ID: 959134541

View in Genome Browser
Species Human (GRCh38)
Location 3:102400511-102400533
Sequence CTGAGCATGGAGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 9, 3: 55, 4: 558}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959134541_959134547 -6 Left 959134541 3:102400511-102400533 CCCTCTGCCTTCTCCATGCTCAG 0: 1
1: 0
2: 9
3: 55
4: 558
Right 959134547 3:102400528-102400550 GCTCAGAAGGGCTAGCACCATGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959134541 Original CRISPR CTGAGCATGGAGAAGGCAGA GGG (reversed) Intronic
900031121 1:373843-373865 CTGGGCATGGACACTGCAGAGGG - Intergenic
900206373 1:1433537-1433559 CTGTGCCTGCAGGAGGCAGAGGG + Intergenic
900481332 1:2900883-2900905 CTGTGCAGGAAGGAGGCAGACGG - Intergenic
901404435 1:9036904-9036926 TTGAGCAAGTAGAAGGCAGGAGG - Exonic
903548906 1:24143981-24144003 CAGGGCCTGGAGAAGGTAGAAGG + Intergenic
903756127 1:25662268-25662290 CTGAGAGTGGAGGAGGGAGATGG + Intronic
903758996 1:25684718-25684740 CCGAGCATGGAGAATACAGGTGG + Intronic
904830908 1:33306381-33306403 CTGAGCCTGCAGAATGCAGCTGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
906193591 1:43914792-43914814 CTGGGCCTGGAGAAGGGACAGGG + Intronic
906844336 1:49174888-49174910 CTGAGGATGAAGAAGACAGAAGG + Intronic
907291018 1:53412888-53412910 CTGAACTTGGAGATGGCAGGGGG + Intergenic
907427905 1:54392680-54392702 CTGAGCCTTGAGAAGTGAGAAGG - Intronic
908165723 1:61455743-61455765 TTGAGCATTGAGGAGGCACATGG + Intronic
908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG + Intergenic
908859760 1:68470881-68470903 CTGAGCAATCAGAAGACAGATGG + Intergenic
909170056 1:72283063-72283085 CTGGGGATGGAGAAGGGAGGGGG + Intergenic
909175864 1:72357602-72357624 CTGAGCCAGGAGATGGCAAATGG - Intergenic
912128056 1:106564973-106564995 ATGAACATGAAGAAGGTAGAAGG + Intergenic
913218885 1:116643670-116643692 CTGAGCATGGGCGTGGCAGAAGG - Intronic
913566592 1:120078788-120078810 ATGGTCCTGGAGAAGGCAGAAGG - Intergenic
913631539 1:120714756-120714778 ATGGTCCTGGAGAAGGCAGAAGG + Intergenic
914287350 1:146239500-146239522 ATGGTCCTGGAGAAGGCAGAAGG - Intergenic
914548382 1:148690242-148690264 ATGGTCCTGGAGAAGGCAGAAGG - Intergenic
914618298 1:149381465-149381487 ATGGTCCTGGAGAAGGCAGAAGG + Intergenic
914732523 1:150384409-150384431 GTGAGAATGGAAAAGACAGAAGG + Intronic
914755773 1:150560966-150560988 CTCAGCAGTGTGAAGGCAGAAGG + Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915604405 1:156941620-156941642 CTGAGCCTGAAGAAGGGTGAGGG - Intronic
915737402 1:158093786-158093808 CAGAGGGTGGAGAAGGCAGGAGG - Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916896450 1:169168305-169168327 CTGAGGAAGCATAAGGCAGAAGG - Intronic
916986998 1:170202335-170202357 CAGAGCATTGAAAAGGCAGAGGG - Intergenic
917023840 1:170619810-170619832 GTGAGCATGCTGGAGGCAGAAGG - Intergenic
917237667 1:172912238-172912260 CTGGGCATTGAGAAAGCTGAAGG - Intergenic
917341998 1:173989587-173989609 CTGACCATGGAGTAGGCAGTGGG - Intronic
917524958 1:175780376-175780398 CTCACCATGGAGAAGGCAAGAGG - Intergenic
917707427 1:177648530-177648552 CTGAGAATGGAGAAGAGAGGAGG - Intergenic
917936972 1:179877890-179877912 TGAAGGATGGAGAAGGCAGAAGG - Intergenic
918626024 1:186656683-186656705 CTGAGCAAGGTGAATGCAGTTGG - Intergenic
918664248 1:187129560-187129582 CCGAGCATGGAGAACACAAATGG + Intergenic
919007961 1:191924147-191924169 TTGATCATGGAGATGGCAGTGGG + Intergenic
919509646 1:198446193-198446215 CTGAGCAAAAAAAAGGCAGATGG - Intergenic
920099420 1:203507717-203507739 CTGAGAATGGGGCAGGCAGAGGG - Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920357960 1:205389578-205389600 CTGGACTTGGAGAAGTCAGAAGG + Intronic
920577499 1:207072325-207072347 CTGGGCACGGAGAGGGCTGAGGG - Exonic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
922386339 1:225087616-225087638 CAGACCTTGGAGAAGGAAGATGG + Intronic
922572972 1:226644670-226644692 CTGGGCATGGCGGGGGCAGAAGG - Intronic
922792944 1:228320398-228320420 ATGAGTATGTAGATGGCAGATGG - Intronic
922972163 1:229751745-229751767 CAAAGCCTGGAGAAGGCAGAGGG - Intergenic
923036848 1:230290469-230290491 CTGAGCACAGAGAACGGAGATGG - Intergenic
923069501 1:230549615-230549637 CTGAGCAGGGAAAGGGCAGTGGG + Intergenic
923391262 1:233515782-233515804 CTGAGCCTGTGGAAGGCAGGGGG - Intergenic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
924660564 1:246012714-246012736 CAAAGCAGGGAAAAGGCAGAAGG + Intronic
924910423 1:248506157-248506179 ATGAACATGGAGAAGACAGCAGG - Intergenic
924913677 1:248541882-248541904 ATGAACATGGAGAAGACAGCAGG + Intergenic
1064075956 10:12269019-12269041 CTGGGCAGGGTGAAGGCACACGG - Intergenic
1064148633 10:12844521-12844543 CTGAGGATGGATACGGCAGTGGG + Intergenic
1064177478 10:13087466-13087488 GTGGACATGGAGAAGGGAGAGGG - Intronic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1065699938 10:28414946-28414968 CTAACCGTGGAGAAGACAGAAGG + Intergenic
1067033575 10:42897387-42897409 CTGAGCGTGGGGCAGGAAGAGGG + Intergenic
1067730070 10:48804187-48804209 CTGAGCCAGGAGGAGGCAGGTGG - Intronic
1069598688 10:69689225-69689247 CTGAGCCTGGATTAGGAAGAGGG + Intronic
1070151957 10:73811014-73811036 CTGAGGACGGCGAAGCCAGACGG + Intronic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070425932 10:76287213-76287235 CTGAGAGTGGGGCAGGCAGATGG - Intronic
1070692384 10:78536768-78536790 ATGAGTATGGAGAAAGAAGAGGG - Intergenic
1071329577 10:84546419-84546441 CTGGGCAGGGAGATGGCCGATGG + Intergenic
1072616995 10:97056639-97056661 CTATGCATGGAGGAGGCAGTCGG - Intronic
1073930409 10:108567808-108567830 CTGAGAATGGAGGAGGTTGAGGG - Intergenic
1074676799 10:115860346-115860368 GTGAGCAAAGGGAAGGCAGATGG - Intronic
1076063254 10:127429601-127429623 CTGGGTATCGAGAAGTCAGAGGG - Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076409387 10:130234954-130234976 CAGACCCTGGAGAAGGCAGCTGG - Intergenic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076451647 10:130560766-130560788 CTGAGCACAGAGGAGGCTGATGG - Intergenic
1076631397 10:131854300-131854322 GAGAGAAGGGAGAAGGCAGAAGG - Intergenic
1077233631 11:1469597-1469619 TTGGGCATGGAGGAGGCAGCAGG + Intronic
1077244031 11:1527259-1527281 CAGAGCATGGAGACGGCAGTGGG - Intergenic
1077466176 11:2734793-2734815 CTGAGGCTGGAGGAGGCAGGAGG - Intronic
1077827135 11:5823192-5823214 CTCAGCGTGGAGTAGGCACATGG - Intronic
1078108945 11:8376391-8376413 CAAAGCCAGGAGAAGGCAGACGG + Intergenic
1078281631 11:9908319-9908341 TTGTGAATAGAGAAGGCAGATGG + Intronic
1078432957 11:11301779-11301801 CTGGGCATTGGGAAAGCAGAGGG + Intronic
1078898096 11:15615928-15615950 GTGGGGATGCAGAAGGCAGAAGG - Intergenic
1079259359 11:18863600-18863622 CTGAGGTGGAAGAAGGCAGATGG - Intergenic
1080552161 11:33382122-33382144 GTGAGTATGGAGAAGAGAGAGGG + Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1081999164 11:47383561-47383583 GAGAGCAGGGCGAAGGCAGATGG + Intergenic
1082249333 11:49961719-49961741 CTTAGCATGGAAAAGCCACAGGG + Intergenic
1082561632 11:54626628-54626650 CTAAGCATGGAAAAGTCACAGGG - Intergenic
1082772949 11:57222738-57222760 CTGAGCATGGGGTAGGGAAAGGG - Intergenic
1083335555 11:61919722-61919744 CTTGGGATGGAGCAGGCAGAGGG - Intronic
1083597030 11:63922870-63922892 CTGGGCATGGGGCATGCAGATGG - Intergenic
1083731522 11:64654943-64654965 CTGAGCAGGAAGTAGGCAGCAGG + Intronic
1084090791 11:66878375-66878397 CTTTGCATGGAAAAGGCAGTGGG - Intronic
1084117189 11:67049278-67049300 CTGAGCATGTCGCAGGCAGCGGG + Exonic
1084151557 11:67289948-67289970 CTGACCAGGGAGATGGCAGAGGG - Intronic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1085124736 11:73992144-73992166 CTGAGTATGGAGAAGGCAAAAGG - Intergenic
1085297751 11:75440441-75440463 CTGAGCATGCAGAAGGCAGGTGG - Intronic
1085600035 11:77847263-77847285 CTGAGCTTGCAGAAAGCAAAGGG - Intronic
1086005625 11:82031921-82031943 CTAAGTATTGAGAAGGGAGAAGG + Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086558210 11:88136850-88136872 CTAAGAATGGAGAAGGGACAGGG - Intronic
1087153188 11:94877070-94877092 CTGAGGATGGAAATGGGAGATGG + Intergenic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087304605 11:96473418-96473440 CTGAGGATGGGGATGTCAGATGG - Intronic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089554221 11:119306500-119306522 CTCAGCATGGAGGTGGCACAAGG - Exonic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1090178426 11:124672950-124672972 CACAGTATGGAGAAAGCAGAAGG - Intronic
1090415098 11:126535099-126535121 CAGAGCTGGGAGCAGGCAGATGG + Intronic
1090490598 11:127157338-127157360 GTCAGCCAGGAGAAGGCAGAAGG + Intergenic
1090806157 11:130203601-130203623 CTGAGCATGGGGAAGGCATGAGG - Intronic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1091328089 11:134707243-134707265 CAGAGCATGGAGAAATCACAAGG + Intergenic
1091365457 11:135016183-135016205 CGAAGGATGGAGAAGGCTGAGGG - Intergenic
1091365480 11:135016269-135016291 TGGAGGATGGAGAAGGCTGAGGG - Intergenic
1091852557 12:3712081-3712103 ATGAGAATAGGGAAGGCAGAGGG - Intronic
1092591987 12:9960577-9960599 CTCAGCATGAAGCAGCCAGAAGG + Intronic
1092890396 12:12964395-12964417 ATGAGCATGGAGTAGGAAGTGGG + Intergenic
1092991687 12:13909089-13909111 ATGAGCTTGTGGAAGGCAGAAGG - Intronic
1095048115 12:37532885-37532907 CTGACCATGAAGACGGCTGAAGG + Intergenic
1095908592 12:47403212-47403234 CTGGGCATGGAGATGGCAGGTGG - Intergenic
1096558709 12:52420303-52420325 CTTAGCATTGAAAAGGAAGAAGG - Intergenic
1096584990 12:52614200-52614222 ATGTACATAGAGAAGGCAGAAGG + Intronic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097391378 12:59019007-59019029 CTGCGCAAGCAGAAGGCACATGG + Intergenic
1098416925 12:70244127-70244149 CTGTGCATGGTGGAGGGAGAAGG + Intronic
1098859824 12:75695758-75695780 ATGAGCAAGGAGAAAGGAGAAGG + Intergenic
1100067005 12:90661255-90661277 CTGAGAATGGATAAGCTAGATGG + Intergenic
1100123696 12:91397740-91397762 CATCCCATGGAGAAGGCAGAAGG + Intergenic
1101557536 12:105824381-105824403 TTCAGAAGGGAGAAGGCAGAGGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1101867570 12:108532221-108532243 CTCACCATGGAGAGGACAGAAGG - Exonic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102207411 12:111099802-111099824 CTGGGCATGGAGGGGACAGAGGG - Intronic
1102449577 12:113030833-113030855 GTGAGCATGGAGAAAGCAAGGGG - Intergenic
1102560138 12:113756076-113756098 CTGACCTTGAAGAAGGAAGAAGG + Intergenic
1102974765 12:117198640-117198662 CTGAGAAGGCACAAGGCAGAAGG - Intergenic
1104081909 12:125436529-125436551 CGTCGCATGAAGAAGGCAGAGGG + Intronic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1104955928 12:132465817-132465839 ATGTGCAGGGTGAAGGCAGACGG + Intergenic
1106098094 13:26668276-26668298 CTGAGCTGGGAGAAGGCAGGAGG - Intronic
1106184441 13:27396677-27396699 GTAAGCATGGTGAAGGCAAAGGG + Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106257123 13:28031894-28031916 CTCAGTATGGAGAAGCCAAAGGG + Intronic
1106780796 13:33057150-33057172 CTCAGCAGGGAGCAGGCAGAAGG - Intronic
1107652849 13:42561942-42561964 CTGAGCATGGTGGTGGCAGAAGG - Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1110337451 13:74348119-74348141 CTGAACTTGGAGATGGTAGAAGG + Intergenic
1112313064 13:98336748-98336770 TTGAGGATGGAGAAGGCAACAGG + Intronic
1113378359 13:109783781-109783803 CTGTCCATGGAGCATGCAGATGG - Exonic
1113454451 13:110438275-110438297 GGGAGCATGGAGATGGCGGAGGG + Intronic
1114619994 14:24089967-24089989 CTGAGGCTGGAGAAGTCAGCAGG + Intronic
1116342452 14:43741664-43741686 ATGAGCAAGGTTAAGGCAGAAGG - Intergenic
1116594815 14:46827572-46827594 CTGAGTATGGAGATGGCACTGGG + Intergenic
1117983372 14:61363738-61363760 CTGAGGATGAAGAAGGCAACGGG + Intronic
1118702539 14:68448071-68448093 CTGAGCCTGGAGCAGCCAGTTGG + Intronic
1118925026 14:70184383-70184405 TTGAGTGTGGAGAAGGCATAGGG - Intronic
1119499033 14:75107144-75107166 GTGAGCAAGGAGAAGACAGGTGG - Intronic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1119774943 14:77242509-77242531 CTGAGACTGAAGAAGGCAGCAGG + Intronic
1120370051 14:83621909-83621931 CTGACCATGGATGAGGCTGAAGG + Intergenic
1120535663 14:85691951-85691973 TTCAGCATGAAGGAGGCAGAAGG - Intergenic
1122128076 14:99589958-99589980 CTGAGCAGGAAGGAGGCAGAGGG - Intronic
1122154549 14:99742378-99742400 CTGGGGATGGAGAAGGTACATGG + Intronic
1122626444 14:103087657-103087679 CTGAGCCTGGAGGAGGCCAAGGG + Intergenic
1122674088 14:103396007-103396029 CTGAGTCGGGAGAGGGCAGAAGG + Intronic
1122848647 14:104514596-104514618 CTGGGCAGTGAGAAGGCAGGTGG + Intronic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1123509287 15:20979942-20979964 CTATGCATGGAAAGGGCAGAAGG - Intergenic
1123566511 15:21553689-21553711 CTATGCATGGAAAGGGCAGAAGG - Intergenic
1123602772 15:21990975-21990997 CTATGCATGGAAAGGGCAGAAGG - Intergenic
1123994101 15:25706368-25706390 CTGAGCGTGGCGCAGGCACAGGG - Intronic
1124247015 15:28079704-28079726 CTGAGTGTGGAGATGCCAGAAGG - Intronic
1124624507 15:31300305-31300327 CTGACCAGGAAGAAGGCAGTGGG + Intergenic
1127172962 15:56322694-56322716 GTATGAATGGAGAAGGCAGATGG + Intronic
1127267433 15:57373663-57373685 CTGAGGGTGGAGGAAGCAGAGGG - Intergenic
1128556834 15:68637572-68637594 CTGAGCCTGGAGAAGGAAGGCGG + Intronic
1128768573 15:70265723-70265745 TGGAGAATGGAGAAGGAAGATGG + Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129248986 15:74297874-74297896 CTTAGCTTGGGGAGGGCAGAGGG - Intronic
1129302878 15:74636371-74636393 CTGACCATGGCGGAGGCAGCAGG + Intronic
1129897930 15:79122498-79122520 CTTAGGAAGGAGACGGCAGAAGG - Intergenic
1131645897 15:94343551-94343573 ATGAGAATGGTGCAGGCAGAAGG + Intronic
1202974875 15_KI270727v1_random:280777-280799 CTATGCATGGAAAGGGCAGAAGG - Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1133409752 16:5558414-5558436 CTGAGCATCGAGGAGACTGAAGG + Intergenic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135793980 16:25424013-25424035 CTCAGCATGGAGGTGGCAAAGGG - Intergenic
1136072035 16:27793154-27793176 TTGAGGATGGAGAAGGAACAAGG - Intronic
1136247979 16:28986006-28986028 CTGAGCTGGGAGAGGGGAGATGG + Intronic
1136702006 16:32152813-32152835 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136765660 16:32774647-32774669 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1136802439 16:33095731-33095753 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1137372693 16:47923172-47923194 CTGAACATGTAGAAGGCACCTGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1138124928 16:54430860-54430882 GCGAGCATGAAGAAGGAAGAAGG - Intergenic
1139079796 16:63502519-63502541 CTGAGCATGAAGAAAGAAAAAGG + Intergenic
1140885136 16:79236329-79236351 ATGAGCCTGGAGGAGGGAGAGGG - Intergenic
1141633111 16:85299577-85299599 CAGAGAACGGAGTAGGCAGAGGG - Intergenic
1141677006 16:85523389-85523411 CTGAGCATGGAGGATGGAGATGG - Intergenic
1142191813 16:88721599-88721621 CTGGGCCTGGAGAAGACTGACGG - Exonic
1203068048 16_KI270728v1_random:1036895-1036917 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1142694581 17:1626811-1626833 GGGATCAAGGAGAAGGCAGAGGG + Intronic
1143281332 17:5756764-5756786 CTGACACTAGAGAAGGCAGAGGG + Intergenic
1143594661 17:7907141-7907163 GTGAGAAAGGAGAAGGCATAAGG + Exonic
1143743338 17:8970952-8970974 CTGAGGAAGGAGAAGACAAAAGG + Intergenic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144619651 17:16809324-16809346 CTGAGCATGAGGAAGGCAGTTGG - Intergenic
1144711334 17:17403563-17403585 CTGTCCATGCAGACGGCAGATGG - Intergenic
1144734578 17:17547906-17547928 GTGAAGATGGAGAAGCCAGAAGG + Intronic
1144893034 17:18506380-18506402 CTGAGCATGAGGAAGGCAGTTGG + Intergenic
1145139183 17:20437912-20437934 CTGAGCATGAGGAAGGCAGTTGG - Intergenic
1145728661 17:27156200-27156222 CTGACCATGGAGACGGCCCAAGG - Intergenic
1145882963 17:28365144-28365166 CTGGGCATGGAGCTGGCAAAGGG + Exonic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1147454911 17:40531109-40531131 TTGAGCTTGGAGAAAGCAGGCGG + Intergenic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1147628388 17:41914583-41914605 CTGAGTATGGAGCAGACACAGGG + Intronic
1148736039 17:49865450-49865472 CTGAGCGTGGAGACGACAGAGGG - Intergenic
1148748041 17:49929319-49929341 CTCAGAAAGGAGAGGGCAGAAGG + Intergenic
1149222348 17:54429552-54429574 TTGAGAAGGCAGAAGGCAGATGG + Intergenic
1149401393 17:56299912-56299934 TTGAGCATTGAGAATTCAGAGGG - Intronic
1149604637 17:57916202-57916224 CTGAGAATGCAGAAGGCCGAGGG + Intronic
1149990148 17:61378611-61378633 CTGGGCAGGGAGAAGGCTGGTGG - Intronic
1151397262 17:73831747-73831769 CAGAGGCTGTAGAAGGCAGACGG - Intergenic
1151458051 17:74238346-74238368 CTAAGCGTGGAGGAGGCACAAGG + Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151745897 17:76011663-76011685 CTTCTCCTGGAGAAGGCAGAGGG + Exonic
1151767277 17:76139010-76139032 CTAAGAATGGACAAGGCAGGAGG - Intronic
1152196767 17:78923216-78923238 CTGAGCATGAAGGAGGCGGGAGG + Intronic
1152379793 17:79936522-79936544 CTGAGGCTGAAGGAGGCAGAAGG + Exonic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1153475993 18:5499141-5499163 CTGAGCATGTAGAGAGCAGGAGG - Intronic
1153583061 18:6594726-6594748 CCGCTCATGGGGAAGGCAGAAGG + Intergenic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1154290633 18:13102942-13102964 CTGAGCCTGGAGGAGGCGTAGGG - Intronic
1155592040 18:27438506-27438528 GTGAGCATGGAGGAGGCAGAAGG + Intergenic
1156729344 18:40171702-40171724 CTCAGCATGCAGAAGGAACAGGG - Intergenic
1157115611 18:44860012-44860034 CAGAGAATGGAAAAGTCAGAAGG - Intronic
1157560544 18:48642544-48642566 CTGAGAATGGTGAATGCAGAGGG + Intronic
1157948076 18:52003633-52003655 CTGAGGGAGGAGAAGCCAGAAGG - Intergenic
1158371175 18:56806276-56806298 CTGAGCATGGCGAAGGCAGGAGG - Intronic
1158562569 18:58527355-58527377 GTTAGCATGGAGAAAGCAAATGG + Intronic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1159856868 18:73599196-73599218 GTTTGAATGGAGAAGGCAGATGG - Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1160731355 19:643010-643032 AGGAGCAAGGAGCAGGCAGAGGG - Intronic
1160883221 19:1331965-1331987 CTGAGCAGGGACAAGGGACAAGG - Intergenic
1160965609 19:1745856-1745878 GGGAGCAGGGAGAAGGAAGAAGG + Intergenic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161744512 19:6047480-6047502 CTGAGCATGCAGAATTCCGAGGG - Exonic
1162037135 19:7946852-7946874 AGGAACTTGGAGAAGGCAGATGG + Intergenic
1162745682 19:12796756-12796778 CTGAGCCTGAAGAAGGAAGGGGG + Intronic
1163041639 19:14607149-14607171 CTGACCATGGGGAGGGGAGAAGG + Intronic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1163830645 19:19545672-19545694 GCCAGCATGGAGAAGGCAGCTGG - Exonic
1164180174 19:22811420-22811442 GTGAGCAGGGTGAAGGCAGCAGG - Intergenic
1164400762 19:27900656-27900678 CTAAGCATGGGGGAGACAGAGGG - Intergenic
1164428477 19:28166246-28166268 CTGAGGATGGTGAAGGCATGAGG + Intergenic
1164431824 19:28195542-28195564 GTGGGGAGGGAGAAGGCAGAAGG + Intergenic
1164634135 19:29780329-29780351 CTGAGCCTGGAGGAAGAAGAGGG - Intergenic
1164763601 19:30746171-30746193 TTAATCATGGAGAAAGCAGATGG - Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1164976883 19:32580422-32580444 TTGTGCGTGGAGGAGGCAGATGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165444324 19:35848588-35848610 CTGAGCATGGAGGGGGCTGAGGG - Intronic
1166194644 19:41197847-41197869 CTGGGCATGGGGAAGCGAGAAGG + Exonic
1166258958 19:41625031-41625053 CTCAGCCTGGAGAGGGCAGGGGG - Intronic
1166276479 19:41757557-41757579 CTCAGCATGGAAAGGACAGATGG + Intronic
1166406628 19:42526428-42526450 CTCAGCCTGGAGAGGACAGATGG - Intronic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1166972638 19:46580002-46580024 GTGAGCATGGAGAATGTAGAGGG - Intronic
1167031094 19:46961351-46961373 CTCAGAATGGAATAGGCAGATGG + Intronic
1168347917 19:55659912-55659934 CTGAGCCGGGAGGAGGCAGGAGG - Intronic
1168651552 19:58095595-58095617 CTGAGCATGGTGGAGGCATCGGG + Intronic
925039657 2:721637-721659 CCGAGCCTGGAGGAGGCAAATGG - Intergenic
925425271 2:3744192-3744214 ATGAGAGAGGAGAAGGCAGATGG + Intronic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
926053088 2:9757167-9757189 CTAAGCAGGGAGACTGCAGAGGG - Intergenic
926691277 2:15735716-15735738 GAGAGCATGGAGAATGAAGAAGG - Intronic
927489504 2:23511434-23511456 AGGAGCTTGGAGAAGGAAGATGG + Intronic
927854451 2:26519104-26519126 ATGAGCCTGGGGATGGCAGAGGG + Exonic
927951757 2:27175023-27175045 CTGAGGATGCAGAAGGCAGAGGG - Intergenic
927974421 2:27327226-27327248 CTGCGCATGCAGGAGGGAGAGGG - Exonic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928336270 2:30401106-30401128 AGGAGCATTGAGAATGCAGAGGG + Intergenic
928950506 2:36809155-36809177 CTGAGTAGGGAGAAGGAACAAGG + Intronic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929562675 2:42965517-42965539 CTTAGGCTGGAGAAGGGAGATGG + Intergenic
929880907 2:45836711-45836733 GTGAGAAAGGAGGAGGCAGACGG - Intronic
929919147 2:46160301-46160323 CTGAGAATCTGGAAGGCAGAAGG - Intronic
930222242 2:48756320-48756342 CTTACCATGTAGAAGCCAGAAGG - Intronic
931122146 2:59231739-59231761 CTGAGGGTGGAGATGCCAGAGGG + Intergenic
931240798 2:60450637-60450659 CAGAGCATGGGGCAGGGAGAGGG + Intergenic
931433603 2:62229350-62229372 CCCAGCTTGGAGGAGGCAGAAGG - Intergenic
931979750 2:67681878-67681900 CTAAGCCTGGAGCATGCAGATGG - Intergenic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
932435478 2:71700608-71700630 CTGAGAATGGAGAAAGCAGAGGG - Intergenic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932442148 2:71744214-71744236 CTGAGGAAGGAGCATGCAGAAGG - Intergenic
932894718 2:75628054-75628076 CTGAGCATGAAGCTGGCAGGTGG + Intergenic
934702016 2:96449985-96450007 CTGAGCAAGGAGATAGTAGATGG - Intergenic
935525293 2:104158343-104158365 TTTAGCATGGTGAAGGCTGAAGG + Intergenic
935785454 2:106544687-106544709 GTGAACTGGGAGAAGGCAGAGGG + Intergenic
935858480 2:107301276-107301298 CTGAACATGAAAAAGGCAGAGGG - Intergenic
935922302 2:108029489-108029511 CTTAGCATAGAGATGGCAAATGG + Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936765948 2:115848661-115848683 CTGAGGAGGCAGAAGGCAGAAGG - Intergenic
937318799 2:120948516-120948538 CTGGGCCTGGAGATGGCAGGTGG - Intronic
937784049 2:125874341-125874363 CAGAGCTGGGAGGAGGCAGACGG + Intergenic
938941207 2:136171069-136171091 CTGCACACGGGGAAGGCAGAGGG + Intergenic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
939501206 2:142987421-142987443 CTCAGCATGGACAAGGAACAAGG + Intronic
939783880 2:146484187-146484209 ATGAGTAGGGAGAAGGGAGAAGG + Intergenic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
940008129 2:149028372-149028394 CTGGGCATGGGGAAGGGTGAAGG - Intergenic
941065964 2:160903116-160903138 ATAAGCATGAAGAAGGCAGATGG - Intergenic
941745252 2:169080323-169080345 CTGAGCCTGTGGAAGGGAGAGGG - Intronic
945777569 2:214126184-214126206 CGGAGAAGGGAGAAGGGAGAAGG + Intronic
946020997 2:216640027-216640049 GACAGCATGGAGAAGGCAGGAGG - Intronic
946073007 2:217050503-217050525 CTGAGCATTGGGAGGGCAGCAGG - Intergenic
946539947 2:220673286-220673308 CTGAGCAGGGTTGAGGCAGATGG + Intergenic
946896279 2:224327729-224327751 CTGAGCCTGGGCAAGGCAGGAGG - Intergenic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
946934735 2:224708381-224708403 ATGAGGATGGAGAAGTGAGAAGG - Intergenic
947364262 2:229378069-229378091 CTGACTTTGAAGAAGGCAGAAGG + Intronic
947462841 2:230318034-230318056 CAGAGCAGGAAGGAGGCAGAGGG + Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947872862 2:233449440-233449462 CTGAACACGGAGATGACAGAAGG + Intronic
948004677 2:234597370-234597392 CTGAACCTGGAGGAGGCACATGG + Intergenic
948613236 2:239182771-239182793 CCGAGCATGCCGAGGGCAGAGGG - Intronic
948781513 2:240324479-240324501 CAGGGCCTGGAGGAGGCAGAAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
949052318 2:241903828-241903850 CTGGGCATGGGGAGGGCAGCTGG - Intergenic
1169751641 20:9000604-9000626 CTGAGGAGGTATAAGGCAGAAGG - Intergenic
1169801866 20:9518795-9518817 CTGTGCATCCAGAAGGCAGAGGG + Intronic
1170588876 20:17756011-17756033 CACAGCAGGGGGAAGGCAGAGGG + Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170907321 20:20528056-20528078 CTGTGCCTGGAGAATGCAGGGGG + Intronic
1171320963 20:24243951-24243973 CTCACCTTAGAGAAGGCAGAAGG + Intergenic
1171429570 20:25073067-25073089 CTGAGGATGGAGAGGCCAGCAGG - Intronic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1173114555 20:40228381-40228403 CTGCCCATGGAGAAGACTGAGGG - Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173476903 20:43365948-43365970 TGGGGCGTGGAGAAGGCAGAGGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173620125 20:44430156-44430178 CTGAGCAAGGTGACAGCAGAGGG - Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173850451 20:46214550-46214572 ATGAGGCTGGAGAAGCCAGAAGG - Intronic
1173909650 20:46656874-46656896 CAGCAAATGGAGAAGGCAGAAGG - Intronic
1173966360 20:47115679-47115701 CTGAGGGTGGTGGAGGCAGAGGG - Intronic
1174188453 20:48723265-48723287 CTGAATCTGGAGAAGCCAGAGGG + Intronic
1174516419 20:51095760-51095782 CTGAACATGACGAAGGCAGCTGG - Intergenic
1175476639 20:59280016-59280038 TTCTGCTTGGAGAAGGCAGATGG + Intergenic
1176072228 20:63233266-63233288 CTCAGCGGGGAGAAGGCATATGG + Intergenic
1177216020 21:18130042-18130064 CGGAGCAAGGAGAAGGAATAGGG + Intronic
1177925087 21:27204058-27204080 CTGATCACTGGGAAGGCAGAAGG + Intergenic
1178343877 21:31808485-31808507 CTAACCGTGGAGAGGGCAGAAGG + Intergenic
1178462820 21:32818466-32818488 GTGAGGATGGAGCAGGGAGAAGG - Intergenic
1178566026 21:33686542-33686564 CTGAAAATGGAGAGGCCAGAAGG - Intronic
1179111182 21:38446878-38446900 GGGGGCAAGGAGAAGGCAGATGG - Intronic
1179884747 21:44309071-44309093 CTGAGCTTGGAGGAGGCAGAGGG + Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180629016 22:17214498-17214520 CTGATCCTGGAGAAGACAGCTGG - Intronic
1180663168 22:17486794-17486816 GTGAGCAGGGAGAAGACAGAAGG + Intronic
1180785060 22:18542527-18542549 CACAGCCTGGAGCAGGCAGAAGG - Intergenic
1180820183 22:18821721-18821743 CTGAGCATGGGTGTGGCAGAAGG - Intergenic
1181112139 22:20608454-20608476 CTCAGCATTGAGAGGGCAGGGGG + Intergenic
1181241963 22:21481881-21481903 CACAGCCTGGAGCAGGCAGAAGG - Intergenic
1181467709 22:23118986-23119008 CAGAGCATGGACAGGTCAGAGGG + Intronic
1182556979 22:31134416-31134438 CTGAGGGTGGGGTAGGCAGATGG + Exonic
1183256794 22:36767507-36767529 CTCAGCATGCAGAAGTCAGAGGG + Intronic
1183422442 22:37719806-37719828 GTGTGCAGGGAGAAGACAGAAGG - Intronic
1183948761 22:41341065-41341087 CTGGGCAGGGAGAAGACACAGGG - Intronic
1183983332 22:41555413-41555435 CTCAGCATTGAGAAGGCTGGAGG + Intergenic
1184048475 22:41987372-41987394 CAGAGCATGGAGGGTGCAGATGG - Intronic
1184345200 22:43908888-43908910 CTGAGCATGGTGGAGGGAGTCGG - Intergenic
1184903489 22:47463077-47463099 CTGAGCATGGAGTGTGCAGGGGG + Intronic
1203220514 22_KI270731v1_random:39230-39252 CTGAGCATGGGTGTGGCAGAAGG + Intergenic
1203270310 22_KI270734v1_random:47592-47614 CTGAGCATGGGTGTGGCAGAAGG - Intergenic
950898623 3:16476190-16476212 CTCAAGATGGAGAAGGCAGAGGG + Intronic
951584470 3:24201329-24201351 TTGAGCATGGAGGAGGCAGGGGG - Intronic
952561257 3:34596125-34596147 CTTAGCATTCAGTAGGCAGATGG + Intergenic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953022868 3:39127088-39127110 CTGGGCCTTGAGAAGGGAGAAGG - Intronic
953325701 3:42010803-42010825 CTCAGCTTGGAGGAAGCAGATGG - Intergenic
953381520 3:42476236-42476258 CAGAGGATGGAGAAGTCAGGAGG + Intergenic
954227440 3:49191373-49191395 CTGAGCATGGGAAATACAGATGG + Intronic
954314837 3:49795509-49795531 CTGGTCTTGGAGAAGGCAGCAGG - Intronic
954874622 3:53793540-53793562 AGGAGCGTGGAGAAGGCACATGG - Intronic
955805154 3:62726022-62726044 CTGAGAAGGGAGGAGGCTGACGG + Intronic
956711149 3:72039842-72039864 GTGAGGCTGGAGAAGGCAGCAGG - Intergenic
956901047 3:73716448-73716470 TCAAGCATGGAGCAGGCAGAGGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
959027374 3:101255658-101255680 CTAACCATGGAGATGGCATATGG - Intronic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959591784 3:108090459-108090481 CTAAGCACTGAGAAGGGAGAGGG + Intronic
959947032 3:112136006-112136028 TTGAGCATGGAGACTGCACATGG - Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961235401 3:125362071-125362093 GTGGGCATGGAGAAAACAGATGG - Intronic
961426008 3:126848650-126848672 CTGGGGGTGGAGAAGGTAGAGGG + Intronic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
962064171 3:131961862-131961884 CTGAGTAGGGAAAAGGGAGAAGG - Intronic
962082746 3:132157787-132157809 CTGCATATGGGGAAGGCAGAAGG - Intronic
962479605 3:135787111-135787133 CTGAGCATGGTGGAAGAAGAGGG - Intergenic
962662613 3:137619038-137619060 CTAAGGATGGAGAAGGAAGGTGG + Intergenic
963017502 3:140839839-140839861 CAGCCCAGGGAGAAGGCAGAGGG - Intergenic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
964633959 3:158841205-158841227 CTGAGAAAGCAGAAAGCAGATGG + Intergenic
966196314 3:177317506-177317528 CTCATCATGGAGAAGGGATATGG + Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
968276218 3:197442306-197442328 GTGGGGAGGGAGAAGGCAGATGG + Intergenic
968883581 4:3314991-3315013 CTGGGCACGAAGCAGGCAGAGGG + Intronic
969560422 4:7943277-7943299 GTGACCAGGGAGAAGGCAGCTGG - Intergenic
969880303 4:10167783-10167805 TTGAGTATGGAGAAGTCAGGAGG - Intergenic
970088665 4:12377812-12377834 TTGAGCAATGAGGAGGCAGAGGG + Intergenic
970641888 4:18075988-18076010 CTGAGCGTGGAGGAGGAAGAGGG + Intergenic
970651895 4:18187921-18187943 CTGAGGATGGTGGAGGGAGATGG - Intergenic
970707598 4:18823231-18823253 CTTAGCATGGAAAAGCCACAAGG + Intergenic
971093302 4:23370344-23370366 CTCTGCATGGAAAAAGCAGATGG + Intergenic
971364158 4:25963576-25963598 CTGAGTAGGGAGTAGGAAGATGG - Intergenic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975931022 4:79522735-79522757 CAGAGCCTGGAGAGGGGAGAAGG + Intergenic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
978400647 4:108326747-108326769 CTCAGCATTGAGAAGACAGGAGG - Intergenic
979187232 4:117812257-117812279 TCTAGCTTGGAGAAGGCAGAAGG - Intergenic
979684106 4:123492520-123492542 GTGTGAATGTAGAAGGCAGAAGG - Intergenic
980099515 4:128527672-128527694 CTGTGCGTGGAGAGAGCAGAGGG + Intergenic
980897481 4:138874112-138874134 AGCAGCATGGAGAAGGCAGCTGG - Intergenic
980938934 4:139254178-139254200 CTGAGCAAGGAGACAGAAGATGG + Intergenic
981954600 4:150454730-150454752 CTTAGAAGGGAGAAGGCTGAGGG - Intronic
982714517 4:158792807-158792829 CTTAGAATGGAGAAGGTAAATGG + Intronic
983301067 4:165926530-165926552 CTCAGGAAGCAGAAGGCAGAGGG + Intronic
983656326 4:170089142-170089164 GTGACCAAAGAGAAGGCAGAGGG + Intronic
984153175 4:176160166-176160188 TTGAGCATGTAGAAGGGAGAAGG + Intronic
984782875 4:183541839-183541861 CTGTGCAAGGGGAATGCAGAAGG - Intergenic
985170760 4:187147380-187147402 GGGAGCATGCACAAGGCAGAAGG + Intergenic
985588799 5:754384-754406 CTGAGCATGGTGGAGGCACAAGG - Intronic
985603448 5:846706-846728 CTGAGCATGGTGGAGGCTCAAGG - Intronic
985673938 5:1220678-1220700 ATCAGGATGGAGCAGGCAGAAGG - Intronic
986178584 5:5372867-5372889 CTGAGGAGGCAGAAGGCAGAAGG + Intergenic
986301078 5:6478930-6478952 CTGAGCAGGAAGGAAGCAGAGGG - Intronic
986408689 5:7453526-7453548 CTTAGGAGGCAGAAGGCAGAAGG + Intronic
986667189 5:10114148-10114170 CTGTACATGGGGCAGGCAGAAGG + Intergenic
988129859 5:27089903-27089925 CAGAGCATGGGGAAACCAGAGGG + Intronic
989962298 5:50430765-50430787 CTGAGCCTGGAGGTGGAAGAAGG + Intronic
990289600 5:54334662-54334684 CTGAGAATGGGGATGTCAGATGG - Intergenic
990336273 5:54775820-54775842 GTGAGCATGTAGCTGGCAGATGG - Intergenic
990504126 5:56427794-56427816 CTGGGGTGGGAGAAGGCAGAGGG - Intergenic
990616052 5:57509445-57509467 CTGAACATGGTGAAGCCAGCAGG - Intergenic
990641016 5:57783577-57783599 CTTAGAATGGACAAGGGAGAGGG + Intergenic
990933872 5:61125630-61125652 CTGTGTATTGACAAGGCAGATGG + Intronic
991224837 5:64258028-64258050 CTTTGCATGGGAAAGGCAGAGGG + Intronic
991617797 5:68515343-68515365 CTGAGCATGGAGGAACCAGATGG - Intergenic
993227034 5:85180790-85180812 CTGAGGAATGAAAAGGCAGAAGG + Intergenic
993576557 5:89609279-89609301 CTGACCATGAAGAAGGTAGCAGG - Intergenic
994735078 5:103543368-103543390 GTGAGCACGGAGAAGGTAAAAGG + Intergenic
995544298 5:113214882-113214904 TAGAGCATGGGGAAGGTAGAAGG - Intronic
996063045 5:119052860-119052882 GTGAAAATGTAGAAGGCAGAGGG + Intronic
996343454 5:122464256-122464278 CTGAGATTTGAGAAGGCAGAAGG - Intergenic
996620293 5:125493219-125493241 CTGAGCATGGGGAAGGTATTAGG + Intergenic
996817247 5:127587851-127587873 CTGGGCCTGGATTAGGCAGAGGG + Intergenic
997582023 5:135024216-135024238 TGGAGCAGGGAGGAGGCAGAGGG - Intergenic
997737670 5:136225993-136226015 ATGAGGCTGGAGAAGGCAGCAGG - Intronic
998006917 5:138663177-138663199 ATGAGGATGGAGATGGCAGCTGG - Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998166269 5:139846177-139846199 TTCAGTATGGAGAAGGCAGATGG - Intergenic
998648285 5:144089059-144089081 ATGAGCAGGAAGAAGGCAGTGGG - Intergenic
999450008 5:151670890-151670912 CTGAAGATGGAGAAGCCAGATGG + Intronic
999795454 5:154985266-154985288 CTGAGCTTGCAGAATGCACAGGG - Intergenic
1001753300 5:174147710-174147732 CTGAGCATGGTGCAGGGAGGAGG - Intronic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002742699 5:181445025-181445047 CTGGGCATGGACACTGCAGAGGG + Intergenic
1003006392 6:2386528-2386550 CTGAACCTGTAGAAGGCCGAGGG + Intergenic
1003442349 6:6154933-6154955 CATACCATGGAGAAGACAGATGG - Intronic
1004192774 6:13478616-13478638 CTGAGCAGGGAGAAAGCATCTGG + Intronic
1005426348 6:25706679-25706701 CTGAGCAGGGAGAAAGGAGTGGG + Intergenic
1005821440 6:29602868-29602890 CTGAACATGAAGAAAGCATACGG + Exonic
1006586393 6:35117381-35117403 CCCAGAATGGAGAAGCCAGAAGG + Intergenic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1007112649 6:39321888-39321910 ATGAGCTGGGAGAGGGCAGAAGG + Intronic
1007348124 6:41248462-41248484 CTGAGCTTAGGGCAGGCAGAGGG + Intergenic
1007357978 6:41334701-41334723 CTGAGAATGGGAAAGGCAGAGGG - Intergenic
1007807691 6:44462799-44462821 CTGGGGATGGAGACTGCAGAGGG - Intergenic
1008489645 6:52072806-52072828 CTGAGCATTTATAAGGTAGAAGG - Intronic
1009050579 6:58271013-58271035 GTGAGCACCGAGAAGCCAGATGG + Intergenic
1009239840 6:61171371-61171393 GTGAGCACCGAGAAGCCAGATGG - Intergenic
1010577074 6:77544839-77544861 CTGAGCAGGGAGAAGTGAAAGGG + Intergenic
1011027527 6:82885696-82885718 CTGAGCACTGAGAAGTCAGGAGG + Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011955630 6:93021735-93021757 CTAACCAGGGAGTAGGCAGATGG - Intergenic
1013117175 6:107112470-107112492 CTGGGCATGGAGAAGGTAGGCGG + Intronic
1013332585 6:109119716-109119738 CTGGGCCTGGAGAAGGCATTAGG + Intronic
1015037613 6:128676282-128676304 TGGAGATTGGAGAAGGCAGAGGG - Intergenic
1015118480 6:129675620-129675642 CTAAGCAGGGAAAAGGCAGGTGG - Intronic
1015747010 6:136520888-136520910 AAGAGGATGGAGAAGGCAAAAGG + Intronic
1015769332 6:136752903-136752925 ATGAGCATGTACCAGGCAGAGGG - Intronic
1016915636 6:149241971-149241993 CAGAGCCTGGGGAAGGCAGTGGG - Intronic
1017305017 6:152907429-152907451 CAGATCATAGAGAAAGCAGATGG + Intergenic
1017780992 6:157715165-157715187 CTGAGCGTGAGGAAGGCATAGGG - Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018918577 6:168154697-168154719 GTGGGCATGCACAAGGCAGAAGG + Intergenic
1019258152 7:64726-64748 CTGAGCAAGAAGAAGGGAGGGGG - Intergenic
1019315603 7:383710-383732 CTGAGCATTGAAAAATCAGATGG + Intergenic
1020208539 7:6139699-6139721 CAGGGCAGGGAGAATGCAGAGGG - Intronic
1022388375 7:29922820-29922842 CTTAGCATTGGGAAGACAGAGGG - Intronic
1022467507 7:30661522-30661544 CAGAGCCTGGAGAGAGCAGAGGG - Intronic
1022468085 7:30664825-30664847 CAGAGCCTGGAGAGAGCAGAGGG + Intronic
1023725065 7:43134822-43134844 GTGATCATGGAGAAGTCTGAGGG + Intronic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024799504 7:53059715-53059737 CTCAGTAAGGAAAAGGCAGAGGG - Intergenic
1024839123 7:53563844-53563866 GTGATCATGAAAAAGGCAGATGG + Intergenic
1024944608 7:54796245-54796267 CAGGGCATAGAGAAAGCAGAGGG + Intergenic
1025025852 7:55515451-55515473 CTGAGCTTGGAGAAGACCGGGGG - Intronic
1025061309 7:55810941-55810963 CTGTACAAGGAAAAGGCAGAAGG - Intronic
1025119764 7:56291440-56291462 CTGATCATGAAGTAGGCACAGGG - Intergenic
1025977148 7:66378292-66378314 CTGGGCCTGGAGAAGGCACAGGG + Intronic
1026345077 7:69466666-69466688 CTCATAATGGTGAAGGCAGATGG - Intergenic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027421823 7:78024367-78024389 GTGGACATCGAGAAGGCAGATGG - Intronic
1027498234 7:78915167-78915189 CTCATGATGGAGAAAGCAGAGGG + Intronic
1028324011 7:89499303-89499325 CTGAGCATGGAGGGTGCAGAAGG + Intergenic
1030087119 7:105825910-105825932 CTGAGAATGGAGAAGCCATAGGG + Intronic
1030516953 7:110550607-110550629 CTCAGCATGGAAAAGCCACAAGG - Intergenic
1032518326 7:132523457-132523479 CTTGGCAAGGAAAAGGCAGAAGG + Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033034007 7:137854094-137854116 CTAAGCATGAAGAAGGAAAAGGG - Intergenic
1033591766 7:142814436-142814458 CAGAGCATGGCAAAGACAGAGGG - Intergenic
1033786218 7:144734113-144734135 GTGAGCATAGAGAAGAGAGAGGG - Intronic
1034500338 7:151446713-151446735 GTGGGCATGGAGAAGGAAGTGGG - Intergenic
1036547142 8:9782802-9782824 CTAGGCATGGAGAAAGAAGAGGG - Intergenic
1037719129 8:21427917-21427939 ATGGGAATGGAGAAGGGAGAAGG - Intergenic
1037804427 8:22051102-22051124 GTGAGCATGGAGTAGCCACAGGG + Intronic
1038251686 8:25911049-25911071 CTGAGCATGGTGGATGGAGAGGG - Intronic
1038397357 8:27257156-27257178 TGGAGCAGTGAGAAGGCAGAGGG - Intronic
1039144141 8:34426597-34426619 CTGAAACTGAAGAAGGCAGATGG - Intergenic
1039800521 8:40950660-40950682 ACGTGCATGGAGAAAGCAGAAGG + Intergenic
1040414536 8:47184429-47184451 GAGAGCCTGGAGAGGGCAGAAGG - Intergenic
1040587845 8:48760892-48760914 CTAAGCACAGAGAAAGCAGAGGG - Intergenic
1041191411 8:55359164-55359186 AAAAGCACGGAGAAGGCAGAAGG + Intronic
1041268334 8:56086099-56086121 AGGAGGATAGAGAAGGCAGAAGG - Intergenic
1044838414 8:96317240-96317262 CTGGGCATGGGAAAGGCACAAGG - Intronic
1045829032 8:106435772-106435794 CTGAGCCTTGAGAAGATAGAGGG - Intronic
1046517008 8:115275694-115275716 CTGAGCCTGCAGAGGACAGAAGG + Intergenic
1047367885 8:124228996-124229018 GTGAGCTTGGAGAAAGTAGAAGG + Intergenic
1047767395 8:128000928-128000950 TTGAACATGGAAAAGGCACAAGG - Intergenic
1048045647 8:130770304-130770326 CTGGGGAGGGAGAAGGCAGGAGG + Intergenic
1048638151 8:136322611-136322633 CTTATCATGGGGATGGCAGATGG + Intergenic
1048871284 8:138801481-138801503 CTGAGCACTGAGAACACAGAAGG + Intronic
1049080150 8:140436589-140436611 CTGAGCATGGAAGAGGCCCACGG + Intronic
1049272679 8:141704312-141704334 CTGAGCATGGTGGGGGCTGATGG - Intergenic
1049298181 8:141854948-141854970 CTGAGCATGGCCAAGGCCAAGGG + Intergenic
1049600137 8:143503814-143503836 CTGAACATGGAGGAGGCGGTGGG - Intronic
1049612430 8:143561783-143561805 CTCATCATGGAGAGGCCAGAGGG - Exonic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051299769 9:15636196-15636218 CTGGGTATGGAGTAGGTAGATGG + Intronic
1051736985 9:20210450-20210472 ATCATCATGCAGAAGGCAGAAGG + Intergenic
1053141503 9:35685398-35685420 CTGGGCAGCGAGCAGGCAGAGGG + Intronic
1054766178 9:69044463-69044485 CTCAGAAAAGAGAAGGCAGAAGG - Intronic
1055645353 9:78357357-78357379 CTGAGATTGGAGCAGGCAGCAGG - Intergenic
1056254370 9:84783656-84783678 AAGAGCATGGAGAAGAGAGAGGG + Intronic
1056716816 9:89038117-89038139 ATGAGCAGGAAGGAGGCAGAGGG - Exonic
1057194291 9:93108184-93108206 GTGAGGAGGGAGGAGGCAGAGGG + Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058348234 9:103990362-103990384 CTGTGCATGAAGAAGCCAAATGG + Intergenic
1058405697 9:104671357-104671379 TTTAGCATGGAGAATGAAGAAGG + Intergenic
1058648995 9:107157462-107157484 AGGAGCATGGAGACAGCAGAGGG - Intergenic
1058940953 9:109812224-109812246 CTGAGAAGGGAGAAGGGAGGAGG + Intronic
1059214738 9:112550591-112550613 CAGTGCAGGGAAAAGGCAGACGG + Intronic
1059659300 9:116385735-116385757 CTGAGGGTGCAGAATGCAGATGG + Intronic
1059698857 9:116755822-116755844 CTGAGTACGGAAGAGGCAGAAGG + Intronic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060722052 9:125986061-125986083 CTAGGCATGGAGAACACAGACGG - Intergenic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1186256737 X:7730239-7730261 CTGAGAAGGGAGAAGTCACATGG + Intergenic
1186653526 X:11587962-11587984 GTGTTCATGGAGAACGCAGAGGG - Intronic
1188260247 X:28015619-28015641 CTGAGCATGGACAAGGCCAGGGG - Intergenic
1188805195 X:34579289-34579311 CTGAGCATGGAAAAGGAATTTGG - Intergenic
1188820603 X:34770362-34770384 GTGAACATGGACAAGGCAGGGGG - Intergenic
1189206468 X:39243508-39243530 CTGAACAGGGAGTAGGGAGACGG - Intergenic
1189261360 X:39681051-39681073 CAGAGCATGGAGGGGGAAGAAGG - Intergenic
1189414782 X:40804190-40804212 CTGAGGATGGAGAAGAGAGCTGG + Intergenic
1189469316 X:41301702-41301724 CTCAGCATAAAGAAGCCAGAGGG - Intergenic
1191717573 X:64204238-64204260 GTGGGCATGGGCAAGGCAGAGGG - Intronic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1192867855 X:75154920-75154942 CTAAGCATGTGGAAGGCTGATGG - Intronic
1192905423 X:75545963-75545985 CTGTGCATGGCTAAGGCAAATGG + Intergenic
1193470736 X:81899576-81899598 CTGAGCATCGAGATTGCAGAAGG - Intergenic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1196066608 X:111471196-111471218 CTGAGCCTGGAAAAGCCACAAGG - Intergenic
1196558154 X:117115959-117115981 CAGGGGATGGAGAAAGCAGAAGG - Intergenic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1196934275 X:120714088-120714110 CAGAAAATGGGGAAGGCAGAAGG - Intergenic
1197284032 X:124574343-124574365 CTAATATTGGAGAAGGCAGAGGG - Intronic
1198233979 X:134718844-134718866 GTGAGCATGGAAAAGGAAGAGGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199368679 X:147019718-147019740 CTGAGGATTTAGAAGGCTGAAGG + Intergenic
1199811335 X:151352812-151352834 CTGTGAATGGGGAAAGCAGAAGG + Intergenic
1199833553 X:151566389-151566411 CTCTGGAAGGAGAAGGCAGAGGG + Intronic
1200154004 X:153965643-153965665 CTCAGCAAGCAGACGGCAGAAGG + Intronic