ID: 959140516

View in Genome Browser
Species Human (GRCh38)
Location 3:102480936-102480958
Sequence TAGCCAGAAGAGGATTCGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959140514_959140516 -7 Left 959140514 3:102480920-102480942 CCGTGTTTTGCTGAGATAGCCAG 0: 1
1: 0
2: 0
3: 14
4: 139
Right 959140516 3:102480936-102480958 TAGCCAGAAGAGGATTCGTTTGG 0: 1
1: 0
2: 0
3: 6
4: 104
959140511_959140516 11 Left 959140511 3:102480902-102480924 CCCCAGAGAAAAAGAATGCCGTG 0: 1
1: 0
2: 0
3: 17
4: 202
Right 959140516 3:102480936-102480958 TAGCCAGAAGAGGATTCGTTTGG 0: 1
1: 0
2: 0
3: 6
4: 104
959140512_959140516 10 Left 959140512 3:102480903-102480925 CCCAGAGAAAAAGAATGCCGTGT 0: 1
1: 0
2: 2
3: 12
4: 197
Right 959140516 3:102480936-102480958 TAGCCAGAAGAGGATTCGTTTGG 0: 1
1: 0
2: 0
3: 6
4: 104
959140513_959140516 9 Left 959140513 3:102480904-102480926 CCAGAGAAAAAGAATGCCGTGTT 0: 1
1: 0
2: 0
3: 15
4: 155
Right 959140516 3:102480936-102480958 TAGCCAGAAGAGGATTCGTTTGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959140516 Original CRISPR TAGCCAGAAGAGGATTCGTT TGG Intergenic
900863193 1:5247292-5247314 TACCTAGGAGTGGATTCGTTGGG + Intergenic
909233278 1:73119077-73119099 TAGCCAGAAGTGGTGGCGTTCGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
921610760 1:217209672-217209694 TACCCAGAAGAGGCATTGTTGGG + Intergenic
1067152833 10:43750783-43750805 TACCCAGAAGTGGAATTGTTGGG + Intergenic
1069108639 10:64414995-64415017 TAGACAAAAGAGGAATCTTTTGG + Intergenic
1070356995 10:75649666-75649688 TACCCAGAAGAGGAATTGCTGGG + Intronic
1071151209 10:82636757-82636779 TACCCAGAAGAGGAATTGCTGGG + Intronic
1073658723 10:105448171-105448193 TGTCCAGAAGAGTATTCCTTAGG + Intergenic
1078712346 11:13806474-13806496 TAGCCAGAAGTGGAATTGCTGGG - Intergenic
1079135474 11:17774014-17774036 AAGCCAGAAGAGGATTGGGATGG - Intronic
1081778653 11:45694684-45694706 CAGCCAGCAGAGGTTTAGTTAGG - Intergenic
1082945943 11:58760078-58760100 TATCCAGAAGAGGGATTGTTGGG + Intergenic
1086929770 11:92680190-92680212 TACCCAGAAGAGTTTTCTTTAGG + Intronic
1087957498 11:104306815-104306837 AAGCCAGAAGAGAATTCTTTAGG - Intergenic
1093385559 12:18548918-18548940 TATCCAGAAAAGGATTCATGTGG - Intronic
1097530122 12:60789392-60789414 TAGCCAGAAGTGGAATTGCTGGG - Intergenic
1098459975 12:70721811-70721833 TATCCAGGAAAGGAATCGTTGGG + Intronic
1098498559 12:71165163-71165185 TAGACACAAGAGGATTTGGTGGG - Intronic
1099924693 12:89003026-89003048 TACCTAGAAGAGGATTTGCTGGG + Intergenic
1100340673 12:93676820-93676842 TAGTCAGAAAGGGATTCGTTAGG - Intergenic
1100539572 12:95545399-95545421 TAGCCTGTAGAGGATCTGTTTGG - Intronic
1107311053 13:39078461-39078483 AAGCCAGAAGAGTATTTCTTAGG - Intergenic
1108877300 13:55061871-55061893 TACCCAGAAGAGAATTTGCTCGG - Intergenic
1108892944 13:55284558-55284580 TAGCCAGAAGTGGAATTGCTAGG - Intergenic
1108981976 13:56525314-56525336 TAGCCATAAGACTATTCTTTTGG - Intergenic
1110023139 13:70501409-70501431 TGCCCAGAAGAGGAATTGTTGGG - Intergenic
1110369122 13:74720080-74720102 TAGACAGAAAAGGATTATTTAGG + Intergenic
1110755577 13:79170287-79170309 TAGCAAGAAGAGGAATCATGAGG + Intergenic
1117814851 14:59586803-59586825 CAGCCAGAAGAGGATGCCCTTGG + Intergenic
1131354647 15:91734199-91734221 TAGCCAGATGAGGCTTGGTAAGG - Intergenic
1132682246 16:1147486-1147508 TAGCAAGCAGAGGGTTTGTTTGG - Intergenic
1135843051 16:25893933-25893955 CAGCCAGTAGAGGATTGCTTGGG + Intronic
1136287433 16:29252805-29252827 TCGCCAGAAGGGAATTCGGTGGG + Intergenic
1138245872 16:55466992-55467014 TAGCCAGAAGTGGGGTCCTTGGG - Intronic
1139189614 16:64847046-64847068 TAGCCAGAAGTGCATTGGTGTGG - Intergenic
1139703553 16:68724914-68724936 GAGCCAGCAGAGGGTTGGTTGGG + Intergenic
1141638856 16:85329676-85329698 GAGCCAGCCGAGGATTCCTTGGG + Intergenic
1142928171 17:3259432-3259454 TAGCCAGATGAGGTGTTGTTTGG + Intergenic
1150381218 17:64721423-64721445 TAGCCAGAAGTGGAATTGTTGGG - Intergenic
1150596028 17:66605575-66605597 TACCTAGAAGAGGAATTGTTGGG - Intronic
1151809898 17:76433064-76433086 TACCCAGGAGAGGAGTTGTTGGG - Intronic
1152989285 18:348589-348611 TACCTAGAAGAGGATTCCATTGG + Intronic
1160807182 19:997211-997233 TACCCAGAAGTGGACTCGCTGGG - Intronic
925861215 2:8177647-8177669 TAGCCCGAAGAAGATGTGTTGGG + Intergenic
929017212 2:37510297-37510319 TACCCAGAAGAGGAATTGCTGGG - Intergenic
929494987 2:42433239-42433261 TAGCTATAATAGGATTCTTTAGG - Intergenic
936602017 2:113906009-113906031 TACCCAGAAGTGGAATTGTTGGG + Intronic
937406539 2:121634585-121634607 TGGCCAAAGGAGGATTTGTTTGG - Intronic
940549422 2:155134053-155134075 TAGCTAGAAGTGGAATTGTTGGG - Intergenic
941033147 2:160536111-160536133 TTCCCAGGAGAGGATTGGTTGGG + Intergenic
944681487 2:202081361-202081383 TACCCAGAAGTGGAATTGTTTGG + Intronic
945181160 2:207092531-207092553 TAGCCAGATGAGGGCTCGTAAGG + Intronic
948323536 2:237091989-237092011 AAGACAGAAGAGGATTCGAAAGG + Intronic
1171210717 20:23314858-23314880 TAGCCCTAAGAGGCTTCGCTGGG + Intergenic
1173164078 20:40673963-40673985 CAGCCAGAAGAGGAGAAGTTGGG + Intergenic
953750462 3:45604672-45604694 TGGCCAGAAGAACATCCGTTGGG - Intronic
954825944 3:53373499-53373521 TGGCCAGAAGATGATTCTTAAGG + Intergenic
959140516 3:102480936-102480958 TAGCCAGAAGAGGATTCGTTTGG + Intergenic
964062824 3:152544870-152544892 TGTCCAGAAGAGTATTCCTTAGG - Intergenic
974303288 4:60098150-60098172 GAGCCAGAAGAGGAATGGTATGG - Intergenic
975390224 4:73807529-73807551 TACCCAGAATAGTATTCCTTAGG - Intergenic
978047265 4:104145740-104145762 TATCCAGAAGAGGTTTCCCTAGG + Intergenic
983875297 4:172868029-172868051 AGGCCAGAAGAGGATCCTTTGGG + Intronic
987104763 5:14627184-14627206 TATCCAGAAGAGGAATTGTTCGG - Intergenic
988497179 5:31755335-31755357 AAGCCTGAAGAGGTTTCTTTGGG + Intronic
990904077 5:60784458-60784480 TAGCTATAAGAGGATTTATTTGG - Intronic
994184597 5:96804244-96804266 TAGGCAGAAAAGGAATCATTAGG + Intronic
996470614 5:123855885-123855907 CAGCCAGAAAAGGAATTGTTTGG - Intergenic
998684655 5:144510012-144510034 TAGCCTGAATAGTATTAGTTAGG + Intergenic
1000719446 5:164688612-164688634 TAGCCTTAATAGGATTAGTTTGG + Intergenic
1003009010 6:2409108-2409130 GAGCCAGAGGAGGATTTGTGAGG + Intergenic
1007147410 6:39649514-39649536 TAGCTAGCAGAGCATTTGTTTGG + Intronic
1008789934 6:55217938-55217960 TATACAGAAGGGGATTTGTTAGG + Intronic
1009240594 6:61181678-61181700 TAGTCATAAGAGGATCAGTTTGG + Intergenic
1014081934 6:117297276-117297298 TATCCAGAAGAGTTTTCCTTAGG - Intronic
1015847090 6:137532023-137532045 AGGCAAGAAGAGGATTTGTTTGG + Intergenic
1018787803 6:167121772-167121794 TAGTCAGGAGAGGCTTTGTTTGG + Intergenic
1020533800 7:9368356-9368378 GAGCCATTAGAGGATTCTTTGGG - Intergenic
1022172907 7:27846559-27846581 TAACCAGAAGAGGGATTGTTGGG + Intronic
1023215864 7:37861900-37861922 TAGCTAAAAGAGGATTCATGAGG + Intronic
1025159265 7:56639526-56639548 TAGCCACAAGAGAATTCATATGG - Intergenic
1025727269 7:64078117-64078139 TAGCCACAAGAGAATTCATATGG + Intronic
1027798483 7:82722789-82722811 TAGCCAGCAGAGGAGGAGTTTGG - Intergenic
1028654751 7:93191954-93191976 TACCCAGATGTGGATTCCTTGGG + Intronic
1030472981 7:109990846-109990868 TAGCCTGAAAATGATTTGTTGGG + Intergenic
1034685638 7:152968489-152968511 AAGCCAGGAGGGGATTAGTTTGG - Intergenic
1035478883 7:159165671-159165693 TACCTAGCAGAGGAATCGTTAGG - Intergenic
1035747407 8:1972320-1972342 TAGCCAGGTGAGGCTTTGTTTGG + Intergenic
1038055735 8:23856025-23856047 GAGCCAGAAGAGGACTTCTTAGG + Intergenic
1040371959 8:46785638-46785660 TAACCAGAAGAGAATTCATGTGG + Intergenic
1042322001 8:67485712-67485734 TAGCCAGGAATGGATTTGTTGGG + Intronic
1043137976 8:76551518-76551540 TACCCAGAAGAGGTATGGTTGGG - Intergenic
1047051381 8:121117114-121117136 AAGCAAGAAGGGGATTGGTTGGG - Intergenic
1047709264 8:127534384-127534406 TAGCCACAAGAGGAATTCTTTGG - Intergenic
1052511748 9:29431032-29431054 TACCCAGAAGAGGAATTGCTGGG + Intergenic
1053141597 9:35685916-35685938 TGGGCAGAAGATGATTGGTTGGG - Intronic
1056774875 9:89504301-89504323 TATCCAGAAGAGGAATTGCTGGG - Intergenic
1057286498 9:93759612-93759634 TACCCAGAAGTGGAATAGTTGGG - Intergenic
1058732356 9:107862335-107862357 AAGCCAGAAAAGGATTCCTTAGG - Intergenic
1185684782 X:1919329-1919351 TTGACAGAAGAGGATTGATTTGG - Intergenic
1186881981 X:13875503-13875525 TAGCTAGAAGTGGAATTGTTGGG - Intronic
1188065398 X:25653085-25653107 TACCCAGAAGAGGAATTGCTGGG + Intergenic
1192906212 X:75553948-75553970 TACCCAGAAGAGGAATTGCTGGG + Intergenic
1193382386 X:80830379-80830401 TATCCAGAAGTGGAATTGTTGGG - Intergenic
1195500913 X:105597936-105597958 TACCCAGAAGAGGAATTGTTGGG - Intronic
1197726191 X:129778007-129778029 TATCCAGAAGAGGAATTGCTGGG - Intergenic
1200854995 Y:7928163-7928185 CAGGCAGAAGAGGCTTCTTTAGG + Intergenic
1202268897 Y:23050842-23050864 TAACCACAAGAGAATTCGTATGG + Intergenic
1202421889 Y:24684582-24684604 TAACCACAAGAGAATTCGTATGG + Intergenic
1202448897 Y:24985496-24985518 TAACCACAAGAGAATTCGTATGG - Intergenic