ID: 959132924

View in Genome Browser
Species Human (GRCh38)
Location 3:102380362-102380384
Sequence TTCCCACAAGAAGCCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959132924_959132925 7 Left 959132924 3:102380362-102380384 CCAGCTCTGGCTTCTTGTGGGAA 0: 1
1: 0
2: 0
3: 23
4: 213
Right 959132925 3:102380392-102380414 ATGCGTGCTAGAAGCAAAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
959132924_959132926 14 Left 959132924 3:102380362-102380384 CCAGCTCTGGCTTCTTGTGGGAA 0: 1
1: 0
2: 0
3: 23
4: 213
Right 959132926 3:102380399-102380421 CTAGAAGCAAAAGTGGCAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959132924 Original CRISPR TTCCCACAAGAAGCCAGAGC TGG (reversed) Intronic