ID: 959137087

View in Genome Browser
Species Human (GRCh38)
Location 3:102436855-102436877
Sequence CTTAGGATACACCTCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959137084_959137087 5 Left 959137084 3:102436827-102436849 CCAACTTAAATTCCTGATTCTGT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 959137087 3:102436855-102436877 CTTAGGATACACCTCTGTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 78
959137083_959137087 20 Left 959137083 3:102436812-102436834 CCACAAAATAACTCACCAACTTA 0: 1
1: 0
2: 1
3: 29
4: 230
Right 959137087 3:102436855-102436877 CTTAGGATACACCTCTGTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 78
959137086_959137087 -7 Left 959137086 3:102436839-102436861 CCTGATTCTGTAATTTCTTAGGA 0: 1
1: 0
2: 1
3: 24
4: 234
Right 959137087 3:102436855-102436877 CTTAGGATACACCTCTGTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959137087 Original CRISPR CTTAGGATACACCTCTGTGT TGG Intronic
901715621 1:11151404-11151426 AACAGGATAAACCTCTGTGTTGG + Intronic
915962507 1:160278945-160278967 CTTAGGATTCTCCTCTCTCTAGG - Exonic
918586220 1:186192046-186192068 CTTAGGATACACGGCAGGGTGGG + Intergenic
921414843 1:214873809-214873831 CTTACCATACACCTCTCTGATGG + Intergenic
923300080 1:232632096-232632118 ATGAGGATACACCTGTGAGTTGG - Intergenic
1065911975 10:30315364-30315386 CTTGGGATAGCCCTCTGTTTGGG - Intronic
1070184864 10:74051792-74051814 CTTGGGATAAACCTCAGTTTTGG - Intronic
1071683052 10:87726999-87727021 CTTTGGAAACGCCTCTTTGTGGG - Intronic
1078179934 11:9003372-9003394 ATTAGGAATCACCTCTGTCTGGG + Intronic
1078875182 11:15387287-15387309 TTGAGGATTCACCTCTTTGTGGG - Intergenic
1082739267 11:56892456-56892478 CTTAGGATTTACCTATGTCTAGG + Intergenic
1082854631 11:57795641-57795663 CTCAGGATCCTCCTCCGTGTAGG - Exonic
1085014235 11:73162446-73162468 CTCAGAAAAGACCTCTGTGTGGG - Intergenic
1085338059 11:75712506-75712528 CTTAGAATACACCACTATGCTGG + Intergenic
1087944098 11:104137234-104137256 TTTAGGATACAGCTCTGTATTGG - Intronic
1088804693 11:113341519-113341541 CTTAGGATACCCGTGTGGGTTGG + Intronic
1092484947 12:8894611-8894633 CTTAGCATAGACATTTGTGTAGG - Intergenic
1094356212 12:29580470-29580492 CTTAAGATAGAACTTTGTGTTGG - Intronic
1094395458 12:30000633-30000655 CTTAGCATAAGCCTTTGTGTTGG - Intergenic
1097865418 12:64555935-64555957 TTCAGGATACACCTCTGCATAGG + Intergenic
1099023643 12:77438074-77438096 CTGAGCATACACCTCTGGGTGGG - Intergenic
1101281512 12:103262306-103262328 ATTATGATACACCTCTATGGTGG + Intronic
1109444891 13:62422836-62422858 CTTATGATACAAATCTGTGTTGG + Intergenic
1109776560 13:67048526-67048548 CTGAGAATATACATCTGTGTGGG - Intronic
1110932939 13:81246233-81246255 CTTAAGATACACCTTAGTCTGGG + Intergenic
1111435835 13:88206771-88206793 CTTAAGATAAATCTTTGTGTGGG - Intergenic
1111817386 13:93170493-93170515 CTTAGAATTCACTTCTTTGTGGG + Intergenic
1114657374 14:24324186-24324208 TTCAGGACACACCTCTGTGGAGG + Exonic
1118129762 14:62949704-62949726 CTTAGGATACACTTTTGTATAGG - Intronic
1118968833 14:70614072-70614094 CTAAGGCTACACCCCTGTCTAGG - Intergenic
1122795224 14:104202694-104202716 CTTAGGGTACTCCTCTCTGTAGG + Intergenic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1140383121 16:74508719-74508741 CTTAGAATTCACATCTGTCTTGG - Intronic
1147626153 17:41901527-41901549 TTTAGGATAGCACTCTGTGTTGG + Intronic
1157905388 18:51564852-51564874 CTTAGGATGGATCTCTGAGTTGG + Intergenic
1158632621 18:59129333-59129355 CTTTGGAATCACCTCTATGTGGG + Intergenic
1164682674 19:30146044-30146066 ATTAGGATGCGCCTGTGTGTGGG - Intergenic
925313298 2:2903207-2903229 CTTGGGATATAGCTCTGTGATGG - Intergenic
936958295 2:118045517-118045539 CTTATGCTACTTCTCTGTGTTGG + Intergenic
939775571 2:146383495-146383517 CTGAGAATACACCTTTGGGTGGG + Intergenic
946021420 2:216642894-216642916 CTGAGGCTACATCTCTGGGTGGG + Intronic
947314041 2:228835785-228835807 CTTTGGATACAACTTTTTGTTGG + Intergenic
1169790149 20:9401706-9401728 CTTAGGATACGAGTCTGTGCTGG + Intronic
1177907689 21:26991988-26992010 CTTGCGATACACCCCAGTGTTGG + Intergenic
1178990699 21:37353212-37353234 CTGAGTTTACACCTCTGTCTTGG - Intergenic
1179406437 21:41130034-41130056 ATTATGATACATCTCAGTGTGGG - Intergenic
1182155990 22:28073473-28073495 CATAGCACACACCTCTGTGTGGG - Intronic
1182349117 22:29688784-29688806 CTTTCGTTCCACCTCTGTGTAGG + Intronic
1182604455 22:31492322-31492344 CTTAGACTCCACCTCTATGTGGG + Intronic
1182711150 22:32324043-32324065 CTGGGGATACACCTCCGTTTGGG + Intergenic
1184398679 22:44260918-44260940 CTGGGGATACATCTCTGTTTGGG + Intronic
952388576 3:32860686-32860708 CTCAGGTTACTCCCCTGTGTAGG + Intronic
957144295 3:76403122-76403144 CTTGGCATAAACCTCTGTGGGGG + Intronic
959137087 3:102436855-102436877 CTTAGGATACACCTCTGTGTTGG + Intronic
960182673 3:114600035-114600057 CTCAAGATAAACCTCTGTGATGG - Intronic
960768555 3:121166080-121166102 CAGAGGTTACACCTCTGTGGTGG - Intronic
961087852 3:124084428-124084450 CTGAGGATACCCCTCCGTGCTGG - Intronic
963916928 3:150867327-150867349 CTCAGGAGACACCTCTTGGTAGG - Intergenic
964569931 3:158099522-158099544 CTTAGGACTAACCTCTGTATTGG + Intronic
966813894 3:183873162-183873184 TTTATGATACACCTTTGTTTTGG - Intronic
972386583 4:38572382-38572404 TTTGGGATACACCATTGTGTTGG - Intergenic
972639364 4:40911694-40911716 CTCAGGATGCACCTCTGTTGAGG - Intronic
975459983 4:74640035-74640057 CTTATGAAACACCACTGTCTTGG + Intergenic
975987100 4:80210786-80210808 CTGAGGATTCATCTCTGGGTGGG + Intergenic
977820277 4:101463584-101463606 CTGAGGATAGAATTCTGTGTTGG + Intronic
979021301 4:115501838-115501860 CTTAGAATTCAGCTGTGTGTTGG + Intergenic
979093675 4:116518264-116518286 CTTAGGATACACATAGGAGTGGG + Intergenic
989550755 5:42733632-42733654 CTTAGGATCAACATCTGTGGCGG + Intergenic
990024981 5:51176526-51176548 CTCAGGAGGCACCACTGTGTTGG - Intergenic
994428861 5:99629330-99629352 CTAAGGATACAACTCAGAGTGGG - Intergenic
997628342 5:135347072-135347094 CTTAAGATTCACATCTGTCTTGG + Intronic
1004039344 6:11960457-11960479 CTGAACACACACCTCTGTGTTGG - Intergenic
1005021858 6:21425809-21425831 ATTAGTGTACACCTCTGTGTAGG + Intergenic
1007143367 6:39600680-39600702 CTTAGGACACACCTATTTTTAGG - Intronic
1010604342 6:77869693-77869715 GTTAGGATGGACCTCTCTGTTGG + Intronic
1023287959 7:38638365-38638387 CTTCAGAAACACCTCAGTGTAGG - Intergenic
1029279101 7:99425281-99425303 CTTAGTATCCACCTCTGGTTGGG + Exonic
1033498951 7:141928222-141928244 ATTAGGAGACACTTCTGTGCAGG - Exonic
1042871471 8:73404083-73404105 CATTGGATACACATTTGTGTAGG - Intergenic
1046208199 8:111031922-111031944 CTTAGGATTCATCTCTGTATGGG - Intergenic
1049135609 8:140895585-140895607 CTAAGAATACACATCTGTGAAGG + Intronic
1056389129 9:86124282-86124304 CCTTGGACACACGTCTGTGTTGG - Intergenic
1060228242 9:121809079-121809101 CCTAGGATGCCCCTCTGTGAGGG + Intergenic
1061720678 9:132549242-132549264 GTTCGGATACACCTTTGTGGGGG - Intronic
1192115810 X:68409832-68409854 CTTAGGAAACTCCTTTATGTGGG + Intronic
1192159855 X:68776383-68776405 CTTGGGAGACACCTCCCTGTAGG + Intergenic
1199392133 X:147292423-147292445 CATAGGATTCATCTCAGTGTTGG + Intergenic
1200299620 X:154959510-154959532 TTCAGGATACACCTTTGTGTTGG + Intronic