ID: 959137087

View in Genome Browser
Species Human (GRCh38)
Location 3:102436855-102436877
Sequence CTTAGGATACACCTCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959137086_959137087 -7 Left 959137086 3:102436839-102436861 CCTGATTCTGTAATTTCTTAGGA 0: 1
1: 0
2: 1
3: 24
4: 234
Right 959137087 3:102436855-102436877 CTTAGGATACACCTCTGTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 78
959137084_959137087 5 Left 959137084 3:102436827-102436849 CCAACTTAAATTCCTGATTCTGT 0: 1
1: 0
2: 3
3: 26
4: 250
Right 959137087 3:102436855-102436877 CTTAGGATACACCTCTGTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 78
959137083_959137087 20 Left 959137083 3:102436812-102436834 CCACAAAATAACTCACCAACTTA 0: 1
1: 0
2: 1
3: 29
4: 230
Right 959137087 3:102436855-102436877 CTTAGGATACACCTCTGTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959137087 Original CRISPR CTTAGGATACACCTCTGTGT TGG Intronic