ID: 959132925

View in Genome Browser
Species Human (GRCh38)
Location 3:102380392-102380414
Sequence ATGCGTGCTAGAAGCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959132921_959132925 12 Left 959132921 3:102380357-102380379 CCTGTCCAGCTCTGGCTTCTTGT 0: 1
1: 0
2: 5
3: 27
4: 274
Right 959132925 3:102380392-102380414 ATGCGTGCTAGAAGCAAAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
959132924_959132925 7 Left 959132924 3:102380362-102380384 CCAGCTCTGGCTTCTTGTGGGAA 0: 1
1: 0
2: 0
3: 23
4: 213
Right 959132925 3:102380392-102380414 ATGCGTGCTAGAAGCAAAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
959132919_959132925 26 Left 959132919 3:102380343-102380365 CCTGTTATTGGTGTCCTGTCCAG 0: 1
1: 0
2: 2
3: 8
4: 137
Right 959132925 3:102380392-102380414 ATGCGTGCTAGAAGCAAAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959132925 Original CRISPR ATGCGTGCTAGAAGCAAAAG TGG Intronic