intergenic
1179714438 21:43280197-43280219 TGGAGGGGAGGGGAGGTGGAGGG + Intergenic
1179714477 21:43280286-43280308 TAGAGGGAAGGGGAGGTGGAGGG + Intergenic
1179714652 21:43280688-43280710 TGGAGGGGAGGGGAGGTGGAGGG + Intergenic
1179714688 21:43280770-43280792 TGGCGGGGAGGGGAGGTGGAGGG + Intergenic
1179714695 21:43280786-43280808 TGGAGGGGAGGGAAGGTGGAGGG + Intergenic
1179738008 21:43401431-43401453 GCGTGGAGAGGGCAGGAGGGCGG + Intergenic
1179739457 21:43410240-43410262 GAGAGAGGAGGGAAGGAGGAGGG - Intergenic
1179919052 21:44497448-44497470 GAGAGGAGAGGGCAGGGGGAAGG - Intergenic
1179955732 21:44737182-44737204 TGGGGTGGAGGGCAGGGGGAGGG + Intergenic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1180129266 21:45816482-45816504 GAGGGGGAAGGGGAGGAGGAGGG - Intronic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1180898061 22:19351820-19351842 TTGAGGGGAGGTCAGGAGGGTGG + Intronic
1180898905 22:19356955-19356977 GATCGGGGATGGCAGGAGGATGG + Exonic
1180923818 22:19538274-19538296 GAGGGGGGAGGGAAGGAGGAAGG + Intergenic
1180956692 22:19744442-19744464 GAATGGGGAGGGCTGGTGGAGGG - Intergenic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181313868 22:21959842-21959864 TAGGGCAGAGGCCAGGAGGACGG - Intronic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181533929 22:23532171-23532193 GAGAGGAGAGGGGAGGAGGAGGG + Intergenic
1181539918 22:23567526-23567548 AAGGGAGGTGGGCAGGAGGAGGG + Intergenic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181582849 22:23837516-23837538 CAGCTGGGAGGGCAGGAAGATGG + Intronic
1181758733 22:25043112-25043134 GGGTGGGGAGGAAAGGAGGAAGG + Intronic
1181902397 22:26167629-26167651 GAGGGTGGAAGGCAGGAGGAGGG + Intergenic
1182048511 22:27295766-27295788 TAGGAGAGAGGGAAGGAGGAAGG + Intergenic
1182103317 22:27672128-27672150 GAGGGGGGAGGGGAGGGGGAGGG + Intergenic
1182107218 22:27698160-27698182 TAGGGCCGAGGGCAGGAGGCAGG - Intergenic
1182581592 22:31315853-31315875 AAGTGGGGAGGGGAAGGGGAAGG + Intergenic
1182669538 22:31984204-31984226 TAGGGAGAAGGGCAGGAGGCTGG + Intergenic
1183025208 22:35060039-35060061 GAGAGTGGAGGGTAGGAGGAGGG + Intergenic
1183033203 22:35120894-35120916 CAGTGAGGAGAGCAGAAGGAGGG + Intergenic
1183129501 22:35820518-35820540 GGTTGGGGAGGGTAGGAGGAAGG - Intronic
1183281061 22:36932935-36932957 CACTGGGGAGGGCGGGAGAAGGG + Intronic
1183432509 22:37774303-37774325 TAGGAGGTAGGGCAGGAAGAGGG - Exonic
1183453809 22:37910728-37910750 AAGTGTTGGGGGCAGGAGGAGGG + Intronic
1183512835 22:38245897-38245919 GAGTGGGGAGGGCTGGCGGGGGG - Intronic
1183731386 22:39620423-39620445 TAGGTGGGTGGGCAGGTGGATGG - Intronic
1183819911 22:40337874-40337896 GACTGGGGTGGGCTGGAGGAAGG - Intergenic
1183902711 22:41018573-41018595 TAGTGGGCACGACAGGTGGATGG + Intergenic
1184041181 22:41945074-41945096 GAGGGTGGAGGGCAGGAAGAAGG - Intronic
1184173402 22:42772555-42772577 GAGAGGGGAGGGGAGGAGAAGGG - Intergenic
1184413429 22:44338617-44338639 CAGTTGGGAGAGCAGGAGCAGGG - Intergenic
1184627524 22:45748240-45748262 TGGTAGGGAGGGTAAGAGGAGGG - Intronic
1184753404 22:46502294-46502316 GGGTGGGGAGGGGAGGAAGAGGG + Intronic
1184855220 22:47142816-47142838 TGGATGGGAGGGTAGGAGGATGG - Intronic
1184856925 22:47151353-47151375 TGCCTGGGAGGGCAGGAGGAAGG - Intronic
1185042782 22:48513965-48513987 GAAAGGGAAGGGCAGGAGGAAGG - Intronic
1185115437 22:48932312-48932334 GAGGGGGGAGGGTAGGAGGAGGG - Intergenic
1185372040 22:50465433-50465455 TGGTGGGAGGGGCAGAAGGATGG - Intronic
1185385734 22:50530652-50530674 GAGTGGGGAGGGCCTGAGGTCGG - Intronic
1203242624 22_KI270733v1_random:32824-32846 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
949321189 3:2812123-2812145 GAGAGTGGAGGGCGGGAGGAGGG + Intronic
949614618 3:5739623-5739645 GAGAGGGGAGGGGAGGAGGAGGG - Intergenic
949810460 3:8001355-8001377 GAGTGGGCAGGTCAGGAGGCAGG - Intergenic
950037779 3:9899533-9899555 CAGCAGGGAGGGAAGGAGGAAGG - Intergenic
950296617 3:11837872-11837894 TGAGGGGGAGGGCAGCAGGAGGG + Intronic
950362377 3:12458884-12458906 TGCTGGGGAGGGCAGAAGGGTGG + Intergenic
950438516 3:12994246-12994268 CGGTGGGGCGGGCAGGAGGGCGG - Intronic
950439471 3:13000722-13000744 TGGAGGGGAGGGCTGAAGGAGGG + Intronic
950557126 3:13702620-13702642 TAGGGGCGGGGGCAGGTGGAAGG + Intergenic
950573750 3:13818257-13818279 AACTGGGGAGGGCAAAAGGATGG + Exonic
950630203 3:14277120-14277142 AAGTGGGGAGGGTGGGGGGAGGG - Intergenic
950665242 3:14491392-14491414 TGGGGGAGAGGGCAGGTGGAAGG + Exonic
950916159 3:16647296-16647318 TAGAGGGGAGGGCAGGAGTGTGG - Intronic
951078581 3:18425371-18425393 GAGGGGGGAGGAGAGGAGGAAGG + Intronic
951499337 3:23366614-23366636 TAGGGTGGAGGGTGGGAGGAGGG + Intronic
951577185 3:24125915-24125937 TGGTGGGGAGTGTAGGAGGCCGG + Intronic
951856203 3:27199958-27199980 GATGGTGGAGGGCAGGAGGAAGG + Intronic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952171578 3:30812856-30812878 TTGGGAGGAGGACAGGAGGAAGG + Intronic
952557775 3:34552934-34552956 AAGGAGGAAGGGCAGGAGGAGGG - Intergenic
952619816 3:35324215-35324237 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
953019583 3:39104999-39105021 GAGTGGGGAGGGAAGTAGGCAGG - Intronic
953141514 3:40233605-40233627 TCTTGGTGAGGGAAGGAGGAAGG - Intronic
953423799 3:42775718-42775740 TAGGGACTAGGGCAGGAGGAGGG - Intronic
953887188 3:46721379-46721401 GATGGGGGAGGGTAGGAGGAGGG + Intronic
954411880 3:50374384-50374406 GGGTGGGGAGGGGAGGGGGAAGG + Intronic
954596223 3:51827286-51827308 TAGAGAGGAGAGCAGAAGGATGG + Exonic
954639028 3:52087097-52087119 GAGTGGGGCGGGCAGTAGGAGGG + Intronic
954705745 3:52479640-52479662 TGGTGAGCATGGCAGGAGGATGG - Intronic
954755902 3:52839678-52839700 TGATGGGGAGGGAAGGAGGATGG - Exonic
955021565 3:55126635-55126657 TAGTGGGGAAGGGAGGAAGAAGG + Intergenic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955220455 3:57019105-57019127 TAGGCTGGAGGCCAGGAGGATGG - Intronic
955353097 3:58208590-58208612 TTGTGGGGAGGTCATGAGCAAGG - Intronic
955386800 3:58487090-58487112 GAGAGGAGAGGGGAGGAGGAAGG + Intergenic
955988949 3:64604185-64604207 AAATGGGGAGGGCAGGATGGGGG - Intronic
956084662 3:65597179-65597201 CAGTGTGGAGGGCAGGGGAAGGG - Intronic
956159671 3:66335895-66335917 TGGTGGGGAGGGAAGGAGGGAGG + Intronic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
956603266 3:71046106-71046128 AAGGTGGGAGGGAAGGAGGAAGG - Intronic
956940596 3:74157104-74157126 TTGTGGGGTGGGGAGGGGGAGGG - Intergenic
956960925 3:74399822-74399844 GGCTGGGAAGGGCAGGAGGAAGG - Intronic
957073223 3:75581451-75581473 GACTGGGGAGGCCGGGAGGAAGG + Intergenic
957159911 3:76597685-76597707 AAGCGGGGAGGGTGGGAGGAGGG - Intronic
957196284 3:77072370-77072392 TAGTGTGGGCGGCAGGAGGAGGG - Intronic
957566459 3:81890533-81890555 TTGTGGGAAGTGCAAGAGGAAGG + Intergenic
957889711 3:86340709-86340731 TAGTGGGGTGGGGAGGCAGAAGG - Intergenic
958026877 3:88059210-88059232 TAGGGAGGAGGGAAGGGGGAGGG + Intronic
958069497 3:88591889-88591911 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
959083301 3:101825145-101825167 GAGGGTGGAGGGTAGGAGGAGGG - Exonic
959129154 3:102331357-102331379 TAGTGGGGAGGGCAGGAGGAAGG - Intronic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959286757 3:104424009-104424031 TGCTGGGGTGGGCAGTAGGATGG + Intergenic
959370229 3:105514731-105514753 AAGTGGTGGGGGGAGGAGGAAGG + Intronic
959991750 3:112638828-112638850 TTGTGGCTGGGGCAGGAGGAAGG + Exonic
960061212 3:113323465-113323487 GAGTGGTGAGGGAAGGAGGGGGG + Intronic
960236030 3:115283189-115283211 TAGTGGATAGAGCAGGAGAAGGG - Intergenic
960311380 3:116120408-116120430 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
960766619 3:121137076-121137098 TAGGGTGGAGGGTGGGAGGAGGG + Intronic
960970926 3:123139621-123139643 TAGTGGGGAGGAGAGGAGAGGGG + Intronic
961026251 3:123560530-123560552 TGGTGGTGATGGCAGGGGGATGG - Intronic
961130808 3:124465811-124465833 TGGGAGGGAGAGCAGGAGGAAGG + Intronic
961788394 3:129360924-129360946 TAATGGGGAAGGTTGGAGGAGGG + Intergenic
961940860 3:130636750-130636772 GGGAGGGGAGGGGAGGAGGAAGG - Intronic
961940875 3:130636778-130636800 GGGAGGGGAGGGGAGGAGGAAGG - Intronic
962072211 3:132044687-132044709 GAGGGGGGAGGGGAGGGGGAGGG + Intronic
962222205 3:133573625-133573647 GAGTGGGGAGGGGAGGGAGAGGG - Intergenic
962367072 3:134793825-134793847 GGGAGGGGAGGGGAGGAGGAAGG + Intronic
962449872 3:135504076-135504098 TTATGGGGAAGGCAGGAGGCTGG + Intergenic
962715092 3:138118897-138118919 TGGGTGGGAGGACAGGAGGATGG + Intergenic
962886379 3:139631807-139631829 TGGTGGTGAGGGCAGTAGGGGGG - Intronic
963010121 3:140760743-140760765 TTGGGGGGTGGGCAAGAGGAGGG - Intergenic
963329531 3:143898733-143898755 GAGAGTAGAGGGCAGGAGGATGG + Intergenic
963685344 3:148426508-148426530 TAGATGGGAGGGAAAGAGGAGGG - Intergenic
963790505 3:149577994-149578016 GTGGGGGGAGGGAAGGAGGAAGG - Intronic
963933843 3:151032582-151032604 GAGGGTGGAGGGCAGAAGGAGGG + Intergenic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
964464998 3:156982256-156982278 CAGTGCTGAGGGCAGCAGGATGG - Intronic
964760133 3:160127609-160127631 TAGTGGGGAAGACAGGAGAATGG + Intergenic
965171795 3:165275062-165275084 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
965182389 3:165420796-165420818 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
965373896 3:167897625-167897647 GAGGGGGGAGGGGAGGAGGGAGG + Intergenic
965373910 3:167897649-167897671 GAGGGGGGAGGGGAGGAGGGAGG + Intergenic
965392185 3:168118514-168118536 TAAGGGGGAGGGTGGGAGGAGGG - Intergenic
966140598 3:176752174-176752196 GGGAGGGGAGGGGAGGAGGAAGG + Intergenic
966140657 3:176752504-176752526 GAGCGGGGAGGGAGGGAGGAAGG + Intergenic
966144485 3:176794274-176794296 CAGTAGGGAGGGCAGTGGGAAGG + Intergenic
966145356 3:176805596-176805618 GAGGGGGGAGGATAGGAGGAGGG + Intergenic
966201151 3:177360239-177360261 TAGTGGGGAGGGCATCTGCAAGG + Intergenic
966490468 3:180522486-180522508 GAATGGGGAGGGCGGGAGGAAGG + Intergenic
966545201 3:181138468-181138490 TAGTGGCGAGGGCAGGAATGTGG - Intergenic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966731828 3:183158099-183158121 GAGTGGGAAGGGCCAGAGGAGGG - Intronic
966830763 3:184006420-184006442 TAGGAAGGAGAGCAGGAGGAAGG - Intronic
966957254 3:184895618-184895640 TGGGGGGGGGGGGAGGAGGAGGG - Intronic
967116483 3:186344590-186344612 GAGTGGGGAGGGTGGGAGGAAGG + Intronic
967459977 3:189734380-189734402 GACTGGAGAGGGCAGGAAGAGGG - Intronic
967563700 3:190948230-190948252 GAGGGTGGAGGGCAGGAGAAGGG - Intergenic
967744999 3:193045389-193045411 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
967826625 3:193882419-193882441 GATTGTGGAGGGAAGGAGGAGGG - Intergenic
967843437 3:194025820-194025842 GAGTGAGGGTGGCAGGAGGAAGG - Intergenic
967870334 3:194224176-194224198 TGGTGTGGAGGGCATGAAGAAGG - Intergenic
967882657 3:194312959-194312981 TGGTGGGAAGGGAAGGAGGGAGG - Intergenic
968005197 3:195237962-195237984 CAGTGGGGAAGGTAGGAGGTAGG - Intronic
968024911 3:195433094-195433116 TAGTGGGTAGTGCAGGGGGTGGG - Intronic
968262343 3:197335404-197335426 AAGAGGGAAGGGAAGGAGGAGGG + Intergenic
968494994 4:910520-910542 TAGCAGAGAGGGCAGCAGGAGGG - Intronic
968590916 4:1459234-1459256 TGGTGGAGAGGGGAGGAGGATGG + Intergenic
968612464 4:1563497-1563519 TTCTGGGCAGGACAGGAGGAAGG - Intergenic
968872074 4:3247255-3247277 TAGTGGGGAGGACATGACTAAGG + Intronic
968881728 4:3303594-3303616 TAGTGGGGGGAACAAGAGGAAGG + Intronic
968890518 4:3366281-3366303 AGGGGTGGAGGGCAGGAGGATGG + Intronic
969110585 4:4841718-4841740 TAGTGGGACGGGGAGGAGGCTGG - Intergenic
969143869 4:5102919-5102941 GAGGGGGGAGGGGAGGAGAAGGG - Intronic
969239292 4:5888507-5888529 GAGAGGCGAGGGCGGGAGGAGGG + Intronic
969550977 4:7867056-7867078 AAGAGGGGAGGGGAGGAGAAGGG + Intronic
969702361 4:8774425-8774447 CAGAGGGGAGGGGCGGAGGAAGG + Intergenic
969827990 4:9773249-9773271 TAGAGGGGAGGGGATGGGGAGGG - Intronic
969965631 4:10992403-10992425 CAGTGGGGAATGAAGGAGGAAGG + Intergenic
970010426 4:11452899-11452921 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
970165726 4:13235861-13235883 AAAAGGGGAGGCCAGGAGGAGGG + Intergenic
970410591 4:15803794-15803816 GAGGAGGGAGGGAAGGAGGAAGG - Intronic
970602299 4:17650132-17650154 TAGTTGGGTGGACAGGTGGAGGG - Intronic
970686807 4:18577927-18577949 GAGAGGGGAGGGGAGGGGGAGGG - Intergenic
970950875 4:21753918-21753940 TGGTGGGGATAGTAGGAGGAGGG - Intronic
971041753 4:22761279-22761301 AAGTGGGGAGAGTTGGAGGATGG - Intergenic
971168054 4:24204506-24204528 GAGAGGGGAGGGCAGGGGAAGGG + Intergenic
971325046 4:25636756-25636778 GGGAGGGGAGGGCAGCAGGAGGG - Intergenic
971839235 4:31812005-31812027 TGGTGGGGGGGCCAGGGGGAGGG + Intergenic
971843169 4:31881027-31881049 AAGGAGGGAGGGAAGGAGGAGGG - Intergenic
971899689 4:32643509-32643531 GAGTGTGGAAGGCAGGAGGAGGG + Intergenic
971920778 4:32936746-32936768 TGGTGGGGAGGGGGGGAGGGGGG - Intergenic
972016102 4:34248358-34248380 GAGTAGGAAGGGAAGGAGGAGGG - Intergenic
972136291 4:35898836-35898858 TAGTTGCAAGGGCAGGAGAAAGG - Intergenic
972146438 4:36032817-36032839 GAGTGTGGAGGGTAAGAGGAGGG - Intronic
972418004 4:38861680-38861702 TAGTAAGGAGGGTAGGAGGATGG - Intergenic
972611132 4:40656665-40656687 TAATTAGCAGGGCAGGAGGAGGG - Intergenic
972824579 4:42742462-42742484 TACTGGTGGGGGAAGGAGGAAGG + Intergenic
972960755 4:44448852-44448874 CCGTGGGGAGGGCGGGAGGAGGG + Intergenic
973088501 4:46100321-46100343 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
973192403 4:47400715-47400737 AAGTGGGGAGGCTGGGAGGAGGG - Intronic
973779143 4:54271976-54271998 GAGGGGGGAGGGGAGGGGGAGGG - Intronic
973866321 4:55117443-55117465 TCTTGTGGAGGGAAGGAGGAGGG + Intronic
974093675 4:57339024-57339046 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
974840265 4:67291306-67291328 TAATGGGGAGAGAAAGAGGAGGG + Intergenic
975139344 4:70903397-70903419 GAGGGGGAAGGGCAGAAGGATGG + Intronic
975149892 4:71008958-71008980 AACTGGGAAGGGTAGGAGGAGGG + Intronic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
975756994 4:77580793-77580815 GAGAGGGGAGGGAAGGAGAAGGG - Intronic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
975892570 4:79046885-79046907 AAGGAGGGAGGGTAGGAGGAAGG - Intergenic
976068394 4:81215248-81215270 AAGAGAGGAGGGAAGGAGGAGGG + Intergenic
976096637 4:81515341-81515363 CAGAGGGGAGGGCAGGAGCCAGG + Intronic
976132299 4:81897551-81897573 AAGGGGGGAGAGGAGGAGGAAGG - Intronic
976245514 4:83002442-83002464 AGGAGGGGAGGGAAGGAGGAAGG + Intronic
976410132 4:84703748-84703770 AAGTGGGGAGAACAGGAGGTTGG - Intronic
976509221 4:85888766-85888788 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
976579500 4:86719120-86719142 GAGTGGGGAGAGTGGGAGGAAGG - Intronic
976616789 4:87086413-87086435 GGGTGGGAAGGGAAGGAGGACGG - Intronic
976713169 4:88094921-88094943 AATTGGGGAGAGAAGGAGGAAGG - Intronic
976744745 4:88391940-88391962 GAGTGGGGAGGGGAGGAAAAGGG - Intronic
976979212 4:91205612-91205634 AAGAAGGGAGGGAAGGAGGAAGG - Intronic
977144025 4:93412739-93412761 TAGTGGGGTAGGCAAGGGGAGGG - Intronic
977151370 4:93516696-93516718 TTTTGGGGAAGGGAGGAGGAGGG + Intronic
977729838 4:100338051-100338073 GAGTGGGGAGGCTGGGAGGAGGG + Intergenic
977738470 4:100446732-100446754 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
977956620 4:103035127-103035149 TAGGGTGGAGGGTGGGAGGAGGG - Intronic
978025079 4:103863606-103863628 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
978563177 4:110054842-110054864 TGGAGTGGAGGGTAGGAGGAGGG + Intronic
979046042 4:115866484-115866506 GAGTGAGGAAGGAAGGAGGAAGG + Intergenic
979174444 4:117645604-117645626 TAGTGTTGAGAGAAGGAGGAAGG - Intergenic
979208476 4:118071403-118071425 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
979226147 4:118287248-118287270 GAGTGGCTAAGGCAGGAGGATGG - Intronic
979295776 4:119031136-119031158 ATGTGGGGAAGGCAGGAGGTTGG - Exonic
979511751 4:121562184-121562206 AAGGGTGGAGGGTAGGAGGAGGG - Intergenic
979766485 4:124470455-124470477 GAAGGGGGAGGGAAGGAGGAAGG - Intergenic
979784435 4:124697826-124697848 AAGTGGGGTGGGGTGGAGGATGG + Intronic
979865066 4:125744137-125744159 AAGTGGGGAGGGAGGAAGGAAGG + Intergenic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980112958 4:128652282-128652304 AAGGTGGGAGGGCAGGAGGGGGG + Intergenic
980200278 4:129648152-129648174 TAGGGGGAAGGGGAAGAGGAGGG + Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980455009 4:133028036-133028058 GAGAGGGGAGGGTGGGAGGAGGG + Intergenic
980544899 4:134246617-134246639 TTGTGGGGAGGGGGGGGGGAGGG - Intergenic
980670415 4:135997216-135997238 GAGGGGAGAGGGTAGGAGGAGGG + Intergenic
981086436 4:140689381-140689403 AAGCGGGGAAGGAAGGAGGAAGG - Intronic
981092114 4:140742747-140742769 GAGTGGGAAAGACAGGAGGAGGG - Intronic
981217247 4:142184811-142184833 TAGAGGGGAGGGAAAGATGATGG + Intronic
981347519 4:143693996-143694018 GAGGGTGGAGGGTAGGAGGAAGG + Intronic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981459905 4:145001034-145001056 TAGGGTGCAGGGCAGGGGGAGGG + Intronic
981536152 4:145801924-145801946 GGGTGGGGAGGGCAGGAAGGTGG + Intronic
981643795 4:146974975-146974997 TGGTGGGGAAGGGAGGAGGGTGG - Intergenic
981721297 4:147804145-147804167 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
982024158 4:151235180-151235202 GAGGGTGGAGGGCGGGAGGAGGG - Intronic
982089708 4:151869642-151869664 TAGTGGTGTAGGCAGCAGGATGG + Intergenic
982169090 4:152643933-152643955 GAGTGGGAGGAGCAGGAGGAAGG - Intronic
983126626 4:163960654-163960676 GAGTGTGGAGGGTGGGAGGAGGG + Intronic
983155643 4:164344223-164344245 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
983535843 4:168855995-168856017 AAGTGGGGAGAGAAGGAGGTGGG - Intronic
983574924 4:169250684-169250706 TAGTGGGGATGGGGGTAGGAGGG + Intronic
983595127 4:169457693-169457715 AAGGGGGGAGGGGAGAAGGAGGG + Intronic
983639448 4:169931128-169931150 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
984149400 4:176108012-176108034 AAGTGGGGAGGGCAGGAGGAAGG - Intronic
984291113 4:177795722-177795744 TGGTGGTGGGGGCGGGAGGAAGG + Intronic
984621306 4:181955603-181955625 TTGTGGGGAGGGGAGGAACAAGG + Intergenic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
984764019 4:183385737-183385759 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
984845771 4:184106759-184106781 TAGCAGGGAGGGCAGGAGTGGGG + Intronic
985010111 4:185573614-185573636 TCCTGGGGATGGCAGGAAGATGG + Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985469117 5:26880-26902 GAGGGGGGAGGGTGGGAGGAGGG - Intergenic
985699341 5:1361121-1361143 GAGGGCAGAGGGCAGGAGGAGGG + Intergenic
985896511 5:2752249-2752271 AAGTGGGGAGGTCAGGATGGTGG + Exonic
986178691 5:5373668-5373690 TAATAGGGAGGGAAGGAGGCTGG - Intergenic
986421552 5:7589536-7589558 AAGGAGGGAGGGAAGGAGGAAGG + Intronic
986520926 5:8617290-8617312 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
986673527 5:10164184-10164206 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
986772595 5:10987664-10987686 GAGTGGGGAGGGGAGGAGAGGGG - Intronic
987702985 5:21425960-21425982 GAGTGGGGAGGGTGGGAGGAAGG - Intergenic
987880433 5:23737262-23737284 GAGTGGGGAGGACAGGAGAGGGG - Intergenic
987905071 5:24066323-24066345 GAGAGTGGAAGGCAGGAGGAGGG - Intronic
988340852 5:29969156-29969178 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
988348533 5:30070632-30070654 AAGTGGGGAGGGTGGGAGGAGGG - Intergenic
988506297 5:31826281-31826303 TGGTGGGGAGGGTAGGAGTGAGG + Intronic
988705811 5:33725013-33725035 AAATGGGGAAGGCAGGGGGAAGG - Intronic
988784669 5:34555442-34555464 TAGTGGAGGGGGCAGGACAAAGG + Intergenic
988801179 5:34698118-34698140 GAGGGGGGAGGGGAGGGGGAGGG - Intronic
988861789 5:35288820-35288842 TAGTGGGGAGTGATGGGGGAAGG - Intergenic
988993246 5:36691535-36691557 CAGTGGGGAGGGTAGAAGTAAGG - Intergenic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
989964574 5:50452739-50452761 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
990000518 5:50886362-50886384 TACTGGGGTGGGAAGGAGCATGG + Intergenic
990275522 5:54191957-54191979 GAGTGGGGGAGGAAGGAGGAAGG - Intronic
990496191 5:56350383-56350405 TAATGGGGAGGAGAGGACGATGG + Intergenic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
990871352 5:60433920-60433942 GAGGGTGGAGGGTAGGAGGAAGG + Intronic
990976801 5:61568006-61568028 AAGGGGGGAGGGAGGGAGGAAGG - Intergenic
991254195 5:64596621-64596643 GAGAGAGGAGGGCAGGAGAAAGG - Intronic
991380356 5:66016543-66016565 TAGTGGGGAGGAAAGAATGAAGG - Intronic
991408092 5:66321054-66321076 GAGTGGGGAGGGGAGGATGAGGG + Intergenic
991598521 5:68329019-68329041 GAGGGCGGAGGGTAGGAGGAGGG + Intergenic
992074263 5:73176448-73176470 AAGAGGAGAGGGCAGGAGGGAGG + Intergenic
992218493 5:74548331-74548353 TGGTGGGGAGGGATAGAGGAAGG + Intergenic
992312129 5:75511604-75511626 TAGTGGGCCAGGCAGGAAGATGG - Intronic
992519755 5:77538446-77538468 TAGTGGGGAGGGAAGAAGAGAGG - Intronic
992564636 5:77985493-77985515 TGGTGGTGGGGGCAGGAGGATGG + Intergenic
992611977 5:78515816-78515838 TATTGGGGAGGGGAGGCTGAAGG + Intronic
993252062 5:85540177-85540199 GAGGTGGGAGTGCAGGAGGAAGG + Intergenic
993350655 5:86845986-86846008 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
993974951 5:94467853-94467875 TAATGGGGAGAGCAGAAGAAAGG + Intronic
994469934 5:100190702-100190724 GAGTGTGGAGGGTGGGAGGAAGG - Intergenic
994511874 5:100714355-100714377 GAGGGCGGAGGGCAGGAGGAGGG - Intergenic
994618865 5:102138796-102138818 GAGTGGGGAGGGTGGGAGAAGGG - Intergenic
995324531 5:110875370-110875392 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
995431057 5:112078093-112078115 CAGTGTGGAGGGTAAGAGGAGGG - Intergenic
995537484 5:113151983-113152005 AAGTGGGGAGGCAAAGAGGAGGG - Intronic
995621883 5:114034708-114034730 AAGGGTGGAGGGCGGGAGGAAGG - Intergenic
995931415 5:117450800-117450822 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
995957715 5:117798935-117798957 GAGAGTGGAGGGTAGGAGGATGG - Intergenic
995982205 5:118117955-118117977 AAGTGGGGAGGGAGGGAGGCAGG - Intergenic
996339218 5:122417717-122417739 AGGTGGGGAGGGAAGGAGGAAGG - Intronic
996681578 5:126233168-126233190 GAGAGGGGAGGGTAGGAGGAGGG + Intergenic
996819511 5:127610990-127611012 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
996898955 5:128521362-128521384 GTCTGGGGAGGGCAGGGGGAGGG + Intronic
996953807 5:129159719-129159741 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
996957156 5:129197233-129197255 CAGTGGGCAGGGAAGGTGGAGGG - Intergenic
996991514 5:129637965-129637987 GAATGGGGAGGGTGGGAGGAGGG + Intronic
997131263 5:131278737-131278759 GAGAGGGGAGGGGAGGGGGAGGG - Intronic
997975340 5:138438788-138438810 GTGTGGGCAGGGCAGGAGGTGGG + Intergenic
998352656 5:141511523-141511545 GAGTGGGGTGGGGAGGAGGGAGG - Exonic
998392061 5:141793572-141793594 GGGTGGGGAGGGGAGGAGGCTGG - Intergenic
998401139 5:141849719-141849741 GGGTGGGGAGGGGCGGAGGAGGG + Intergenic
998490136 5:142539525-142539547 AAGCAGGGAGGGGAGGAGGATGG - Intergenic
999059719 5:148620357-148620379 CAGTGGGGATGGCAGTAGGAAGG + Intronic
999231572 5:150065144-150065166 TGGTGGGGAGGATGGGAGGAAGG - Intronic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999370447 5:151052111-151052133 GAGTGGGGGCTGCAGGAGGAGGG - Intronic
999386579 5:151157861-151157883 TAGAGGGGTGGGGTGGAGGAGGG - Exonic
999593671 5:153177858-153177880 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
999663376 5:153888661-153888683 GAGTGGGGAGGCCAGTAGGGAGG + Intergenic
1000033210 5:157420786-157420808 GAGTGGGAAGGGCAGGAGGGGGG + Intronic
1000147573 5:158468296-158468318 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1000285172 5:159820440-159820462 GGGTGAGGAGGGCAGGGGGAGGG - Intergenic
1000501304 5:162054264-162054286 TACTTGGGAGGTCAGGAGGGAGG + Intergenic
1000521166 5:162296389-162296411 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1000614683 5:163413933-163413955 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1000698184 5:164415596-164415618 GAGAGGGGAGGGTGGGAGGAGGG - Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1001190699 5:169628308-169628330 TAGGGTGGAGGGCAAGGGGAGGG - Intergenic
1001567043 5:172706601-172706623 TGTTGGGGAGAGGAGGAGGAGGG - Intergenic
1002136186 5:177109157-177109179 GTGTGGGGAAGGCAGGAGGAGGG + Intergenic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002255430 5:177954769-177954791 GAGGGGGGAGGGAGGGAGGAGGG + Intergenic
1002269007 5:178057436-178057458 TAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1002324070 5:178394089-178394111 GACCTGGGAGGGCAGGAGGAAGG + Intronic
1002556366 5:180044940-180044962 GAGGGAGGAGGGCAGGACGATGG + Intronic
1002663915 5:180809422-180809444 TAGACAGGAGGGCAGGAGAAAGG - Intronic
1002666967 5:180831979-180832001 TTCTGGGGAGGGGAGGAGGAGGG - Intergenic
1002737831 5:181409576-181409598 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1002766967 6:249610-249632 GGGTGGGGAGGACAGAAGGATGG - Intergenic
1002811908 6:639261-639283 CAGTGGCAAGGGCAGGAGAAGGG - Intronic
1002870675 6:1164878-1164900 TAGTGTGGAGGGAAGGCAGATGG + Intergenic
1002918190 6:1545884-1545906 TTGTGGGCAGGGCAGGAGAGAGG + Intergenic
1003061359 6:2865298-2865320 AAGCGGGGAGGGAGGGAGGAAGG - Intergenic
1003310418 6:4965394-4965416 GAGTGGGAGGGGCAGGAGGGAGG - Intergenic
1003362317 6:5439822-5439844 AGGAAGGGAGGGCAGGAGGAAGG - Intronic
1003393929 6:5736954-5736976 TAGTGTGGAGGGCGAGAGGAAGG - Intronic
1003414820 6:5898386-5898408 AGGGAGGGAGGGCAGGAGGAGGG - Intergenic
1003443439 6:6164335-6164357 GAGTGGGGAGGATGGGAGGAGGG + Intronic
1003961343 6:11211902-11211924 GGATGGGGAGGGCAGGAGGGTGG + Intronic
1004139286 6:13000638-13000660 AAGGGGGGAGGGAGGGAGGAAGG + Intronic
1004303469 6:14478984-14479006 TACAGCGGAGGGTAGGAGGACGG - Intergenic
1004784405 6:18950497-18950519 GAGAGTGGAGGGTAGGAGGAAGG + Intergenic
1004945669 6:20609921-20609943 GAGGATGGAGGGCAGGAGGAGGG - Intronic
1005413685 6:25578355-25578377 AGTTGGGGAGGGGAGGAGGAAGG + Intronic
1005483866 6:26280725-26280747 TAGTGGGAAGGCCGTGAGGAAGG + Intergenic
1005665107 6:28044452-28044474 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1005666525 6:28063085-28063107 TAAAGGGGAGGGGAGAAGGAAGG + Intergenic
1005738520 6:28770746-28770768 TATTTGGGAGGGCTGGAGCAGGG + Intergenic
1005870725 6:29972613-29972635 AAACTGGGAGGGCAGGAGGATGG + Intergenic
1006059066 6:31405696-31405718 TAGTGGGGAGTGGGGGAGCAGGG - Intronic
1006414249 6:33893937-33893959 GGGTGGGGAGGGGAAGAGGAAGG + Intergenic
1006438966 6:34041500-34041522 CGGAGGGGAGGGGAGGAGGATGG - Intronic
1006636635 6:35466141-35466163 GAGAGAGGAGGCCAGGAGGATGG - Intronic
1006648986 6:35535484-35535506 TCGTGGGGAGGGAAGAGGGAAGG - Intergenic
1006734077 6:36259827-36259849 TACTAGGGAGGGAGGGAGGAGGG + Intronic
1006929387 6:37678581-37678603 GAGTGGGGAGGGCAGTAGAATGG - Intronic
1007259770 6:40555371-40555393 TGGAGGGGAGAGGAGGAGGAGGG - Intronic
1007288517 6:40765934-40765956 GTGTGTGGAGGGCAGGAAGAGGG - Intergenic
1007378831 6:41473622-41473644 TACTTGGGTGGGGAGGAGGAAGG - Intergenic
1007502453 6:42308784-42308806 GAGGGGGGAGGGCAGGAGGAGGG + Intronic
1007510344 6:42369961-42369983 TCATGTGGAGGTCAGGAGGAAGG - Intronic
1007751889 6:44076067-44076089 GAGAGGGGAGGGGAGGAGGTAGG + Intergenic
1007811052 6:44485909-44485931 TGATGGGGAGGGCAGGGGGAAGG - Intergenic
1007811645 6:44490594-44490616 TGCTGGGGAGGACAGGAGAATGG - Intergenic
1007917549 6:45575191-45575213 TAGTGAGGATGGGAGGAGCATGG + Intronic
1007958194 6:45935965-45935987 TAGTGGGGAGGGCATAAAGATGG - Intronic
1007981720 6:46166208-46166230 GAGGAGGGAGGGAAGGAGGAAGG - Intronic
1007983652 6:46185498-46185520 GAATGTGGAGGACAGGAGGATGG + Intergenic
1008542229 6:52555216-52555238 GAGCGAAGAGGGCAGGAGGAGGG - Intronic
1009419717 6:63451597-63451619 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1009441727 6:63688227-63688249 AAGGGGGGAGGGGAGGGGGAGGG - Intronic
1009634748 6:66250832-66250854 TAGGGTGGGGGGCAGGGGGAGGG + Intergenic
1009747792 6:67841501-67841523 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1010256772 6:73767198-73767220 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1010467166 6:76181706-76181728 GAGTGGGGAGGGTGAGAGGAGGG + Intergenic
1010560712 6:77345493-77345515 TAGTGGGGAGGGGAGGAAAGGGG + Intergenic
1010969559 6:82248789-82248811 TGCTGGGAAGGGCAGTAGGAGGG - Intergenic
1011160228 6:84381259-84381281 TATTAGGGAGGGCAGGCTGATGG + Intergenic
1011208031 6:84922570-84922592 TAGGAGGCAGGGCAGGAGGCAGG + Intergenic
1011314140 6:86012656-86012678 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1011334521 6:86245590-86245612 AAGAGGGGAGGTCAGAAGGAAGG - Intergenic
1011418305 6:87145601-87145623 TGGGGTGGAGGGCAGGGGGAGGG + Intergenic
1011628909 6:89305797-89305819 GAGTGTGGAGGGTGGGAGGAGGG + Intronic
1011871815 6:91903977-91903999 TAGTGTGAAGGGTGGGAGGAGGG + Intergenic
1012204631 6:96445304-96445326 TAGGGGAAAGGGTAGGAGGAAGG + Intergenic
1012230644 6:96757250-96757272 TTATGGGGATGGCAGGTGGAGGG + Intergenic
1012445987 6:99307549-99307571 CAGTGGGGAGGTCTGGAGGCAGG + Intronic
1012529247 6:100214404-100214426 GAGGGGGGAGAGTAGGAGGAGGG + Intergenic
1012585920 6:100922414-100922436 GAGAGTGGAGGGTAGGAGGAGGG + Intergenic
1012814004 6:103999090-103999112 GAGGGTGGAGGGCAGAAGGAGGG - Intergenic
1013355138 6:109339842-109339864 TGGAGAGGAAGGCAGGAGGAGGG - Intergenic
1013688876 6:112616651-112616673 TAGTGGGAAGGGGATGAGGCAGG + Intergenic
1013690331 6:112634071-112634093 TTGTGGGGTGGGGAGGGGGAGGG + Intergenic
1014029616 6:116685427-116685449 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1014166550 6:118231554-118231576 TATTCAGGAGGGCAAGAGGAAGG - Intronic
1014416392 6:121190212-121190234 TGGTGGGGAGGAAAGGAGGGAGG - Intronic
1014990484 6:128068937-128068959 GAGTGGGGAGGAGAGGGGGAGGG + Intronic
1015098209 6:129442670-129442692 GAGGGTGGAGAGCAGGAGGAGGG - Intronic
1015295603 6:131588675-131588697 TACTGGGAGGGGTAGGAGGATGG + Intronic
1015636342 6:135278733-135278755 TGGTGGGGAGGGCGAGAGGAGGG + Intergenic
1015658528 6:135546828-135546850 TAGTGGTGCGGGCATGTGGAGGG + Intergenic
1016013940 6:139165333-139165355 CAGTGGGGGAGGCTGGAGGAGGG - Intronic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1016332949 6:142972975-142972997 TGGTGGGGAGGTTGGGAGGAAGG + Intergenic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016666981 6:146653588-146653610 GAGTGTGGAGGGTGGGAGGAGGG + Intronic
1017017540 6:150113884-150113906 TAGTGGGGAGGACGGGTGGAAGG - Intergenic
1017055811 6:150434717-150434739 AGGTGGGGAGGGAAGGGGGATGG - Intergenic
1017340125 6:153311437-153311459 TAGGGAGGAGGGAAGGAGAATGG - Intergenic
1017587703 6:155945532-155945554 GGGAGGGGATGGCAGGAGGAAGG - Intergenic
1017637352 6:156456180-156456202 GAGAGGGGAGGGGAGGGGGAGGG - Intergenic
1017757612 6:157542801-157542823 CAGTGGGGACGGCAGGCCGAGGG + Intronic
1018123995 6:160664478-160664500 TAGGGGTGAGGGAAGGAGTAAGG - Intergenic
1018389378 6:163330845-163330867 TAGGGCGGAGGGTGGGAGGAGGG - Intergenic
1018515156 6:164571483-164571505 TAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1018681619 6:166270189-166270211 GAGCAGGGAGGACAGGAGGATGG + Intergenic
1019159084 6:170057630-170057652 GAATGGGGAGGGGAGGGGGAAGG - Intergenic
1019223498 6:170493243-170493265 AGGTGAGGAGGGGAGGAGGAGGG + Intergenic
1019242930 6:170685134-170685156 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1019320704 7:414205-414227 GAGGGAGGAGGGGAGGAGGAGGG - Intergenic
1019335731 7:481644-481666 GGGTGGGGAGGGGAGGAGGTTGG - Intergenic
1019342186 7:513508-513530 TGGTGGGGGGGGCAGGATGGAGG - Intronic
1019351727 7:557151-557173 GAGATGGGAGGGCAGGAGGAGGG - Intronic
1019517961 7:1447940-1447962 GAGTGGGGAGGGAAGGAGTGGGG - Intronic
1019576395 7:1739681-1739703 GAGTGGAGAGGGCGGCAGGAGGG + Intronic
1019588148 7:1815736-1815758 TAGCAGGGTGGGCGGGAGGAGGG - Intergenic
1019713886 7:2529673-2529695 TGATGGGGATGGCGGGAGGATGG + Intergenic
1019920035 7:4157514-4157536 GAGCGGGGAGGGAGGGAGGAAGG + Intronic
1019936699 7:4262742-4262764 TAGAGGGGAGGGGAGGGGGTGGG - Intronic
1019936727 7:4262813-4262835 TAGAGGGGAGGGGAGGGGTAGGG - Intronic
1019936758 7:4262886-4262908 TAGAGGGGAGGGGAGGAGAGGGG - Intronic
1020080090 7:5282410-5282432 AAGGGAGGAGAGCAGGAGGAGGG + Intronic
1020550071 7:9592949-9592971 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1020666274 7:11047803-11047825 GAGGAGGGAGGGCAGGAGGGAGG + Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021329950 7:19324035-19324057 GAGGAGGGAGGGGAGGAGGAAGG + Intergenic
1021352948 7:19617625-19617647 TAAAGGGGAGGGAGGGAGGAAGG - Intergenic
1021530098 7:21634661-21634683 GAGAGTGGAGGGCAGGAGGAGGG + Intronic
1021680032 7:23120974-23120996 TAGAGGGAAGGGGAGGCGGAAGG - Intronic
1021734149 7:23626649-23626671 GAGTGGGGAGGGTGGGAGGAGGG - Intronic
1021784245 7:24136516-24136538 CAGTGGGGAGGGGAGGTGGCTGG - Intergenic
1021825164 7:24543567-24543589 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1021896681 7:25243192-25243214 GAGTGGGGAGAGCGGAAGGAAGG - Intergenic
1022026037 7:26448771-26448793 TAGGGGTGTGGGGAGGAGGAAGG + Intergenic
1022028818 7:26473119-26473141 CAGTGGGTGGGCCAGGAGGAAGG - Intergenic
1022069415 7:26897652-26897674 TAGTCGAGAGGAAAGGAGGATGG - Intronic
1022088396 7:27090983-27091005 TAGAGGAGGGGGCAGGAGAAGGG + Intergenic
1022175189 7:27865681-27865703 TGGTGGGGAGGGCTGGTGGGTGG - Intronic
1022358879 7:29640953-29640975 TATTTGGGAGGGCAAGAGCAGGG + Intergenic
1022506316 7:30910411-30910433 TGGTGGGGCAGGCAGGAGGTGGG + Intergenic
1022522842 7:31019144-31019166 GTGTGGGTAGGGCAGGAGGGAGG + Intergenic
1022739087 7:33104304-33104326 GAGGGTGGAGGGCAGGCGGAGGG + Intronic
1022764423 7:33394400-33394422 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1022844643 7:34197614-34197636 TCATGGGGAGGGGAGGAGGGAGG + Intergenic
1023756729 7:43425483-43425505 TAGTGGATAGCGCAGGAGGCTGG - Intronic
1023838267 7:44080927-44080949 GAGTTGGGAGAGAAGGAGGAGGG + Intronic
1023921347 7:44632541-44632563 TAGGAGGCAAGGCAGGAGGATGG - Intronic
1024009996 7:45259293-45259315 TTTTGGGGAGGGCAGGATGTGGG - Intergenic
1024085643 7:45889447-45889469 TCCTGGGGAGGCCAGCAGGAGGG - Intronic
1024121136 7:46241979-46242001 GAGTGGGGAGGGTGAGAGGAAGG - Intergenic
1024187268 7:46963116-46963138 AAGTAGGGAGGGAAGGGGGAAGG + Intergenic
1024217736 7:47262230-47262252 AAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1024393700 7:48843043-48843065 TAGAGGGGAGGGGAGGAAGTAGG + Intergenic
1024507014 7:50170379-50170401 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1025198831 7:56949806-56949828 AAGGGAGGAGAGCAGGAGGAGGG - Intergenic
1025673115 7:63627127-63627149 AAGGGAGGAGAGCAGGAGGAGGG + Intergenic
1025924469 7:65945674-65945696 ACTTGGGGAGGGCTGGAGGAGGG + Intronic
1025931790 7:66000903-66000925 ACTTGGGGAGGGCTGGAGGAGGG + Intergenic
1025992835 7:66508587-66508609 AAGTAGGGAGGGAGGGAGGAAGG - Intergenic
1026237569 7:68541081-68541103 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1026517288 7:71084090-71084112 GGGAGGGGAGGGGAGGAGGAGGG - Intergenic
1026804062 7:73418564-73418586 GAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1026863892 7:73810929-73810951 TGATGGGGAGGGGAGGAGGAAGG + Intronic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1027224988 7:76238068-76238090 GGATGGGGAGGGCAGGGGGAGGG - Intronic
1027352698 7:77327817-77327839 GAGCGGGGATGGCTGGAGGAGGG - Intronic
1027374596 7:77537392-77537414 TAGGGCGGTGGGGAGGAGGAGGG + Exonic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027754139 7:82189017-82189039 GAGTGTAGAGGGCGGGAGGAGGG + Intronic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1028101391 7:86825101-86825123 GAAGGTGGAGGGCAGGAGGAGGG - Intronic
1028143971 7:87301129-87301151 GAGTGTAGAGGGAAGGAGGAAGG + Intergenic
1028396153 7:90370538-90370560 TCGGAGGGAGGACAGGAGGATGG + Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028488437 7:91385196-91385218 CACTGGGGAGAGGAGGAGGAAGG - Intergenic
1028544503 7:91983192-91983214 TGGGGTGGCGGGCAGGAGGAGGG - Intronic
1029054423 7:97726353-97726375 GAGGGGGGAGGGTGGGAGGAGGG - Intergenic
1029139551 7:98400580-98400602 TAGGGGGGAGGGGATGGGGAGGG + Intronic
1029195147 7:98800274-98800296 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1029250102 7:99230086-99230108 GAGGGTGGAGGGCGGGAGGAGGG - Intergenic
1029456724 7:100675512-100675534 TTCTGGGGAGGGCGGGAGGCTGG + Intronic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029494765 7:100890812-100890834 CACTGGACAGGGCAGGAGGAGGG - Exonic
1029729727 7:102431508-102431530 TGATGGGGGTGGCAGGAGGAGGG + Intergenic
1030065400 7:105655443-105655465 GTGTGGGGTGGACAGGAGGATGG + Intronic
1030289923 7:107861897-107861919 TGGTGAGGAGGGAAGGAAGAAGG + Intergenic
1030376853 7:108762325-108762347 GAGGGTTGAGGGCAGGAGGAGGG + Intergenic
1030379001 7:108789993-108790015 GAGAGTGAAGGGCAGGAGGAGGG - Intergenic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1030693000 7:112553884-112553906 TACAGCAGAGGGCAGGAGGATGG + Intergenic
1030698618 7:112614637-112614659 TAGTGGGGAGGGAGGAATGAGGG - Intergenic
1030779937 7:113587864-113587886 TAGTGGGGAAGGCTGGGGTAGGG - Intergenic
1031023875 7:116659262-116659284 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1031417760 7:121513164-121513186 TAGAGTTTAGGGCAGGAGGATGG + Intergenic
1031429282 7:121646780-121646802 TAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1031929876 7:127674149-127674171 AAGTGGGGACGGAAGGAGGGAGG - Intronic
1031991140 7:128200106-128200128 AAGGGAGGAGGGGAGGAGGAAGG - Intergenic
1032121232 7:129158534-129158556 TAGAGTGAAGGGTAGGAGGAAGG - Intronic
1032373205 7:131381602-131381624 TAGTGATGAGGTCAGGATGATGG - Intronic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1032471112 7:132180000-132180022 TAGTGACCAGGGCAGGATGACGG + Intronic
1032704165 7:134407792-134407814 GAGTGGGGTGGGGAGGGGGAAGG - Intergenic
1032714760 7:134498031-134498053 GAGCAGGGAGGGTAGGAGGAGGG - Intergenic
1032721410 7:134553337-134553359 TATTTGGGAGGGCAAGAGCAGGG - Intronic
1032815029 7:135464539-135464561 AAGTGGGGAGGGTGGAAGGAGGG + Intronic
1033423350 7:141221740-141221762 AGATGGGGAGGGCAGCAGGAAGG + Intronic
1033454390 7:141489559-141489581 GAGTGGGGAGAGAAGGAGGGAGG - Intergenic
1033885597 7:145941159-145941181 CAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1034064736 7:148125403-148125425 AAGCGTGGAGGGCGGGAGGAGGG - Intronic
1034440114 7:151081976-151081998 TGTTGTGGAGGGCAGGGGGAGGG - Intronic
1034544221 7:151779380-151779402 GAGCGGGGAGAGGAGGAGGAGGG - Intronic
1034704439 7:153127822-153127844 AAGACTGGAGGGCAGGAGGAAGG + Intergenic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034865600 7:154638814-154638836 AATAGGGGAGGGAAGGAGGAGGG - Intronic
1035205434 7:157291420-157291442 TGGAGGGCAGGGGAGGAGGAGGG + Intergenic
1035270186 7:157715199-157715221 AGGTGGGGAGGGCTGGAGGCGGG + Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035505191 8:123028-123050 TAGTGGGGAGGGAAGAAAAAAGG + Intergenic
1035543760 8:462744-462766 AAGAGGGAAGGGTAGGAGGAGGG + Intronic
1035724789 8:1817699-1817721 GACTGGGGACGGCAGGAGGGAGG + Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1035900879 8:3457206-3457228 CAGTGAGGAGGGCAGGATGAGGG - Intronic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036090672 8:5661568-5661590 TAGGAGGGAGGGCAGGAGCAGGG + Intergenic
1036137563 8:6175878-6175900 GAGAGGGCAGGGCAGGAAGAGGG - Intergenic
1036585855 8:10122677-10122699 GAGTGTAGAGGGCAGGAGGAAGG - Intronic
1036773160 8:11592629-11592651 TGGTGTGGTGGGCAGGTGGAGGG - Intergenic
1036821459 8:11943056-11943078 CACAGGGGAGGGCAGGAGGTGGG + Intergenic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037176284 8:15950078-15950100 TGGTGTGCAGGGCAGGAGTATGG - Intergenic
1037260342 8:17001436-17001458 CAGTGGGAAGGGCAAGGGGAAGG + Intronic
1037323769 8:17668818-17668840 GAGGGTGGAGGGCGGGAGGAGGG - Intronic
1037562685 8:20088973-20088995 TATTGGGGAGGGGAGGAAGATGG - Intergenic
1037583772 8:20262342-20262364 AAGAGGGGAGGGGAGAAGGAAGG + Intronic
1037636049 8:20701756-20701778 CAGTGGGGCTGGCAGGAGCAGGG + Intergenic
1037767409 8:21780657-21780679 GAGAGGGGAGGGCAGGGGGATGG - Intronic
1037805624 8:22056753-22056775 AAGTGGGGAGGGCGCGGGGAGGG + Intronic
1037957241 8:23069184-23069206 AAGTGGGGAGGGGAGGGGAAGGG + Intergenic
1037977304 8:23222875-23222897 TGGGGAGGATGGCAGGAGGAGGG - Intronic
1038176267 8:25184459-25184481 GGGTGGGGAGGGCGGGAGAAAGG + Intergenic
1038311600 8:26449643-26449665 GAGAGGGGTGAGCAGGAGGAGGG + Intronic
1038325155 8:26567364-26567386 TAGTTGGGTGGGCAGATGGATGG - Intronic
1038904189 8:31879700-31879722 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1038920853 8:32082352-32082374 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1039370726 8:36981575-36981597 CAGAGGAGAGGACAGGAGGAAGG - Intergenic
1039486810 8:37916511-37916533 TAATTGGAAGGGCGGGAGGAGGG - Intergenic
1039615966 8:38955204-38955226 GGGTGGGAAGGGCAGGAGGGGGG - Intronic
1040102284 8:43516400-43516422 GAGTGTGGAGGGTAGTAGGAAGG + Intergenic
1040407617 8:47121807-47121829 GAGGGTGGAGGGCAGCAGGAGGG + Intergenic
1040462495 8:47662245-47662267 TGGAGGGGAGGGCACCAGGATGG + Intronic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1041125664 8:54635974-54635996 CAGTGGGGAGGAGAGGAAGAGGG - Intergenic
1041161016 8:55044049-55044071 TAGTGGGAAGGGAAGAAGCAGGG - Intergenic
1041177253 8:55209516-55209538 TTGTGGGGAGGGCAGGGTTAAGG + Intronic
1041214203 8:55583680-55583702 AAGTGGGGAAGGCAGGAGAGGGG + Intergenic
1041221389 8:55655149-55655171 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1041245502 8:55885042-55885064 AAGTGGGGAGAGCAGAAGAAGGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041380398 8:57248588-57248610 TGGTGGTGAGGGGAGGAGAATGG - Intergenic
1041523324 8:58778409-58778431 TAGTGAGGAGGGTGGGAGGAGGG + Intergenic
1041628174 8:60055012-60055034 AAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042440314 8:68818441-68818463 TTGTGGGGTGGTCAGGAGGCCGG + Exonic
1042469263 8:69164625-69164647 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1042616648 8:70656879-70656901 TAGTGTGGTGGGCAAGGGGAGGG + Intronic
1042659473 8:71137849-71137871 TGGTGGGTAGGGCAGAAAGAAGG + Intergenic
1042702273 8:71628369-71628391 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1042790582 8:72600838-72600860 TAGGGTGGAGGGTGGGAGGAGGG + Intronic
1043796395 8:84547113-84547135 CTGTTGGGAGGGCAAGAGGAGGG - Intronic
1043968022 8:86501046-86501068 GAATGGGGAGGGCAGGAGGTAGG + Intronic
1044058736 8:87605725-87605747 TGGGGGGGAGGGCAGGGGGGAGG + Intronic
1044444093 8:92253548-92253570 TTGTGGGGTGGGCGGGGGGAGGG + Intergenic
1044553687 8:93539139-93539161 TGGTGGAGAGGGGAGGAGGCAGG + Intergenic
1044557930 8:93584850-93584872 GAGGGTGGAGGGCAGGAGGAGGG + Intergenic
1044803414 8:95980278-95980300 AAGGGTGGAGGGCGGGAGGAGGG - Intergenic
1045048055 8:98297674-98297696 GAGAGGGGAGGGAAGGAGGAGGG - Intergenic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1045238428 8:100376734-100376756 GAGTGGGAAGGTCAGGAAGAAGG + Intronic
1045318994 8:101067380-101067402 TAGGGGAGAGGGCAGGAGGCAGG + Intergenic
1045407705 8:101883457-101883479 GAGTGGTGAGGGGAGGAGGAAGG - Intronic
1045592907 8:103618320-103618342 GAATGGGGAGGGTGGGAGGAGGG + Intronic
1045661785 8:104445627-104445649 TAGTGGGGAGGGATGGCGGTGGG + Intronic
1045696016 8:104809660-104809682 TAGTGGGGATGGTAAGAAGATGG - Intronic
1045870764 8:106924352-106924374 TGGAGGGGAGGGCAGGGGGCAGG + Intergenic
1045990653 8:108303020-108303042 AAGTGGGGAGGGTAGGAGTGGGG - Intronic
1046156365 8:110295123-110295145 TAGTGCGGACTGTAGGAGGAGGG - Intergenic
1046166405 8:110442145-110442167 GAGTGGGGAGGGTGGGAGGAGGG + Intergenic
1046194797 8:110847432-110847454 CAGTGGGGAGGGGTGGATGAAGG + Intergenic
1046537274 8:115531564-115531586 TAGTGTGGAAGTCAGAAGGACGG + Intronic
1046694258 8:117320881-117320903 GAGTGGGGAGGGTAGAAGGAGGG + Intergenic
1046722070 8:117631632-117631654 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1046940325 8:119924881-119924903 GAGTGTGGAGGGTGGGAGGAGGG - Intronic
1047011027 8:120672912-120672934 GAGACTGGAGGGCAGGAGGAAGG + Intronic
1047061798 8:121235632-121235654 AGGAGGGGAGGGAAGGAGGAAGG - Intergenic
1047061804 8:121235648-121235670 AGGAGGGGAGGGAAGGAGGAGGG - Intergenic
1047061811 8:121235664-121235686 AGGAGGGGAGGGAAGGAGGAGGG - Intergenic
1047219674 8:122909591-122909613 TGGGGGGGAGAGGAGGAGGAGGG - Intronic
1047300770 8:123612096-123612118 GAGAGGGGAGGGGAGGGGGAGGG - Intergenic
1047613753 8:126545769-126545791 TTGTGGGGAGAGGGGGAGGAGGG + Intergenic
1047622911 8:126626449-126626471 TAGAAGGGAGGAAAGGAGGAAGG + Intergenic
1048149258 8:131877838-131877860 TGGTGTGGGGGGCAGGGGGAGGG - Intergenic
1048158196 8:131983340-131983362 AAGTGGGGAGGGCAAGAGCATGG + Intronic
1048325267 8:133434297-133434319 AAGAGATGAGGGCAGGAGGAAGG - Intergenic
1048483036 8:134819239-134819261 GAGTGGGAAGGGGAAGAGGAAGG + Intergenic
1048511808 8:135069885-135069907 TAGGGGGCAGGGCAGGACCATGG - Intergenic
1048526101 8:135204437-135204459 GAGTGGGGAGGGCAGGAGAGGGG + Intergenic
1048574105 8:135677609-135677631 GGGTGGGGAGAGGAGGAGGAAGG + Intergenic
1048690385 8:136955955-136955977 GAGAGGGGAGGGAGGGAGGAAGG - Intergenic
1048800307 8:138188687-138188709 CAGTGGGCAGGGCTGCAGGAAGG - Intronic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049310469 8:141931333-141931355 TAAGGAGGAGGGGAGGAGGAGGG + Intergenic
1049362558 8:142219321-142219343 GAGGAGGGAGGGGAGGAGGAAGG + Intronic
1049444757 8:142624828-142624850 AGGCAGGGAGGGCAGGAGGAGGG - Intergenic
1049452965 8:142672261-142672283 GATTGGGGAGGGCAGTTGGAGGG - Intronic
1049741165 8:144241682-144241704 CAGTGGGGAGGGCGGCAGAATGG + Intronic
1049799286 8:144510331-144510353 TGGTGGGGGGGGCATGAGCACGG - Intronic
1049850779 8:144829136-144829158 CAGTGGGCAGAGCAGGAGGTGGG - Intronic
1050559172 9:6817185-6817207 TGGGGGGGGGGGCAGGGGGAGGG - Intronic
1050722456 9:8606150-8606172 TAGTGATGAGGAAAGGAGGAAGG + Intronic
1050820916 9:9878865-9878887 GATTGTGGAGGGAAGGAGGAAGG - Intronic
1050912201 9:11085605-11085627 GAGGAGGGAGGGAAGGAGGAAGG + Intergenic
1051038410 9:12776535-12776557 AAGAAGGGAGGGCAGGAGGGCGG - Intronic
1051301575 9:15656735-15656757 GGGTGGTGAGGGCTGGAGGAAGG + Intronic
1051334564 9:16054517-16054539 TAGTGGGGAAGGCAGGGGAGAGG - Intronic
1051428991 9:16962921-16962943 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1051696567 9:19774188-19774210 TGGTGGGTTGGGGAGGAGGAGGG + Intronic
1051759686 9:20448571-20448593 TACTGGGGTGGGGAAGAGGAAGG - Intronic
1052040782 9:23736477-23736499 GAGTGGGGAGGGGAGGAGCAGGG + Intronic
1052370277 9:27656179-27656201 TACTCGGGAAGGCAGGAGAATGG + Intergenic
1052669199 9:31534081-31534103 GAGGGTGGAGGGCGGGAGGAGGG - Intergenic
1052951984 9:34220084-34220106 AAGAGGGGAGGGGAGGGGGAGGG - Intronic
1053270922 9:36748944-36748966 GAGTGGGGAGGGCAGGAATTGGG + Intergenic
1053558445 9:39162814-39162836 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1053774691 9:41524545-41524567 TAATGGGGAGAGTAGGAGGTGGG + Intergenic
1054813561 9:69453995-69454017 CAGTGTGGTGGGCAGGAGGATGG - Intronic
1054925209 9:70581891-70581913 AAGAAGGGAGGGAAGGAGGAAGG - Intronic
1054938522 9:70714635-70714657 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1054940213 9:70732628-70732650 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1054962036 9:70979868-70979890 TGGTGGGGAGGGGGAGAGGAAGG + Intronic
1055189658 9:73502348-73502370 AAGTGGGGAGAGAAAGAGGAAGG - Intergenic
1055562750 9:77537215-77537237 TGGTTGGGAGGGGAGGATGAAGG - Intronic
1055638475 9:78300155-78300177 GCGTGGGGTGGGCAGGAAGAAGG - Intronic
1056137745 9:83646575-83646597 AAGAGGGGAGGGGAGGAGGGAGG + Intergenic
1056211604 9:84369799-84369821 GAGGGTGGAGGGCTGGAGGAAGG - Intergenic
1056481270 9:87008834-87008856 TAGTCAGGAGGCCAGGAGGAAGG - Intergenic
1056733016 9:89181991-89182013 TGGTGAGGAGGTCAGGAGGCTGG + Intergenic
1056765151 9:89440502-89440524 GAGTGTGGAGGGCAAGCGGAGGG - Intronic
1056834637 9:89944610-89944632 CACAGGGGAGGGGAGGAGGAAGG + Intergenic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1057106266 9:92420542-92420564 TAGAAGAGAGGGAAGGAGGATGG - Intronic
1057249894 9:93492685-93492707 TGGTGGGGAGGGCAGCTGCATGG + Intronic
1057492901 9:95536277-95536299 GAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1057575538 9:96239250-96239272 TAGTGAGAGGGGCAGGAAGAAGG + Intronic
1057695803 9:97322250-97322272 TGGGGAGGAGGGCAGGGGGATGG - Intronic
1057823693 9:98354927-98354949 TAGTGAGGAAGGCAGGTTGAAGG - Intronic
1058136576 9:101314297-101314319 TATTGGGGAGGGAAGGAAGAGGG - Intronic
1058470249 9:105270496-105270518 TAGTGGGGAGGTGAAGAGGGAGG - Intronic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1059062477 9:111047693-111047715 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1059335319 9:113565199-113565221 TCGCGGGGTGGGCAGAAGGACGG + Intronic
1059490973 9:114667098-114667120 GGGTGGGAAGGGCAGAAGGAAGG + Intergenic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1059878353 9:118661043-118661065 GGGAAGGGAGGGCAGGAGGAAGG + Intergenic
1059972507 9:119682167-119682189 GAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1059977729 9:119736099-119736121 TAGGGATGAGGGCAGGAGGTAGG + Intergenic
1060046675 9:120347016-120347038 GAGGGTGGAGGGTAGGAGGAAGG - Intergenic
1060056042 9:120413832-120413854 GAGGGAGGAGGGAAGGAGGAGGG + Intronic
1060063471 9:120482411-120482433 GAGTTGGAAGGGTAGGAGGAAGG - Intronic
1060213729 9:121725811-121725833 TAGAGGGGAAGGTAGCAGGAAGG + Intronic
1060401575 9:123352864-123352886 GAGTGAGGAGGGCAGGGGGCTGG + Intergenic
1060460636 9:123851172-123851194 TGGTGGGGAGTGCAGCAGGAGGG - Intronic
1060477717 9:123998747-123998769 GAATGGGGAGGGAAGGAGGGAGG + Intergenic
1060502176 9:124167609-124167631 AAGGGTGGAGGGTAGGAGGAGGG - Intergenic
1060647233 9:125291392-125291414 TAGTGAGGAGGGCAGGTTGAGGG + Intronic
1060877266 9:127092400-127092422 TAGAGGGGAGCGCCGGTGGATGG - Intronic
1061131983 9:128713473-128713495 TATTGGGGAGGCCAGGCTGAAGG - Intronic
1061162520 9:128903330-128903352 GGATGGGGAGGACAGGAGGAAGG - Intronic
1061275565 9:129568087-129568109 GAGTGGGGAGGGACAGAGGAAGG - Intergenic
1061473512 9:130846513-130846535 GTGTGGGGGGGACAGGAGGATGG - Intronic
1061584145 9:131555299-131555321 TGGTAGGGAGGGCAGGAAGGTGG + Intergenic
1061713870 9:132506445-132506467 TGGCGGGGAGGGGAGGAGCAGGG + Intronic
1061802525 9:133120355-133120377 TGGTGGTGAGGGGAGGAGGGTGG - Intronic
1061817297 9:133205007-133205029 TACTGGGGAGGACAGGAGCGGGG - Intergenic
1061949884 9:133930285-133930307 GAGTGAGGAGGCCAGGAGGCAGG - Intronic
1062017312 9:134297296-134297318 TACTGGGGCAGGCAGGAGCAGGG - Intergenic
1062070677 9:134553556-134553578 AAGCGGGGAGCCCAGGAGGAGGG - Intergenic
1062149602 9:135010869-135010891 TCGTGGACAGGGCAGGTGGAGGG - Intergenic
1062155330 9:135045155-135045177 GGTTAGGGAGGGCAGGAGGATGG + Intergenic
1062219478 9:135406927-135406949 TGGTGGGGAAGGCAGGAGGATGG - Intergenic
1062701203 9:137904676-137904698 TTGAGGGGACAGCAGGAGGAGGG - Intronic
1062703957 9:137924336-137924358 AAGGAGGGAGGGAAGGAGGAAGG - Intronic
1203772808 EBV:58095-58117 AAGAGGGGAGGGCTGGAGGCCGG + Intergenic
1203458950 Un_GL000220v1:15907-15929 TAGGGGGAAGGGCATGGGGAAGG - Intergenic
1203603121 Un_KI270748v1:34358-34380 TAGTGGGGAGGGAAGAAAAAAGG - Intergenic
1185459791 X:328791-328813 GAGAGGGGAGGGCAGGGAGAGGG - Intergenic
1185511422 X:667791-667813 GAGTGGGGAGGGCAGGGGAGGGG - Intergenic
1185593041 X:1291326-1291348 AAGAAGGGAGGGAAGGAGGAAGG - Intronic
1185598696 X:1324491-1324513 GGGAGGGGAGGGAAGGAGGAGGG + Intergenic
1185602314 X:1348837-1348859 AAGTAGGGTGGGAAGGAGGAGGG - Intronic
1185688287 X:1948332-1948354 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688295 X:1948350-1948372 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688310 X:1948386-1948408 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688588 X:2133908-2133930 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185829737 X:3289245-3289267 GAGCGGGGAGGGTGGGAGGAAGG - Intergenic
1186059668 X:5690606-5690628 TAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186216812 X:7309391-7309413 GAGAGGGGAGGGTGGGAGGAGGG + Intronic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186378209 X:9031620-9031642 GAGGGTGGAGGGTAGGAGGAGGG + Intronic
1186402333 X:9271342-9271364 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1186473955 X:9842819-9842841 AAGAGGGGAGGGAAGGAGGAGGG - Intronic
1186481894 X:9902300-9902322 TAGAGGGGAGGGCAAGTGGATGG + Intronic
1186698127 X:12059611-12059633 TACTATGGGGGGCAGGAGGAAGG - Intergenic
1186884583 X:13900400-13900422 TACTGGGAAGGGCTGGAGGGAGG + Intronic
1186936657 X:14458015-14458037 TTGTGGGGTGGGGAGGGGGAGGG - Intergenic
1187132251 X:16514163-16514185 AAGGGGGGAGGGAAGGAGGAAGG + Intergenic
1187206528 X:17186923-17186945 AAGCAGGGAGGGTAGGAGGAGGG + Intergenic
1187214505 X:17263592-17263614 TAAGGTGGAGGGTAGGAGGAGGG + Intergenic
1187239058 X:17496074-17496096 GAGATTGGAGGGCAGGAGGAAGG - Intronic
1187415442 X:19089284-19089306 TAGGGTGGAGGGTGGGAGGAGGG + Intronic
1187820299 X:23280247-23280269 GAGGGTGGAGGGCGGGAGGAGGG + Intergenic
1187830287 X:23374239-23374261 AAGGGAGGAGGGAAGGAGGAAGG - Intronic
1188035058 X:25308010-25308032 GAGAGTGGAGGGCAGGAGGAAGG - Intergenic
1188535732 X:31194734-31194756 TTGTGGGCAAGGCAGGAGGGTGG + Intronic
1188547475 X:31325164-31325186 AAGCAGGGAAGGCAGGAGGAAGG - Intronic
1188573528 X:31618072-31618094 TAGGGTGGAGGGTGGGAGGATGG + Intronic
1188574903 X:31636190-31636212 GAGTGGGGAGGGTGGGAGGAGGG + Intronic
1188601633 X:31973527-31973549 CAGTGGGGAGAAGAGGAGGATGG - Intronic
1188878977 X:35468670-35468692 GTGTGGGGAGGGGAGGAGGATGG + Intergenic
1188963071 X:36517318-36517340 GAGTAGAGAGGACAGGAGGAAGG + Intergenic
1189161819 X:38817156-38817178 CAGTGGGGAGGGGAGGGGGATGG - Intergenic
1189236047 X:39488295-39488317 GACTGGGGTGGGCAGGAGGCAGG - Intergenic
1189750649 X:44217711-44217733 GAGAGGGGAGGGCAGCAGGTGGG + Intronic
1189996760 X:46646523-46646545 TAGTGGGGAGGGGCAGAGGAAGG + Intronic
1190231778 X:48587791-48587813 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1190953164 X:55165788-55165810 GAGGGTGGAGGGTAGGAGGAGGG - Intronic
1190961174 X:55249688-55249710 TATTGGAGAGGTCAGGGGGAAGG + Intronic
1191599223 X:62984652-62984674 AGGTGGGGAGGGTAAGAGGAGGG - Intergenic
1191654305 X:63579270-63579292 TCTTGGTGGGGGCAGGAGGATGG - Intergenic
1191818745 X:65278792-65278814 GAGGGGGGAGGGTAGGGGGAGGG - Intergenic
1191985033 X:66970485-66970507 TTGTGGGGTGGGGAGGAGGGGGG - Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1193616889 X:83699884-83699906 TAGGGTGGAGGGTAGGAGAAGGG - Intergenic
1193663703 X:84288974-84288996 TAGGGTGGAGGGTTGGAGGAGGG + Intergenic
1193728774 X:85077248-85077270 TGGGGTGGGGGGCAGGAGGAGGG - Intronic
1193807287 X:86010204-86010226 GGGTGGGGGGGGCTGGAGGAGGG + Intronic
1193932179 X:87566913-87566935 GAGGGTGGAGGGCAGGAGGAGGG + Intronic
1194167436 X:90536283-90536305 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
1194227734 X:91282026-91282048 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1194568110 X:95519350-95519372 TAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1194806304 X:98332443-98332465 TAGGGGGCAGAGGAGGAGGAGGG + Intergenic
1194829367 X:98601845-98601867 AAGATGGGAGGGTAGGAGGAGGG - Intergenic
1194851059 X:98869824-98869846 GAGTGTGGAGAGCGGGAGGAGGG - Intergenic
1195047445 X:101066898-101066920 TGGGGTGGAGGGCAGGGGGAGGG + Intergenic
1195091047 X:101459357-101459379 CAGTGGGGAGGGCAGGTGCCTGG + Intronic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1195427146 X:104747321-104747343 AAGGGAGGAGGGAAGGAGGAAGG - Intronic
1195549461 X:106150616-106150638 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196401636 X:115323234-115323256 TAGTGTGCAGGGTGGGAGGAGGG + Intergenic
1196650078 X:118159356-118159378 GGGGGGGGAGGGAAGGAGGAAGG + Intergenic
1196665029 X:118306585-118306607 AAGAGGGGAGGGTAGGAGGAGGG + Intergenic
1196729137 X:118923706-118923728 TAGGGGGAAGGGCAGGAGTTAGG - Intergenic
1196769574 X:119280660-119280682 GAGTGGGTAGGGCAAGGGGAGGG - Intergenic
1196814369 X:119653328-119653350 AAGTGGGGAAGGCCGTAGGAAGG - Intronic
1196943745 X:120803634-120803656 GAGGGTGGAGGGCAGGAGGAGGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197045069 X:121986451-121986473 GAGAGGGGAGGGTGGGAGGAGGG + Intergenic
1197107802 X:122736433-122736455 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
1197230550 X:123999417-123999439 GAGGGAGGAGGGTAGGAGGAGGG - Intronic
1197287449 X:124612757-124612779 TAGTTGGGAGAAAAGGAGGAAGG - Intronic
1197436510 X:126434845-126434867 TAGAGGAGGGGGAAGGAGGAAGG + Intergenic
1197621320 X:128752964-128752986 GAGGAGGGAGGGCGGGAGGAGGG - Intergenic
1197704776 X:129626742-129626764 AAGGTGGGAGGGAAGGAGGAGGG + Intergenic
1197706781 X:129639905-129639927 CAGTGAGGAGTGCAGGGGGATGG - Intergenic
1197788958 X:130231569-130231591 AAGTTGGGAGGGAGGGAGGAAGG + Intronic
1198054485 X:132980419-132980441 GAGGGAGGAGGACAGGAGGAAGG + Intergenic
1198195307 X:134354780-134354802 GAGGAGGGAGGGCGGGAGGAGGG - Intergenic
1198327203 X:135585485-135585507 AAGGGAGGAAGGCAGGAGGAGGG + Intergenic
1198495175 X:137185120-137185142 TAGTAGGGAAGGCAGTGGGAAGG + Intergenic
1198962494 X:142197007-142197029 CATGGGGCAGGGCAGGAGGATGG - Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1199010838 X:142756727-142756749 GAGAGGGGAGGGCTGGAGGGAGG - Intergenic
1199095872 X:143737891-143737913 TAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1199259168 X:145750636-145750658 TAGTGGCGGGGGGAGGAGGTGGG + Intergenic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1199326737 X:146507442-146507464 AAGGGGAGAGGGTAGGAGGATGG + Intergenic
1199544666 X:148995455-148995477 TTGTGGGGAGGGCAGAAAGGGGG + Exonic
1199602561 X:149550914-149550936 TGTTGCGGTGGGCAGGAGGAGGG + Intergenic
1199647827 X:149928561-149928583 TGTTGCGGTGGGCAGGAGGAGGG - Intergenic
1199679937 X:150217301-150217323 TAGTGAGGCGGGCAGGAAGACGG + Intergenic
1199711460 X:150472661-150472683 TAATGGGGAGAGAGGGAGGAGGG + Intronic
1199770382 X:150971490-150971512 AAGGGTGGAGAGCAGGAGGAGGG + Intergenic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199827718 X:151516295-151516317 TGGTGGGGAGGGAAGGAGGGAGG + Intergenic
1199847581 X:151702148-151702170 TGGTGTTGAGGTCAGGAGGATGG - Exonic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1199996988 X:153031672-153031694 CAGTGGGGTCGGCAGCAGGACGG + Intergenic
1200082597 X:153585890-153585912 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1200101067 X:153689263-153689285 GGGAGGGGAGGGCAGGGGGAGGG - Intronic
1200225217 X:154413316-154413338 TCCTGGGCAGAGCAGGAGGAGGG - Intronic
1200365449 X:155657649-155657671 CACTGGGCAGGGGAGGAGGATGG + Intronic
1200374720 X:155767595-155767617 GAAAGGGGAGGGCAAGAGGAGGG + Intergenic
1200513699 Y:4114061-4114083 GAGGGTGGAGGGTAGGAGGAAGG + Intergenic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201248263 Y:12028725-12028747 GAGGGGGGAGGGTGGGAGGAAGG + Intergenic
1201341100 Y:12935498-12935520 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201384307 Y:13421763-13421785 GAGAGTGGAGGGTAGGAGGAGGG + Intronic
1201667524 Y:16475198-16475220 TATTGTGGAGGGCAGGGGGCTGG + Intergenic
1201690577 Y:16760250-16760272 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1201711794 Y:17000635-17000657 AAGGAGGGAGGGAAGGAGGAAGG - Intergenic
1202300723 Y:23410963-23410985 CAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1202570088 Y:26259635-26259657 CAGGGTGGAGGGTAGGAGGAGGG - Intergenic