ID: 959132634

View in Genome Browser
Species Human (GRCh38)
Location 3:102376317-102376339
Sequence ATGTACTTTTAGAAGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959132634_959132635 30 Left 959132634 3:102376317-102376339 CCAGCAATCTTCTAAAAGTACAT 0: 1
1: 0
2: 1
3: 23
4: 212
Right 959132635 3:102376370-102376392 TTTGAGCTAGATAAATGTTAAGG 0: 1
1: 0
2: 3
3: 30
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959132634 Original CRISPR ATGTACTTTTAGAAGATTGC TGG (reversed) Intronic
905810084 1:40906271-40906293 TTGTACTTTTAGTAGAGAGCGGG + Intergenic
907531104 1:55098192-55098214 ATGGACTTTTAAAATATTGAGGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909759767 1:79272162-79272184 ATGTACCTGTAGGAGATGGCTGG - Intergenic
910494279 1:87809275-87809297 ATGTACTTTAAAAAGATTGTTGG + Intergenic
910821810 1:91358833-91358855 ATGTACCTTTAGGAGGTGGCTGG - Intronic
911350371 1:96746537-96746559 TTGTAGTTTTAAAAAATTGCTGG + Intronic
912180465 1:107212983-107213005 TTCTACTTTTAGAAGAGTGGTGG + Intronic
916152026 1:161803272-161803294 ATGAATTTTTACAATATTGCTGG - Intronic
917131968 1:171752170-171752192 GTGTATTTTTAGAACTTTGCAGG - Intergenic
917330504 1:173875496-173875518 TTGTATTTTTAGTAGATAGCAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923904204 1:238364516-238364538 ATATATATTTAGAAGATTGGAGG - Intergenic
923933292 1:238728224-238728246 ATTTACTTTTACAGGATTGCAGG + Intergenic
924151431 1:241134382-241134404 ATTTACTTTTGGAAGAGTTCAGG - Intronic
924798079 1:247307399-247307421 ATATACTTTTAGAAGATGGATGG - Intronic
1063941873 10:11138629-11138651 GTTTACTTTTAGAAGACTGGGGG + Intronic
1064731966 10:18340593-18340615 CTGTACTTTGACAAGTTTGCAGG + Intronic
1065043548 10:21723106-21723128 ATCTATTTTTAAAAGATGGCTGG - Intronic
1066107868 10:32171388-32171410 CTGTTCTTTCAGAACATTGCAGG - Intergenic
1066281944 10:33926285-33926307 ATCTAATTTTAGAAGGTAGCAGG + Intergenic
1068064278 10:52109301-52109323 GTGTTCTTTTAGAAAAATGCGGG - Intronic
1069240917 10:66138096-66138118 ATATACTTTTCAAAGACTGCGGG - Intronic
1070013004 10:72495481-72495503 TTGTACTTTTAGTAGAGAGCAGG - Intronic
1072670290 10:97424504-97424526 TTGTACTTTTAGTAGAGTGGAGG + Intronic
1073964649 10:108975143-108975165 ATGAACTTTTGGAAAATGGCAGG - Intergenic
1074643370 10:115415013-115415035 ATGTAGTTTTATAATATTGGAGG + Intronic
1074654383 10:115567660-115567682 TTGTAATTTTAGAATAATGCAGG + Intronic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078851043 11:15164269-15164291 ATGAACCTTTAGAAGAAGGCAGG + Intronic
1080081844 11:28229566-28229588 ATGCTCTTATAAAAGATTGCAGG + Intronic
1080599495 11:33808519-33808541 ATGAGCTTTTAGAAAACTGCAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1085576902 11:77613740-77613762 CTTTACTTTTAGAAGAAGGCAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091085837 11:132720983-132721005 ATTTAATTTTAAATGATTGCTGG - Intronic
1092231844 12:6780284-6780306 AAGTCCTTTTAGAAGCTTCCAGG + Intergenic
1092666395 12:10804237-10804259 TTGTATTTTTAGTAGATTCCGGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097702332 12:62832690-62832712 ATGTACCTTGATAAGATTGATGG - Intronic
1098469641 12:70828396-70828418 ATGTAATCTTTGAATATTGCAGG - Intronic
1099171577 12:79370868-79370890 ATGAAACTTTAGAAGATTGGAGG - Intronic
1100898069 12:99206991-99207013 ATGGACTCTTAGAAGAATGATGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102783342 12:115584374-115584396 ATGTATTTTAATAAGATTTCTGG + Intergenic
1103826300 12:123741852-123741874 AGGAACTTTTAGAAGATGGCAGG + Intronic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107386346 13:39913925-39913947 ATGCACTTTTGGAAGATCTCTGG - Intergenic
1107900094 13:45003479-45003501 ATGTATTTTTAAAAGATTCATGG - Intronic
1109282612 13:60374664-60374686 GTGTGGTGTTAGAAGATTGCTGG + Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1110708537 13:78624353-78624375 TGGTACTTTTAGAAGATGGAGGG - Intronic
1111023051 13:82479719-82479741 GTGAACTTTTAGAAGGTTGAGGG + Intergenic
1111074499 13:83215841-83215863 ATGTTCTTTTATTAGCTTGCAGG - Intergenic
1111357147 13:87122804-87122826 ATATACTTTTAGAAAATTCCTGG - Intergenic
1111984589 13:95053021-95053043 ATGTACCTTTACAGCATTGCAGG - Intronic
1113400510 13:109988336-109988358 TTATACTTTTAGAAGATAGTGGG - Intergenic
1113489949 13:110683686-110683708 AGGTAGTTTTAGAAGATGACTGG - Intronic
1115248136 14:31317806-31317828 AGGTACTTGTATAACATTGCTGG + Intronic
1116576178 14:46578535-46578557 ATGTCTTTTTATTAGATTGCAGG + Intergenic
1118261442 14:64250973-64250995 GTGTACTTATAGAAAATTGCAGG - Intronic
1118560106 14:67070218-67070240 ATATACATTTTGAAGAATGCAGG - Intronic
1118914472 14:70090966-70090988 ATGGACCTTTAGAGGATTGATGG - Intronic
1120154602 14:81079334-81079356 AAGTACTTTTAGTGGAGTGCTGG - Intronic
1123100911 14:105799698-105799720 ATGAAATTTTAGAAGATAACAGG + Intergenic
1123568391 15:21576071-21576093 ATATATTTTTAGAAGAATGTAGG - Intergenic
1123604499 15:22011393-22011415 ATATATTTTTAGAAGAATGTAGG - Intergenic
1125226125 15:37398106-37398128 ATTTAGTTTGAGAAGAATGCTGG - Intergenic
1127290461 15:57565820-57565842 ATGTACTTTTAGTATACTGAGGG + Intergenic
1127952730 15:63825353-63825375 ATCTACTTTTAGAAAATTTCTGG - Intronic
1129779777 15:78263025-78263047 AGGGATTTTTAGAAGATTCCAGG + Intergenic
1130458107 15:84135094-84135116 ATGTACTCTTTGAAGATGGAGGG - Intergenic
1130825224 15:87537219-87537241 ATCTACTTTTGGAAGAGTTCTGG + Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1136352116 16:29717408-29717430 TTGTATTTTTAGAAGAGTCCAGG - Intergenic
1137747628 16:50834769-50834791 AAATACTCTTAGAAGAGTGCTGG + Intergenic
1137749243 16:50846674-50846696 ATGCACTTTTGGCAGAATGCTGG + Intergenic
1139338905 16:66254269-66254291 AAGCACTCTTAGGAGATTGCCGG - Intergenic
1140677544 16:77348046-77348068 ATGAACTCTTAGAAAATTGAGGG - Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1148727903 17:49808831-49808853 TTGTACTTTGAGAAGAGTCCAGG + Intronic
1152350357 17:79780837-79780859 TTGTCCTTTTAGGAGATTTCAGG + Intronic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1154352150 18:13593138-13593160 ATGTACTTTTAGTAGAGTCAGGG - Intronic
1155534105 18:26797534-26797556 TTGTACATTTAGATGATTTCTGG - Intergenic
1155738329 18:29252549-29252571 AAGGTCTTTTAGAAGATTGAAGG + Intergenic
1156827037 18:41443343-41443365 ATGTACTGTGGGAAGATTTCTGG - Intergenic
1156996009 18:43467422-43467444 ATGTATTTTTAAAAGAAGGCAGG + Intergenic
1157840239 18:50950659-50950681 TTGTATTTTTAGAAGAGTGGGGG + Exonic
1159475353 18:68914066-68914088 ATGTATTTTGAGAAAATTGGTGG - Intronic
1167254729 19:48420252-48420274 ATGTACTTTTAGAAGAGACGGGG - Intronic
1167750077 19:51374106-51374128 TTGTATTTTTAGTAGATTTCAGG + Intergenic
925887699 2:8407329-8407351 AAGTACTTTTAGTAAATTGCTGG - Intergenic
926936886 2:18095008-18095030 ATGTTCTTTTAGAATAGTTCTGG + Intronic
928301861 2:30132157-30132179 AAATACTTGCAGAAGATTGCAGG - Intergenic
928742112 2:34367092-34367114 ATGTATTTTTAAAAGAATGGGGG + Intergenic
929512769 2:42577928-42577950 CTGTTCATTTAGCAGATTGCTGG + Intronic
930658807 2:54033534-54033556 ATTTACTTTTAGGAGAGTGGGGG + Intronic
932519178 2:72391094-72391116 AAGTACTTCTAGGAGATTGCTGG + Intronic
934992054 2:98928880-98928902 ATGTAGTTTTGGATGGTTGCTGG - Intronic
936694714 2:114932032-114932054 ATTTAGTTTTAGAATCTTGCTGG + Intronic
937624592 2:124028941-124028963 ATGTGCATTCAGAAGATAGCAGG + Intronic
938311991 2:130298215-130298237 ATGTACATTTAAAAAATTTCGGG - Intergenic
938385903 2:130867177-130867199 ATGGACTTTTGGAAGATAGCAGG - Intronic
939804651 2:146758792-146758814 ATGTAAATTTAGCAGTTTGCTGG - Intergenic
940397779 2:153211828-153211850 ATGAACATTTAGAAGAGAGCTGG + Intergenic
942919072 2:181349004-181349026 ATGTACTATTAAAAGATTATAGG + Intergenic
943525569 2:189012804-189012826 ATATACTTTTTCAAGATTACTGG - Intergenic
943912759 2:193589762-193589784 CTGTACTTTTAGCAGATTACAGG + Intergenic
944176505 2:196834414-196834436 ATGTACAGTTATAAAATTGCAGG + Exonic
945359628 2:208881228-208881250 TTGTAATTTTTGAAGATTGTAGG - Intergenic
1172911633 20:38413795-38413817 TTGTACTTTTAGTAGATAACAGG - Intergenic
1173132760 20:40410067-40410089 ATTTACTTGGAGAAGATTGGGGG - Intergenic
1173154714 20:40598302-40598324 ATTTACTTTTAAAAGTCTGCTGG - Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1178272505 21:31204769-31204791 ATGTGCTTTTACAAGAATGCAGG - Intronic
1179100140 21:38349163-38349185 ATTTTCTTTTAGCAGATTCCAGG - Intergenic
1179503385 21:41823790-41823812 ATCTCCTTTCAGAAAATTGCAGG - Intronic
1179503740 21:41825866-41825888 CTGTACTTATAGAATATTGCAGG - Intronic
1181962026 22:26629068-26629090 ATGGACTTTGAGCAGGTTGCTGG - Intronic
1183857234 22:40643166-40643188 TTGTATTTTTAGTAGATAGCAGG + Intergenic
950990155 3:17426459-17426481 ATGTACTTTTAATAGTTGGCAGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951888055 3:27543235-27543257 ATGTATTTTAAGATGATTCCAGG - Intergenic
951980802 3:28564274-28564296 AGGTACTGGTAGAAGATGGCAGG - Intergenic
952743944 3:36760754-36760776 CAGTACTTTTTGAATATTGCTGG - Intergenic
954244466 3:49319785-49319807 CTGTACTTTTAGTAGATAGGGGG + Intronic
959132634 3:102376317-102376339 ATGTACTTTTAGAAGATTGCTGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964160196 3:153637342-153637364 ATGCACATCTAGAACATTGCTGG - Intergenic
965142075 3:164850763-164850785 ATTTAGTTTTAGAAGAATTCAGG - Intergenic
965203303 3:165688997-165689019 TTGTACTTTTAAAAGATTTAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
970366167 4:15360228-15360250 ATGTATTTTTAAAAGATCGATGG - Intronic
973088835 4:46105709-46105731 AAGTAATTTTAGAAAATTGGAGG - Intronic
973745748 4:53961760-53961782 CTATACTTTTAGAAGATCACAGG + Intronic
977413973 4:96705750-96705772 ATGTACATTCAGAAAAATGCAGG + Intergenic
977550000 4:98431305-98431327 AGGTAATTTTATAAGATTGCCGG - Intronic
977632367 4:99257396-99257418 AGGTACTTCTAGATCATTGCAGG + Intergenic
977679349 4:99781851-99781873 ATGTATTTATAGAAAATGGCTGG - Intergenic
977720924 4:100239458-100239480 ATCTTTTTTTAGGAGATTGCTGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
981662014 4:147178495-147178517 ATGCATTTTAAGAAAATTGCAGG - Intergenic
981824411 4:148923872-148923894 ATGTCTTATTAGAAGACTGCTGG - Intergenic
983481133 4:168275503-168275525 ATGGACTTTTAAAATAATGCAGG - Exonic
984873397 4:184346844-184346866 ATGTACTATTGGGAAATTGCTGG + Intergenic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990486597 5:56265349-56265371 ATGTACTTTGAGAAGAGGGCAGG - Intergenic
992277895 5:75140029-75140051 TTGTATTTTTAGTAGAATGCTGG - Intronic
993693667 5:91034729-91034751 TTGTACTTTTAGAATTTGGCAGG - Intronic
993980957 5:94543269-94543291 TTGTACTTTTAGTAGATACCAGG - Intronic
994175905 5:96710750-96710772 ATTTAGTTTTATAATATTGCTGG - Intronic
996562066 5:124841883-124841905 ATGTATATTTATAAGGTTGCTGG - Intergenic
997804982 5:136907912-136907934 ATGTTCTTTAAGAAGCTTGGAGG + Intergenic
997995269 5:138580685-138580707 ATGTACCTTTGGCAGATTTCAGG + Intergenic
999165850 5:149548915-149548937 ATGTTATTTTAGATTATTGCTGG + Intronic
999423967 5:151470291-151470313 ATTTACTTTTAAATCATTGCAGG + Intronic
999637566 5:153638800-153638822 ATGTACATTTAAAAGATGGGTGG + Intronic
1000916506 5:167088452-167088474 TTGTACTTTTAGTAGAGAGCAGG - Intergenic
1004878779 6:19984434-19984456 TTGTACTTTTAGTAGATAGGGGG - Intergenic
1009552354 6:65115121-65115143 ATGTATTTGTGGAAGTTTGCAGG - Intronic
1009834300 6:68978813-68978835 ATGAACTTTTAGAATATAGAAGG - Intronic
1010843947 6:80681697-80681719 CTTTATTTTTAGAAGATTGTGGG + Intergenic
1011589205 6:88954898-88954920 ATGTATTTTTAGTACATGGCTGG - Intronic
1012187495 6:96237768-96237790 AAGTACTTTTAGAGAATTGTTGG - Intergenic
1012856689 6:104510113-104510135 ATTTACTTTTAGAAGATGAAAGG + Intergenic
1013865045 6:114686224-114686246 CTGAACTTTTAAAAGATTGTAGG + Intergenic
1014959063 6:127659762-127659784 ATGGAATTTTTGAAGTTTGCTGG - Intergenic
1015222582 6:130821664-130821686 TTGTATTTTTAGTAGATTGATGG - Intergenic
1015232753 6:130935222-130935244 ATTTCCTTTTAAATGATTGCAGG - Intronic
1015596039 6:134868257-134868279 ATGTGTTTTTAAAAGATTGTAGG + Intergenic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1016392805 6:143591913-143591935 ATCTATTTTTAGGAGATTGAAGG + Intronic
1019997061 7:4731359-4731381 AGGTACTTTTCGAATTTTGCAGG - Intronic
1023667456 7:42539330-42539352 ATATACCTTGAGGAGATTGCAGG - Intergenic
1026449783 7:70518215-70518237 ATGTACTTTAATAGGATTGCAGG + Intronic
1026563585 7:71471027-71471049 CTCTACTTTTAGAAGAATGCAGG - Intronic
1027206789 7:76106801-76106823 TTGTACTTTTAGTAGATAGGGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030317717 7:108133241-108133263 ATGTATTTTTAGATTGTTGCAGG - Intergenic
1032742988 7:134758088-134758110 ATGTACTTGTAGAAAGTTTCTGG - Intronic
1033488436 7:141815346-141815368 ATGTACTTCTGGAAGATGCCTGG + Intergenic
1033568951 7:142608086-142608108 ATGTACTTTTAGTAGAGACCGGG + Intergenic
1034104417 7:148478081-148478103 CTGTTTTTTTAGAAGATTCCAGG + Intergenic
1036924185 8:12888226-12888248 ATGTATTTGTGGAAGATTGAAGG + Intergenic
1038078742 8:24107877-24107899 ATGCACTTTTAAAAGCTTCCTGG + Intergenic
1040590160 8:48784436-48784458 CTGTCCTTTTTGTAGATTGCTGG - Intergenic
1040775696 8:51040669-51040691 ATGTCTTTTCAGAAGATTGGAGG - Intergenic
1041298406 8:56386338-56386360 TTGTACTTCTAGAAGACTCCAGG - Intergenic
1041709301 8:60878307-60878329 ATTTACTTTTAGTTTATTGCAGG - Intergenic
1042391254 8:68238115-68238137 TTTTACTTTTTGGAGATTGCTGG + Intergenic
1043130787 8:76458193-76458215 TGTTACTTTTAGAAGATTGAAGG + Intergenic
1044022306 8:87119957-87119979 ATGTACTGTTAGTGGTTTGCTGG + Intronic
1046132293 8:109980847-109980869 ATGTACTTTTACAATATTCAGGG + Intergenic
1046877095 8:119267343-119267365 ATTTTCTTTCATAAGATTGCTGG - Intergenic
1047380942 8:124362062-124362084 TTGTACTTTTAGTAGATTCGGGG + Intronic
1047797654 8:128274242-128274264 ATGTTCTTTTAGAATGATGCAGG + Intergenic
1048949872 8:139487459-139487481 AAAGACTTTTGGAAGATTGCAGG + Intergenic
1049984986 9:941899-941921 TTGTCCTTTTAGTACATTGCTGG + Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050470074 9:5979179-5979201 ATGTACTTTTACAAACTTGCTGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1051127857 9:13824352-13824374 CTGTACCTTTTGAAGATTGTTGG - Intergenic
1051531482 9:18109031-18109053 AAGTAATTTTATAAGATTGCTGG - Intergenic
1053559953 9:39181803-39181825 TTGTACTTTTACAACAGTGCTGG + Intronic
1053824061 9:42002024-42002046 TTGTACTTTTACAACAGTGCTGG + Intronic
1054137163 9:61437152-61437174 TTGTACTTTTACAACAGTGCTGG - Intergenic
1054606513 9:67185340-67185362 TTGTACTTTTACAACAGTGCTGG - Intergenic
1055475280 9:76657278-76657300 ATGTGCCTTTAGAATATTTCAGG - Intronic
1055774807 9:79755720-79755742 CTGTGCTTTTAGGAGAATGCAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057095353 9:92302857-92302879 ATGGTCTTTGAGAAGGTTGCAGG + Intronic
1057431311 9:94996942-94996964 ATCTGCATTTGGAAGATTGCTGG - Intronic
1061181815 9:129028698-129028720 ATGTGCTCTTAGATGATTGCAGG + Intergenic
1186618158 X:11211714-11211736 TTGTATTTTTAGTAGATAGCAGG + Intronic
1187652486 X:21424197-21424219 ATATTCCTTTAGAAGATTACAGG - Intronic
1188173162 X:26953949-26953971 ATGGATTTTTTGAAGAATGCAGG + Intergenic
1188548031 X:31331752-31331774 ATGTACTTTTAAAAGACGACAGG + Intronic
1188897985 X:35694004-35694026 GGGTACATTTAGAAGTTTGCTGG + Intergenic
1189827651 X:44936204-44936226 GTGTCCTTTTATAAGATAGCAGG - Intronic
1194231245 X:91326512-91326534 ATCTACTTTTAATCGATTGCAGG + Intergenic
1196311334 X:114170020-114170042 ATATATTTTTAAAAGACTGCTGG + Intergenic
1196755555 X:119154578-119154600 TTGTACTTTTAGTAGAAAGCGGG - Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197728407 X:129791579-129791601 ATGGACTTCTAGAAGATGCCAGG - Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1201325464 Y:12752433-12752455 ATGGACTTTAACACGATTGCAGG - Intronic
1201601699 Y:15736641-15736663 ATCTTCTTTAAGAAGATTTCAGG - Intergenic