ID: 959132926

View in Genome Browser
Species Human (GRCh38)
Location 3:102380399-102380421
Sequence CTAGAAGCAAAAGTGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959132924_959132926 14 Left 959132924 3:102380362-102380384 CCAGCTCTGGCTTCTTGTGGGAA 0: 1
1: 0
2: 0
3: 23
4: 213
Right 959132926 3:102380399-102380421 CTAGAAGCAAAAGTGGCAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 251
959132921_959132926 19 Left 959132921 3:102380357-102380379 CCTGTCCAGCTCTGGCTTCTTGT 0: 1
1: 0
2: 5
3: 27
4: 274
Right 959132926 3:102380399-102380421 CTAGAAGCAAAAGTGGCAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959132926 Original CRISPR CTAGAAGCAAAAGTGGCAGC TGG Intronic